ID: 905953740

View in Genome Browser
Species Human (GRCh38)
Location 1:41974911-41974933
Sequence GCCCTTCAGGACTGAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905953735_905953740 -3 Left 905953735 1:41974891-41974913 CCATTATCTCCACGCAACCTGCC 0: 1
1: 0
2: 1
3: 8
4: 106
Right 905953740 1:41974911-41974933 GCCCTTCAGGACTGAGGTGAAGG 0: 1
1: 0
2: 2
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905953740 Original CRISPR GCCCTTCAGGACTGAGGTGA AGG Intronic
901465632 1:9419111-9419133 GCCCTTGAGCACTGTGGTCAGGG - Intergenic
902111656 1:14084102-14084124 GCCCCTCTGGAGGGAGGTGATGG + Intergenic
904886046 1:33739180-33739202 CTCCTTCAGGACGCAGGTGATGG + Exonic
905345927 1:37311275-37311297 CTCCTCCAGGACTGAGGTCAGGG + Intergenic
905817754 1:40965235-40965257 GCCCTGGAGGACTGAGGACATGG + Intergenic
905953740 1:41974911-41974933 GCCCTTCAGGACTGAGGTGAAGG + Intronic
906210937 1:44011789-44011811 GGCCTGCAGGACTGAGCTGGTGG + Intronic
907268650 1:53277550-53277572 AACATTCAGGAGTGAGGTGATGG - Intronic
910370910 1:86514063-86514085 GCCCTTCAGGAATGAAGGGTTGG + Intergenic
911160000 1:94674632-94674654 GCACCTCAGTTCTGAGGTGAAGG - Intergenic
912048868 1:105497480-105497502 TCCTTTCAGGAGTGAGGTGCTGG - Intergenic
912956780 1:114159557-114159579 CCCCTACAGAACTGAGGTGTTGG + Intergenic
915356433 1:155257685-155257707 GCCCTTCTGGACTGCAATGAAGG + Intronic
915597461 1:156903749-156903771 GCAGTTCAGGAGTGAGGTGTAGG + Intronic
916017079 1:160759730-160759752 GCCCTTCAGGAATGAAGGTATGG - Intergenic
916132896 1:161626865-161626887 GGCCTTCAGGAATAAGCTGACGG + Intronic
916804994 1:168250604-168250626 GCCCTTCAGAACAGAAGAGATGG + Exonic
916929451 1:169560326-169560348 AACCTTAAGGACTGAGATGAAGG + Intronic
916984610 1:170177355-170177377 GCATTTCAGGAGAGAGGTGATGG + Intergenic
920746671 1:208635579-208635601 GCCATCCAGGACCGAGGTGCTGG + Intergenic
922380244 1:225016028-225016050 GCCCTTCAGGACAGGGCTTAAGG + Intronic
922557392 1:226542803-226542825 GCCCTTCATGACTGGGCTCAAGG + Intergenic
922907887 1:229189274-229189296 GCCCTTCAGGACTATGTTAAAGG - Intergenic
923550798 1:234961213-234961235 GCCCTTTGGGACTCAGGTGGTGG + Intergenic
1065469371 10:26061534-26061556 GCCCTTCTGTACGGAGCTGATGG + Intronic
1068257223 10:54528142-54528164 GTCCTTCAGGACAGAGATAATGG + Intronic
1070585694 10:77764241-77764263 CCCCTTCAGGACAGAGCAGAAGG - Intergenic
1070950334 10:80425940-80425962 GCACATCAGGACTGAAGTGAAGG + Exonic
1071413603 10:85420848-85420870 GCCCTTCAGGACAGGGGTCTGGG - Intergenic
1071925981 10:90409376-90409398 GCCCTTCATGACTGGGCTCAAGG + Intergenic
1075227106 10:120639556-120639578 CCACTGCAGGACAGAGGTGAGGG + Intergenic
