ID: 905951081

View in Genome Browser
Species Human (GRCh38)
Location 1:41951439-41951461
Sequence GATTTCTGGTGTGCTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905951081 Original CRISPR GATTTCTGGTGTGCTGAAAT TGG Intronic
900094633 1:935316-935338 GTTTCCTCGTGTGCAGAAATCGG + Intronic
900943560 1:5816841-5816863 GATTACTGGTGTGTGGACATGGG + Intergenic
903139346 1:21329728-21329750 GATTTGTGGTGTGCTGAGAAGGG - Intronic
905951081 1:41951439-41951461 GATTTCTGGTGTGCTGAAATTGG + Intronic
906647319 1:47484557-47484579 GAGTTCTGTTGGGCTGAAATTGG - Intergenic
907026142 1:51121563-51121585 GAGTTCTTTTGTACTGAAATTGG - Intronic
909120074 1:71591866-71591888 CATTTCTGTTTTGCAGAAATGGG - Intronic
909803048 1:79838022-79838044 GTTTTCTGCTGATCTGAAATAGG + Intergenic
910057996 1:83054677-83054699 GATTTGTAGTGTGCTGGAAATGG + Intergenic
910334850 1:86115896-86115918 ACTTCCTGGTGTGCTGCAATTGG - Intronic
911523248 1:98953502-98953524 GCTTTCTGGAGTGGTGAAAGTGG + Intronic
912853826 1:113149604-113149626 GGTTTCTGGTCTGCTAAAAGAGG - Intergenic
915753159 1:158231360-158231382 GATTTCTCCAGTGCTGAAAGTGG - Intergenic
917278485 1:173356189-173356211 GATGTCTGGTGTCCTGGAATAGG - Intergenic
917695061 1:177513868-177513890 AATTTGTGCTGTGCAGAAATTGG - Intergenic
918776055 1:188631972-188631994 GATGAGTGATGTGCTGAAATAGG + Intergenic
924074546 1:240319787-240319809 TATTTCTCGAATGCTGAAATAGG - Intronic
924440136 1:244079045-244079067 CATTACTTGTGTGCTGTAATAGG + Intergenic
1063728323 10:8665578-8665600 GCTTTCTGGTTTACTGCAATGGG + Intergenic
1065078472 10:22104127-22104149 GCATTCTGGTGTGCTGCTATTGG - Intergenic
1065105953 10:22385039-22385061 TATTCCAGGTGTGCTTAAATAGG + Intronic
1066391063 10:34977628-34977650 TAATTCTGGGGGGCTGAAATGGG + Intergenic
1070705643 10:78636012-78636034 GGTGTCAGGTGTGCTGAAACTGG + Intergenic
1071056751 10:81520304-81520326 GATTTCTCGTGTTCTGACATGGG - Intergenic
1072128467 10:92468800-92468822 GATTACAGGTGGGCTGAATTTGG - Intronic
1072701161 10:97642059-97642081 ATTTTCAGGTGTGCTGCAATGGG + Intronic
1073614632 10:104981125-104981147 GATTTCTGGTCAGCTTAATTTGG + Intronic
1075411438 10:122231455-122231477 GATGTCTGGTGTGCGGAGAGTGG + Intronic
1076045234 10:127287724-127287746 GCTTGCTGGTGTGATGCAATGGG - Intronic
1078149612 11:8747619-8747641 CATATCTTGTGAGCTGAAATGGG + Intronic
1078467624 11:11561876-11561898 GATCTGTGGTGAGGTGAAATGGG - Intronic
1079457483 11:20649591-20649613 TATTTGTGGTGTGCTGGAATAGG + Intronic
1080754918 11:35188003-35188025 GATTTCTAAAGTGCTGGAATAGG - Intronic
1082944432 11:58742739-58742761 CATTTCTTCTGGGCTGAAATTGG - Intergenic
1083412041 11:62500623-62500645 GATTTCTGGTATGATCAACTGGG - Intronic
1083422903 11:62565642-62565664 GATTTTTGGTGTGTGTAAATAGG - Intronic
