ID: 905952211

View in Genome Browser
Species Human (GRCh38)
Location 1:41961384-41961406
Sequence TGCCATAGCAATAGTAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905952209_905952211 -1 Left 905952209 1:41961362-41961384 CCACTAAATTCCAGGGAATTTTT 0: 1
1: 0
2: 1
3: 34
4: 347
Right 905952211 1:41961384-41961406 TGCCATAGCAATAGTAACCAAGG 0: 1
1: 0
2: 1
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905952211 Original CRISPR TGCCATAGCAATAGTAACCA AGG Intronic
903180799 1:21603840-21603862 TGCCATAGGCATAGGAACCGTGG - Intronic
905952211 1:41961384-41961406 TGCCATAGCAATAGTAACCAAGG + Intronic
907643577 1:56217826-56217848 TGCAACAGCAATAGTAACACAGG - Intergenic
908731545 1:67231157-67231179 TGTCAAAGCCACAGTAACCAAGG - Intronic
913038328 1:114997125-114997147 TGCCATAGCAACAGGAAAAAAGG + Intergenic
913040855 1:115021443-115021465 AGACACAGCAATAGAAACCATGG - Intergenic
913495867 1:119427692-119427714 TGTGAGAGCAATAGTAGCCATGG - Intergenic
914720600 1:150285654-150285676 AGTCACAGCAATAATAACCATGG - Intronic
917701276 1:177584009-177584031 TGCCATAGGAAAAGTCACCCAGG + Intergenic
918503116 1:185220461-185220483 TGCAATAACAATAGAAGCCAAGG - Intronic
919365783 1:196659320-196659342 TGCCATAGCAAAAGTATTTAAGG - Intronic
923203087 1:231731465-231731487 TGCCATGGCAATGGTAAACATGG + Intronic
1065662969 10:28025399-28025421 TGCTATAACAAAAATAACCATGG + Intergenic
1068267420 10:54670701-54670723 TATAATAGCAATAGTAAACATGG - Intronic
1078322350 11:10347878-10347900 TGCCATAGGAATCCTAACCCTGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1088494940 11:110423239-110423261 TGTGAGAGCAATAGCAACCATGG + Intergenic
1088984269 11:114891838-114891860 TCCAACAGCAATGGTAACCAGGG - Intergenic
1091043243 11:132301857-132301879 TGCCATAAAAATATTAAGCAAGG + Intronic
1091875112 12:3927257-3927279 TGCAATAGGAATAGTAATGATGG - Intergenic
1092046010 12:5432323-5432345 TACCGTGGCAAAAGTAACCATGG - Exonic
1093499162 12:19791402-19791424 TGCCAATTCATTAGTAACCAGGG + Intergenic
1094091692 12:26657045-26657067 TGCTATAGCTGTAGAAACCAGGG + Intronic
1095358122 12:41301704-41301726 TGGCATAGCAAGAGAAAACAAGG + Intronic
1095680495 12:44969492-44969514 TGCAGTAGCAAGAGAAACCATGG - Intergenic
1097721389 12:63025311-63025333 TTCCAGAGCAAAAGCAACCAAGG - Intergenic
1098041207 12:66355651-66355673 TTCCAAAGCAATACTCACCAGGG + Intronic
1098080897 12:66784630-66784652 TGCTATAGCATCACTAACCATGG + Intronic
1098834440 12:75404754-75404776 TGCCATAAGAATAGTTAACAAGG + Intronic
1099646546 12:85365242-85365264 TGCAATAGCCATAGTAACCTAGG - Intergenic
1101500782 12:105301829-105301851 TGCCACAGAAAAAGTAACAAAGG + Intronic
1104206607 12:126644519-126644541 TTCCTTGGCAAAAGTAACCAAGG - Intergenic
1106928959 13:34643048-34643070 TGCCTTGGCAATAGAAACGAGGG + Intergenic
1108096970 13:46912623-46912645 TGCCATGGCAATGGTAAACATGG + Intergenic
1115425441 14:33253703-33253725 TGCCAGAGTAACAGAAACCAGGG - Intronic
1116071462 14:40051646-40051668 GGACATTGGAATAGTAACCAGGG - Intergenic
1138622439 16:58222765-58222787 TTCCAGATCAATAGAAACCAGGG + Intergenic
1138808161 16:60117454-60117476 GCCCATAACTATAGTAACCAAGG - Intergenic
1139946716 16:70647036-70647058 TGCCGTAACCATAGCAACCAGGG + Intronic