1075266250 10:121001608-121001630 GCCTTTCAGGATGGTGGTGAGGG - Intergenic
1075532117 10:123238458-123238480 GACCTTCAGGACTCAGCTTAGGG + Intergenic
1075653374 10:124144968-124144990 GCCCTTCAGAAATCAGGGGAAGG + Intergenic
1075689274 10:124384812-124384834 TCCCTCCAGCACTGAGGTGCTGG - Intergenic
1076099762 10:127766713-127766735 GCCCTTCAGGACTCAGGAGTAGG - Intergenic
1076756486 10:132575215-132575237 GCCCTTCAGCACACAGGTCAGGG - Intronic
1078145545 11:8719697-8719719 GCCCTGCAGGAGTGAGGAGGTGG + Intronic
1079690392 11:23409716-23409738 GAACTTTTGGACTGAGGTGATGG + Intergenic
1083224071 11:61273665-61273687 GCCCTTCAGGACTGAGTCAGGGG + Intronic
1084066587 11:66707871-66707893 GCCCTGCAGGACAGAGGAGCAGG - Intronic
1084999634 11:73019558-73019580 GCCCTTCAGAGATGAGATGAGGG + Intronic
1085528866 11:77179938-77179960 ACGCCTCAGGGCTGAGGTGAGGG + Exonic
1089905720 11:122036296-122036318 GCCCTCCATGACTGAGGAGGTGG - Intergenic
1091014429 11:132037308-132037330 TCCCCTCATGGCTGAGGTGAAGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092032071 12:5294550-5294572 CCCCTTCAGAACTGAGGTGAGGG - Intergenic
1092433938 12:8431390-8431412 GCCCCTCAGGACTCACTTGAAGG + Intergenic
1093256816 12:16878268-16878290 CACCTCCAGGACTGAGGAGAGGG + Intergenic
1093414715 12:18907049-18907071 GTGGTTCAGGAATGAGGTGAGGG - Intergenic
1095491321 12:42736842-42736864 GGGCTTCAGGAATGATGTGATGG + Intergenic
1097041013 12:56155966-56155988 TCCCTTGAGGACTGAGGCTATGG + Intronic
1097431474 12:59513735-59513757 GCACTTCAGGTCTGTGGTTAGGG - Intergenic
1097848719 12:64390817-64390839 GTCCTTCAGGCCCGAGTTGATGG + Exonic
1097894190 12:64807997-64808019 ACTTTCCAGGACTGAGGTGAGGG - Intronic
1102211157 12:111128277-111128299 TCCCTGAAGGACTGCGGTGAAGG - Intronic
1102261472 12:111445891-111445913 GCCCTTTTGGGCTGAGGTGGAGG + Intronic
1102469771 12:113153160-113153182 GACCTTCAGGACTCAGGAGCTGG - Intronic
1102518397 12:113464929-113464951 GCCCTGAAGGACTGACGTGGGGG + Intronic
1105668015 13:22581967-22581989 ACCATTCAGGACACAGGTGAGGG - Intergenic
1106558855 13:30832194-30832216 GCCCATCTGGGGTGAGGTGAGGG + Intergenic
1107017105 13:35716477-35716499 GCACTTCAGGTATGAGGTGGAGG + Intergenic
1108494170 13:51007850-51007872 GCCCATGAGGACTGTGGTGAAGG - Intergenic
1110303168 13:73952974-73952996 GCCTTTGATGACTGAGATGAAGG + Intronic
1112721974 13:102255816-102255838 GCCCTTTAGAAGTTAGGTGATGG - Intronic
1113422659 13:110182421-110182443 TCTGTTCAGGACTGAGGAGAAGG - Intronic
1114941177 14:27612490-27612512 GCCCTTCATGACTGGGCTTAAGG - Intergenic
1116408530 14:44595659-44595681 GCCCTTAAGAACTGAGGTTTAGG - Intergenic
1118002595 14:61537515-61537537 GCCCTTCTGGACCTAGATGAGGG - Intronic