1085802778 11:79606222-79606244 GAATACTGGAGTCCTGAAATTGG + Intergenic
1087544011 11:99560729-99560751 GATTTTAGGAGTGCTGACATGGG - Intronic
1094266829 12:28569152-28569174 GATTTATGATTGGCTGAAATGGG + Intronic
1094635637 12:32225054-32225076 GATTTCTGAAGTGGTGAAACTGG - Intronic
1094784813 12:33835474-33835496 GCCTTCTGCTGTACTGAAATAGG + Intergenic
1099119872 12:78675438-78675460 GATTTCTGGGATGCTGAACAGGG - Intergenic
1099315412 12:81077771-81077793 GAGTACTTGTGTGTTGAAATCGG + Exonic
1099900482 12:88704932-88704954 TATTTTTGGTGTACTAAAATAGG - Intergenic
1101210131 12:102527071-102527093 GTTTTCTGGTGTGTTTAATTGGG + Intergenic
1101490188 12:105203068-105203090 GAGTTCTGGAGTACAGAAATAGG - Intronic
1101623028 12:106408620-106408642 GATCTCCGGAGTTCTGAAATAGG + Intronic
1102011143 12:109619263-109619285 GCTTTCTGGGCTGCTGACATTGG - Intergenic
1105968309 13:25404642-25404664 GATTTCTGGTTTGCGCAACTGGG + Intronic
1106830426 13:33575492-33575514 GATTTCTGCTGTGGTGATGTTGG + Intergenic
1107147852 13:37078535-37078557 AATTAGTGGTGTGCTGGAATTGG - Intergenic
1108041246 13:46341036-46341058 GATGTCTGGTGTGTTGACCTGGG - Intergenic
1108342853 13:49514878-49514900 GATTTTGGGTGTGATGAGATGGG + Intronic
1109770721 13:66968723-66968745 GGTTTCTGGTGTTGTGATATGGG - Intronic
1109842836 13:67943271-67943293 TATTTCAGCTGTGCTGAATTAGG + Intergenic
1110197098 13:72802598-72802620 GATTTCTGTTCAGCTGAGATAGG + Intronic
1113887673 13:113669487-113669509 CATGTCTGGTTTTCTGAAATGGG + Intronic
1114534565 14:23414707-23414729 GCTTTCTGGTGAGCTGTACTGGG + Intronic
1116677411 14:47923604-47923626 GAATTCTGGTGTGGTGCAAAGGG - Intergenic
1117757931 14:58995742-58995764 AATCTCTGGTGTTCTGAACTTGG - Intergenic
1120441726 14:84549512-84549534 GATTTCTGGTCTCCAGAACTAGG + Intergenic
1124051949 15:26204924-26204946 TTTTTCTTGTGTGCTTAAATGGG - Intergenic
1126012355 15:44315246-44315268 TATTTCTGGTGTGGAGAAAAAGG + Intronic
1126183619 15:45809978-45810000 GATTTCTGGTGTGGGGGAATGGG + Intergenic
1128802130 15:70503659-70503681 GATTTGTGGTGTGAAGAAAAGGG - Intergenic
1137064113 16:35819718-35819740 AATTTTTTGTGTGCTCAAATTGG + Intergenic
1137602767 16:49767924-49767946 GGTTTCTGTTGTAATGAAATTGG - Intronic
1140964451 16:79951306-79951328 GCTGTCTGGTGAACTGAAATTGG + Intergenic
1141967666 16:87457840-87457862 GGTTTCTGTTGTCCGGAAATTGG - Intronic
1142814087 17:2411837-2411859 GGTTATTGCTGTGCTGAAATAGG - Intronic
1143761882 17:9110672-9110694 GACTTCTGGCCTCCTGAAATAGG - Intronic
1143858784 17:9872755-9872777 GCTTTCTGGTGTGTAAAAATGGG + Intronic
1144016762 17:11203652-11203674 GATTTCTGGCCTGCAGAACTGGG - Intergenic
1144579016 17:16447609-16447631 AATTCCTGGTGTGCTAAAGTGGG - Intronic