1147539171 17:41342667-41342689 TTCCATAGCAATAGTTTCAAGGG + Intergenic
1152838713 17:82552391-82552413 TGCCATAGCAGTTCTCACCAGGG - Intronic
1155372468 18:25116237-25116259 TGCCATTGGAATAGAATCCAGGG + Intronic
1157269826 18:46264471-46264493 GGCCATAGCAACGGTAACAATGG - Exonic
1158916921 18:62141834-62141856 TTATATAGCAATAGAAACCATGG - Intronic
1159472615 18:68877814-68877836 TGCCATACTCATATTAACCAGGG - Intronic
1162835782 19:13316939-13316961 TGTCATAGCAACAGTAACATTGG + Intronic
1165377708 19:35454793-35454815 TGCCATGGCCACAGTAAACATGG + Intergenic
925243723 2:2359969-2359991 TGCCACAGCAAGAGGAACCTAGG - Intergenic
925847371 2:8045935-8045957 TGGCATTGCAAAAGTAACAATGG + Intergenic
926401647 2:12503189-12503211 TGCCATAGAAATAGATAACATGG + Intergenic
927607847 2:24504324-24504346 GGCCAAAGCCACAGTAACCAAGG - Intronic
928806815 2:35168353-35168375 TTCCTTAGCAATAATTACCAAGG + Intergenic
930323940 2:49889277-49889299 TTACATAGCAATAGAAACCATGG - Intergenic
933118360 2:78502320-78502342 GCCCATATCAATAGTAACCTTGG + Intergenic
933187264 2:79291865-79291887 TGCCATGGCAATAGAAACCATGG - Intronic
940521276 2:154752281-154752303 TGCAATAGCAATAGTCAACTAGG + Intronic
942840965 2:180360213-180360235 TCCCATGGCAATAGCAACTATGG + Intergenic
942886560 2:180931991-180932013 TGTCATAGCAATAATAATAATGG - Intergenic
945137136 2:206641412-206641434 TGCCAGCTCAATAGTATCCATGG - Intergenic
948505233 2:238423589-238423611 TGCCATAGCGTTAGCAGCCATGG + Intergenic
1169507582 20:6229493-6229515 TTTCATAGCAATTGTAACAACGG - Intergenic
1173272531 20:41550754-41550776 TGGCATAGCAGTACCAACCAAGG + Intronic
1173484501 20:43430493-43430515 TGCCATGGCAACGGTAAACATGG - Intergenic
1177058371 21:16338212-16338234 AGTCATAGCATTATTAACCATGG + Intergenic
1177093260 21:16797722-16797744 TGCCCTGGCAACAATAACCAGGG - Intergenic
1178182783 21:30182961-30182983 ACCCATGGCAATAGTAGCCATGG + Intergenic
1180851149 22:19021736-19021758 TGCAATAACAATAGGAACTAAGG + Intergenic
951830528 3:26921316-26921338 TGCCATAGGAACAGGAAACAGGG + Intergenic
954216188 3:49125762-49125784 GGCCAAAGCCATAGTAGCCAGGG + Exonic
955668966 3:61381894-61381916 TGCCATAGAAATAGGAGCTAAGG - Intergenic
955766787 3:62353057-62353079 TTCCACAGCAATAGTCACTATGG - Intergenic
955967734 3:64406454-64406476 TTCCATAGCAGCTGTAACCATGG - Intronic
956942656 3:74181589-74181611 TGCCAGAGTAATAGTTATCATGG - Intergenic
958468808 3:94492866-94492888 TGCTCCAGCAATGGTAACCAGGG - Intergenic
959439826 3:106361480-106361502 TTCCATAGCAATAGTTTCCAGGG + Intergenic
960337391 3:116435177-116435199 TACCAAAGCTATAGTAACCCAGG - Intronic
962807059 3:138935522-138935544 TGCCATCGAAATGTTAACCATGG + Intergenic
962981987 3:140498857-140498879 TCCAATGACAATAGTAACCAAGG - Intronic
966045232 3:175540623-175540645 GGCCATTGCAATAGTAATGATGG + Intronic
969895108 4:10296281-10296303 TCCCACAGCAATAGAAACCTAGG - Intergenic
973794461 4:54409855-54409877 TTCCATAGCAATAGTTTCAAGGG + Intergenic
974695070 4:65356841-65356863 TGACATAGCAATAATTAACATGG + Intronic
975168292 4:71202921-71202943 TCACATAACAAAAGTAACCATGG - Intronic
976297896 4:83489932-83489954 TGCCACAGCATCAGTGACCATGG + Intronic
977915680 4:102590091-102590113 TGCCAGAAAAACAGTAACCAAGG - Intronic