1118764948 14:68903628-68903650 GCCCTTCAGCACTGAGCAGTTGG + Intronic
1119297271 14:73543108-73543130 GCCCTTCAGGAAAGAGGCCATGG - Exonic
1119301502 14:73574966-73574988 GCCCTTCAGGAAAGAGGCCATGG - Exonic
1120901492 14:89579557-89579579 GCCCATAAGCCCTGAGGTGATGG + Intronic
1121748051 14:96318285-96318307 ACCCCACAGGACTGAGGGGAGGG - Intronic
1121878682 14:97479435-97479457 CCCCTTCAGGACTCAGGTCCTGG - Intergenic
1122263841 14:100537797-100537819 GCCCTGTAGGCCTGAGGGGAGGG - Exonic
1122303805 14:100748617-100748639 GCCCTGAAGGCCTGTGGTGAGGG + Intergenic
1125089481 15:35773454-35773476 GCCATTAAGGGCTGAAGTGAGGG + Intergenic
1125131929 15:36292195-36292217 GCCCTTCATGACTGAGATGAAGG + Intergenic
1125728818 15:41881781-41881803 GCCACTGAGGACTGGGGTGAGGG + Intronic
1126141342 15:45441943-45441965 GCCCTTCCTGACTGAGCTCAAGG + Intronic
1126713195 15:51483966-51483988 GCTCCTCAGGCCTGAGGTGTGGG - Intronic
1127050936 15:55083211-55083233 GCCCGTCAGGAGTGAGGGGAGGG - Intergenic
1132558803 16:584289-584311 GCCCTTGAGGACTTTGGTGTAGG + Intergenic
1132690972 16:1181764-1181786 CCTCTTCAGGCCTGAGATGAGGG - Intronic
1133056000 16:3145763-3145785 GCCCTGGAGGCCTGAGGTGAGGG + Exonic
1134884283 16:17776000-17776022 GCCCTTCTGGAAGGAGGTGCAGG - Intergenic
1135604635 16:23812751-23812773 GACCTTCAGGAATGTGGTAAAGG - Intergenic
1136025178 16:27464250-27464272 GCCCATCAGGGCGGAGGGGAGGG + Intronic
1136411157 16:30078027-30078049 GCCAATCAGGACTGAGGGAAAGG - Intronic
1136587751 16:31198582-31198604 GCCCTTCAGGTGTTAGGGGAAGG + Intergenic
1137252972 16:46753277-46753299 GCCCTTCTGTGCTGAGGTGTGGG - Intronic
1138941055 16:61790510-61790532 GGCCTTCATGATTGAGGTGATGG + Intronic
1139340566 16:66265302-66265324 GCCCCACAGGCTTGAGGTGAAGG - Intergenic
1139491389 16:67287988-67288010 GCACTTCAGGACATAGTTGACGG - Exonic
1139655948 16:68387374-68387396 CCCCTTGCTGACTGAGGTGAGGG + Intronic
1140696083 16:77535624-77535646 GGCCTTCAGGGCTGAGGTTCAGG + Intergenic
1144002186 17:11065381-11065403 ACCCTTCAGGCATGAGGTGCTGG + Intergenic
1145061377 17:19736418-19736440 TCCCTGTAGGACAGAGGTGAGGG + Intergenic
1146520563 17:33522357-33522379 TCCCTGCAGGAGTGAGCTGAAGG + Intronic
1147023947 17:37564275-37564297 GCCCTTCAGGTCTTATGTGCAGG + Intronic
1147213150 17:38883888-38883910 GCCCCTTAGGCCTGAGGGGATGG + Intronic
1151081998 17:71340237-71340259 GCCCTAAAGGACTATGGTGAAGG + Intergenic
1154023992 18:10689768-10689790 GCCCTTTTTGACTGAGCTGAGGG - Exonic
1156118508 18:33816159-33816181 TCCCTGCAGGACAGTGGTGAAGG + Intergenic
1156263303 18:35464359-35464381 ACCCTACAGGACTGGGGTGGGGG + Intronic
1160129473 18:76211840-76211862 TCCCTTCAGATCCGAGGTGACGG - Intergenic