1145886826 17:28387858-28387880 GATTTGGGGTGTGTTGAATTTGG + Intronic
1147542016 17:41368291-41368313 GGTTTCTGGGATGCTAAAATGGG + Intronic
1148931545 17:51131090-51131112 GATTTCTGGTTTGAGTAAATGGG + Intergenic
1149283218 17:55131320-55131342 GAATTCTGGTATGCTGGTATGGG + Intronic
1150319191 17:64196825-64196847 GAGTCATGATGTGCTGAAATTGG + Intronic
1156563013 18:38150779-38150801 TATTTCTGGTGTGGTGGCATGGG - Intergenic
1158523289 18:58189595-58189617 GAATTCAGGTGTGTTGAAGTGGG + Intronic
1159844366 18:73440687-73440709 GAATTCTGGTGGGCTCAATTGGG - Intergenic
1163847176 19:19644142-19644164 GCTCCCTGGTGTGCTGTAATTGG - Intergenic
1166208472 19:41289388-41289410 TCTTTATGGTTTGCTGAAATGGG - Intronic
925487179 2:4348412-4348434 TATCTCAGGTGTGCAGAAATGGG + Intergenic
925628637 2:5866915-5866937 GATTTTTGGCTTTCTGAAATTGG - Intergenic
927130975 2:20060252-20060274 GATTTCTTGTCTGCTGATATTGG + Intergenic
930412087 2:51037482-51037504 GATTTCTAGGGGGCAGAAATAGG - Intergenic
930828366 2:55716903-55716925 AATTTCTGGTTTGCAGAATTAGG + Intergenic
932333666 2:70916854-70916876 GATTTCAGCTGGGCTGAAATGGG + Intronic
934092088 2:88560711-88560733 TATTTCTGGTGTTCTGAAAATGG + Intronic
935468051 2:103422926-103422948 CATTTCTGCTCTGCTAAAATAGG + Intergenic
936913999 2:117621033-117621055 TATTTCTGATTTTCTGAAATGGG - Intergenic
936968264 2:118148538-118148560 GATTTCTGGGCTGCTTAAAAAGG + Intergenic
937048199 2:118864261-118864283 GGTTTCTGCTGGGCAGAAATTGG - Intergenic
939351227 2:141040576-141040598 TATTTCTGGAGTTCTGAAGTGGG + Intronic
942613136 2:177762656-177762678 GAATTCTGCTGTGCTAACATGGG + Intronic
943290139 2:186060318-186060340 GATTTCTGCTGTGCTCAAGTAGG + Intergenic
944502314 2:200374759-200374781 GATTACTTGTTTGGTGAAATAGG - Intronic
945974272 2:216258625-216258647 GATTTCAGGTGGGCTAAAAGAGG - Exonic
946807347 2:223484434-223484456 GTTTTCTGGTTTCCTGACATTGG + Intergenic
947948805 2:234129884-234129906 GATTTCAGGTGTGTTCTAATGGG + Intergenic
1169350308 20:4863266-4863288 GATTTCCGGTGTGGGGAAGTTGG - Intronic
1175134574 20:56813380-56813402 GAATTCTGTTGTCCTGTAATGGG - Intergenic
1175752896 20:61511263-61511285 GATTTCTGGTGGTGTGAAGTGGG - Intronic
1177221712 21:18202322-18202344 GACTTCTAGTGTGCTGTATTTGG + Intronic
1178085121 21:29104713-29104735 GCTTCCTGGAGTGCTGTAATTGG - Intronic
1178713637 21:34943377-34943399 GAGTTATTGTGTGCTGGAATGGG - Intronic
1182930492 22:34169213-34169235 GATTTATGTTGTGGTGAGATAGG + Intergenic
1183702890 22:39459738-39459760 GATTCCAGGTGTGATCAAATGGG + Intronic
949431170 3:3977560-3977582 GATTTCTGGTCTGTAGAAATGGG - Intronic
949938169 3:9133549-9133571 GAATTCTAGTGTGCTGTAAAAGG - Intronic
951800357 3:26588986-26589008 GTTTTCTGTTGTGCAGAAAATGG - Intergenic