978404960 4:108369567-108369589 AGCCATAGCAGTAGTAATGATGG - Intergenic
978544850 4:109859904-109859926 TTCCATAGCAATAGTTTCAAGGG + Intronic
978919938 4:114171700-114171722 TGACATATTAATATTAACCAAGG - Intergenic
982846283 4:160256669-160256691 TTCCATAGCAATAGTTTTCAGGG + Intergenic
984597583 4:181688364-181688386 TTTTATAGCAATAGTAACTAGGG + Intergenic
987231476 5:15898108-15898130 TGCAATAGCTATACTAAACAAGG - Intronic
988881747 5:35511137-35511159 TCCCACAGCAAAAGTAACTATGG + Intergenic
989981728 5:50653894-50653916 TGCCATAGGTATAGGGACCATGG - Intergenic
991379488 5:66004911-66004933 TGCAATAGGAATAGAAGCCAGGG + Intronic
992883829 5:81138000-81138022 TGCTGTAGCTATAGGAACCAAGG + Intronic
997223742 5:132193304-132193326 TGCCATGGGAATAGCACCCAAGG + Intronic
999716697 5:154366860-154366882 AACAATAGCAATAGTAACCATGG + Intronic
1001728580 5:173929771-173929793 TAACATTGCAATAGAAACCAAGG - Intronic
1003354164 6:5350430-5350452 TGCTATAGCGATAGTAACGAAGG + Intronic
1007527729 6:42511523-42511545 AGCCATAGAAAAAATAACCATGG + Intergenic
1008062371 6:47012316-47012338 TTACATAACAATAGTAACAAAGG + Intronic
1012044545 6:94253742-94253764 TGCCTCAGTAATAGTAAACATGG + Intergenic
1015154797 6:130080751-130080773 TGCCATTACAATAGTAAAAATGG + Intronic
1017025703 6:150178692-150178714 TGCATCAGAAATAGTAACCAGGG + Intronic
1017208715 6:151831684-151831706 TGTTTTAGAAATAGTAACCAAGG - Intronic
1025870568 7:65428646-65428668 TGCCAAAGCAATTGCAACAAAGG + Intergenic
1028710033 7:93896345-93896367 TGCCAGAGGCTTAGTAACCAAGG - Intronic
1031136047 7:117885224-117885246 TTCTATAGCAATTGTCACCATGG - Intergenic
1032159921 7:129502456-129502478 TGCCCTGGCAACGGTAACCACGG + Intergenic
1033527299 7:142228893-142228915 TGCCATGGCAATGGTAAACTGGG + Intergenic
1035748966 8:1982036-1982058 TACCATAGCTGTATTAACCAGGG - Intronic
1037005081 8:13768149-13768171 TTCCGTAGCAATAGTTTCCAGGG + Intergenic
1038705072 8:29885896-29885918 TGCCATGGCAACAGTCACCATGG + Intergenic
1039951276 8:42174643-42174665 TGCCTTAGGAAAATTAACCAGGG - Intergenic
1043655558 8:82661209-82661231 TCCCATATCAATATTAACCTTGG - Intergenic
1044758501 8:95492156-95492178 TTCCATAGCAATAGAAACAGTGG - Intergenic
1047063226 8:121250995-121251017 AGCCAGAGCAACAGAAACCAAGG + Intergenic
1049490624 8:142899094-142899116 TTTCATGGGAATAGTAACCAGGG + Intronic
1052310916 9:27068224-27068246 TGCCATAGGAAAAGGAAACAAGG - Intergenic
1052594338 9:30539136-30539158 TTCCAAAGCCGTAGTAACCAAGG - Intergenic
1057202995 9:93153216-93153238 TGCAATACCATTAGTCACCAGGG - Intergenic
1058164562 9:101605435-101605457 TGCAAAAGTAAAAGTAACCATGG - Intronic
1058972204 9:110094124-110094146 TGCCAGTGCAATGGTAAGCAGGG - Intronic
1186227837 X:7420462-7420484 TGCCATAGTAATAGTTGCCTGGG + Intergenic
1186227889 X:7420839-7420861 TACCATAGTAATAGTTACCTTGG + Intergenic
1187089411 X:16079518-16079540 TGCTATATCAATTTTAACCATGG + Intergenic
1191689459 X:63925087-63925109 TGCCTTAGCAAAAGTAAAAATGG - Intergenic
1191978205 X:66896829-66896851 TGCCGTGGCAAAAGTAAGCATGG + Intergenic
1195311838 X:103639121-103639143 TGCCATGACAACAGTATCCAGGG - Intergenic
1197096306 X:122600020-122600042 TTCTATAGTAATAGTAGCCAAGG + Intergenic