1160387841 18:78507458-78507480 GCCCTGCAGGCCTGAGAGGAGGG + Intergenic
1160522913 18:79519016-79519038 GCCCTGCAGGACTGGGCAGAAGG + Intronic
1161593080 19:5137445-5137467 CCCCCTCAGGGCAGAGGTGAAGG - Intronic
1162907960 19:13834504-13834526 GACCTTCAGGAATGAAGTCAGGG + Intergenic
1163771315 19:19192814-19192836 GCCCTTTAAGACTTAGGGGAGGG - Intronic
1163885087 19:19958368-19958390 GCCCTTCACGACTGGGCTCAAGG - Intergenic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
1166203857 19:41256297-41256319 TCCCTTCTGGACTGGGATGAAGG + Intronic
1166220491 19:41361235-41361257 TCCCTTCTGGGCTGAGTTGAGGG + Intronic
1168436845 19:56324929-56324951 GCCCTTCACGACTGGGCTCAAGG - Intronic
924991656 2:317722-317744 GTCCTACAGGACAGAGGTCAAGG - Intergenic
925198975 2:1950947-1950969 GACATGCAGGAGTGAGGTGAGGG + Intronic
925839996 2:7982506-7982528 GCAGTTCAGGAATGAGGGGAGGG - Intergenic
927590282 2:24350167-24350189 GCCCCTGAGAACTGAGGAGACGG + Intronic
927816458 2:26221796-26221818 TCCCTTAAGGACAGTGGTGAAGG + Intronic
928108837 2:28490289-28490311 GCCCTTCAGGACTGCCAGGAGGG + Intronic
928116947 2:28552214-28552236 ACCCTTCAAGACTGAGGTCGTGG - Intronic
929245347 2:39696186-39696208 ATTCTTCAGGAGTGAGGTGATGG + Intronic
930097134 2:47573325-47573347 GCAATTCAGGGCTGAGGTAAAGG - Intergenic
930189535 2:48443224-48443246 TCCCTGCAGTTCTGAGGTGAGGG + Intronic
932612837 2:73212626-73212648 GCTCTTGGGGACTGAGCTGAGGG + Intergenic
932721086 2:74139398-74139420 TCTCTTCAGGAGTGAGGTGGGGG - Intronic
934305807 2:91821028-91821050 TCCCTGCAGGACAGTGGTGAAGG + Intergenic
934327449 2:92031714-92031736 TCCCTGCAGGACAGTGGTGAAGG - Intergenic
934744979 2:96753418-96753440 TCCTTGCAGGGCTGAGGTGAAGG + Intergenic
936176076 2:110221096-110221118 GCCCTTCATGACTGGGCTCAAGG + Intergenic
936836517 2:116717323-116717345 GCCCTTCATGACTGGGCTCAAGG - Intergenic
936836984 2:116721110-116721132 GCCCTTCATGACTGTGCTCAAGG - Intergenic
938850290 2:135252660-135252682 TGGCTTCAGGACAGAGGTGAAGG - Intronic
942381026 2:175390833-175390855 GCCTCTCAGGACTGAGCTCATGG + Intergenic
944787530 2:203088459-203088481 GCAGTTCAGGAATGAGGGGAAGG + Intronic
946829322 2:223711982-223712004 GGCCTTGAGGACTGAGGACAGGG - Intergenic
948165036 2:235854471-235854493 GCCCTTCATCACAGAGGTGGGGG + Intronic
948465388 2:238149500-238149522 CCCCTTGAGGACAGGGGTGACGG + Intronic
1169195523 20:3680394-3680416 GCCCAGCAGGACTGAGGCCAGGG - Intronic
1169913139 20:10663370-10663392 GCCTTTCAGGACTGAGGGGTTGG - Intronic
1169999996 20:11605158-11605180 GCAGTTCAGGAATGAGGGGAAGG + Intergenic
1170587239 20:17744066-17744088 GCCTCCCAGGACTGAGATGAGGG + Intergenic
1170982378 20:21226782-21226804 GCCCTTTAGGACTCAGGTCAGGG + Intronic