952237583 3:31496051-31496073 GATTTCAGGGGTACTCAAATAGG + Intergenic
953695866 3:45158604-45158626 GAGGTCTGGTGTGCTGACATGGG + Intergenic
954819270 3:53311238-53311260 AAGTTCTGGTGAGGTGAAATAGG + Intronic
955078150 3:55633143-55633165 TATTTATTGTGTGCTGATATCGG - Intronic
955532794 3:59891576-59891598 GCTTCCTGGTGTGAAGAAATTGG - Intronic
957901520 3:86500029-86500051 TATTTTTGGTGTTCTGAATTGGG - Intergenic
959279059 3:104315181-104315203 GTTTTCTGATGTGCTGATTTTGG - Intergenic
959441224 3:106377852-106377874 TATATCTGTTGTGCTGAGATTGG + Intergenic
960032204 3:113065461-113065483 GGTCTGTGGTGTGCTGTAATTGG + Intergenic
963717568 3:148821516-148821538 GGCTTGTGGTGTGCTGTAATTGG - Intronic
967525465 3:190487636-190487658 GAGTTCTGGCTTGCTGAATTGGG + Intergenic
967688512 3:192445584-192445606 GATCTCTGATGAGCTAAAATAGG - Intronic
968354748 3:198096851-198096873 GATGTCAGGTGTCCTGAAAGAGG - Intergenic
969278795 4:6155101-6155123 GTGTTGGGGTGTGCTGAAATTGG + Intronic
974159656 4:58121579-58121601 TAATTCTGGTGTTCTGGAATTGG - Intergenic
980543118 4:134219930-134219952 CATTTCTGCTGTGCTGTAAGAGG - Intergenic
983415779 4:167452285-167452307 GATTTCTGGTATGTTAAAATGGG + Intergenic
983520359 4:168702141-168702163 GATTTCTTGTGTCCTGAACTAGG + Intronic
985097285 4:186425763-186425785 CATTTCAGGTGTGCTGAAGGTGG + Intergenic
985837973 5:2284227-2284249 GATTTGTGATGAGCTGATATGGG + Intergenic
988835753 5:35030638-35030660 GATTTCTGGTATTGTCAAATTGG + Intronic
989202622 5:38779836-38779858 GATTTCTGGTTTTCTTAAAATGG + Intergenic
989549946 5:42722725-42722747 GATTAATGGTGTGTTGAAAATGG + Intergenic
990227452 5:53671331-53671353 GAAGGCTGGTGTTCTGAAATTGG + Intronic
993202472 5:84833884-84833906 GATTTCAGGTGTCCTGAAAGAGG + Intergenic
994488247 5:100407005-100407027 AATTTCTGGGGTCTTGAAATGGG + Intergenic
995072279 5:107938176-107938198 GCTTTATGGTGACCTGAAATGGG + Intronic
1000956684 5:167552303-167552325 GTTTTCTGATGTACTGAAAAAGG - Intronic
1001459310 5:171895622-171895644 GAGTTCTGGTATTCTGAACTTGG - Intronic
1001591037 5:172865576-172865598 GCTTTCTGGGGTACTGAAAGTGG - Intronic
1002931389 6:1637381-1637403 CAGTTCTGGTGTGCTGAACAAGG + Intronic
1004160331 6:13207159-13207181 TATTCCTGGTGTGGTGAAATGGG + Intronic
1004445146 6:15691122-15691144 GATTTTTGTTCTGCTGAATTTGG - Intergenic
1008008136 6:46434302-46434324 AATTTCTGGTGTCCTGAGAGTGG + Intronic
1009188981 6:60606671-60606693 GATTTGTGGTGGCATGAAATGGG + Intergenic
1009445963 6:63742452-63742474 AATTTCTGCTGAGCTGACATTGG - Intronic
1009815608 6:68729847-68729869 GATTTTTGGTGTCCAGAAGTAGG - Intronic
1013701716 6:112779018-112779040 CTGTTCTGTTGTGCTGAAATAGG - Intergenic
1015676034 6:135750383-135750405 GATTTCTAGTCTCCAGAAATGGG - Intergenic
1016236954 6:141879343-141879365 GATTTATGGAGTCATGAAATTGG - Intergenic
1017247770 6:152245704-152245726 GATTTCTGTTGCTCTGAAGTGGG - Intronic
1018521016 6:164652317-164652339 GTTTTCTGGTGTGCAGGAGTGGG + Intergenic
1019574664 7:1731412-1731434 GATTGATATTGTGCTGAAATTGG + Intronic
1019979790 7:4613145-4613167 GATTTCTGGTCAGCAGATATGGG - Intergenic
1020504790 7:8971192-8971214 GATTTCTGCTGTTGTGAAACAGG + Intergenic
1021290918 7:18844400-18844422 CAATTCTGCTGTGCTTAAATGGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023559426 7:41458475-41458497 GATTTCTTTTGTGATGAAAATGG + Intergenic
1023559495 7:41459043-41459065 GATTTCTTTTGTGATGAAAATGG - Intergenic
1023602569 7:41894473-41894495 GATTTTTGGTTTGATGCAATTGG + Intergenic
1023621337 7:42076301-42076323 GACTTCTGGTGTACTTACATAGG + Intronic
1023917103 7:44597663-44597685 GCTGTTTGGGGTGCTGAAATGGG - Intergenic
1024903099 7:54344805-54344827 AATTTCTGCTCTGCTGAAAGAGG - Intergenic
1025172333 7:56770741-56770763 GCTTTCTGGAATGCTGGAATTGG + Intergenic
1025699534 7:63804794-63804816 GCTTTCTGGAGTGCTGGCATTGG - Intergenic
1025831564 7:65055736-65055758 GCTTTCTGGAGTGCTGGCATTGG - Intergenic
1025918705 7:65889627-65889649 GCTTTCTGGAGTGCTGGCATTGG - Intronic
1025974577 7:66359511-66359533 GATTCCTCGTGTGAAGAAATGGG - Intronic
1028691258 7:93653914-93653936 AATTTCTGGTGTGTTGGAAAAGG - Intronic
1032448129 7:132002293-132002315 CATTTCTGGTGTTCTGGAAGAGG + Intergenic
1037324372 8:17673790-17673812 GATTTCTGCTGTGGTGAAGGTGG + Intronic
1039042421 8:33420571-33420593 GATTTCTGATGTAATAAAATTGG + Intronic
1039376539 8:37040218-37040240 AATTTCTGGTATGCTGAAACTGG + Intergenic
1039392131 8:37189804-37189826 GATTGCTTGAGTGCAGAAATTGG + Intergenic
1040371929 8:46785297-46785319 GATTTCTCTTGTGCTGAATAAGG - Intergenic
1043188925 8:77192175-77192197 GATTTCTGTTTTTCTGAATTTGG - Intergenic
1045169904 8:99653997-99654019 GATTTTTGCTGTCCTGACATTGG + Intronic
1048708192 8:137178267-137178289 GATTTCTATTGTACTAAAATAGG + Intergenic
1058586091 9:106507582-106507604 GATTTCTGGTGTGGTCTATTAGG - Intergenic
1059984938 9:119812659-119812681 GATTTCCAGGGTCCTGAAATTGG - Intergenic
1061522488 9:131127431-131127453 TATTTTTGTTGTACTGAAATTGG + Intronic
1185527430 X:790686-790708 GATGTCTGATGGGCTGAAATTGG + Intergenic
1185677308 X:1859419-1859441 GACTTCTGGTCTGCAGAAATGGG - Intergenic
1187905687 X:24064230-24064252 TATTTCAGCTGAGCTGAAATTGG - Exonic
1192221762 X:69202174-69202196 GCCTTCTGGAGTGCTGAAAATGG - Intergenic
1192910152 X:75595116-75595138 TATTTCTGGTGGGCTTAATTTGG - Intergenic
1193357593 X:80539579-80539601 GAATTCTGAAATGCTGAAATTGG - Intergenic
1196437204 X:115685527-115685549 GAGATCTGGTCTTCTGAAATAGG + Intergenic
1199910958 X:152286365-152286387 GGTGTCTGGTAGGCTGAAATGGG - Intronic