1173594525 20:44250032-44250054 GCCCTTCAGGATTGGAGAGAAGG - Intronic
1173969033 20:47136809-47136831 GCCCTTCAGGAGAGAGGCTATGG - Intronic
1174663360 20:52234992-52235014 GCCCTTCAGGAGATAGGTGTGGG + Intergenic
1175152520 20:56946375-56946397 GCCCTTCATGACTCAGGACATGG - Intergenic
1176998218 21:15580618-15580640 TCCCTGCAGGACAGCGGTGAAGG + Intergenic
1177134831 21:17297610-17297632 GCACTTCTGGGCTGAGCTGAGGG + Intergenic
1177658789 21:24055580-24055602 TCCCTTCAGTAGTTAGGTGAAGG - Intergenic
1178220812 21:30657644-30657666 GACCATCAGGATTGAGGCGATGG + Intergenic
1181438215 22:22922517-22922539 CCACTTCAAGACTGAGGTCAGGG + Intergenic
1182098948 22:27644749-27644771 GCCCTTGGGGGCAGAGGTGAGGG - Intergenic
1182565209 22:31193450-31193472 GGACTTCAGGGCTGAGGAGATGG - Intronic
1183654896 22:39178949-39178971 GGCCTTCAGGGAGGAGGTGACGG + Intergenic
1184615413 22:45634727-45634749 GCCCTAGAGCACAGAGGTGAAGG - Intergenic
949905939 3:8858488-8858510 TCCCTGAAGGACTGTGGTGAAGG + Intronic
950652728 3:14417408-14417430 GGCCTGAAGGATTGAGGTGAAGG - Intronic
951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG + Intergenic
951419858 3:22471513-22471535 TCCCTCCAGGACTGAGGTCCTGG + Intergenic
954640378 3:52094204-52094226 GCTCTTCAGGACTGGGCAGATGG + Intronic
954841510 3:53515695-53515717 GCTCCTCAGGACCCAGGTGATGG + Intronic
959226725 3:103596843-103596865 TCCCTGAAGGACAGAGGTGAAGG - Intergenic
959745954 3:109776840-109776862 TCCCTGAAGGACAGAGGTGAAGG - Intergenic
961444533 3:126972951-126972973 GCCCTGCAGGACGGATGTGCAGG - Intergenic
963107292 3:141658271-141658293 GCCCATCAGAGCTGAGATGAAGG - Intergenic
964106404 3:153044872-153044894 GCCCTGCATGACTGAGGTGGAGG + Intergenic
966860437 3:184228765-184228787 TCTCTTCAGGGCTGCGGTGATGG + Intronic
966862686 3:184239399-184239421 GGCCTTGAGTACTGAGGTGCTGG + Exonic
967138663 3:186533987-186534009 GTTCTTCAGGACTGAGGGGCTGG + Intergenic
968091060 3:195898460-195898482 GCCCTCGAGGACTGAGGGAAGGG - Intronic
969346946 4:6575758-6575780 GCCCCCCAGGACAGGGGTGAAGG + Intronic
970159509 4:13174869-13174891 GCCTTTAAAGACTGAAGTGAGGG + Intergenic
970473799 4:16402109-16402131 GCACTTCAGGCCTGATGGGAGGG - Intergenic
971002640 4:22339743-22339765 GCCCTTCATGACTGGGCTCAAGG + Intergenic
972056100 4:34805520-34805542 GACCTTCAGGACTGTTGGGAAGG - Intergenic
973975494 4:56258648-56258670 GCCCTGAAGGACAGTGGTGAAGG + Intronic
974073014 4:57142362-57142384 ACCCTTCAGGACTTTGGTGAAGG - Intergenic
976541861 4:86286732-86286754 GTACTTCAGGAATGAGGAGAGGG + Intronic
977437780 4:97021923-97021945 GCCTTACAGGATTGATGTGAGGG + Intergenic
981154836 4:141422728-141422750 GCTCTATAGGACTGTGGTGAAGG - Intergenic
983582738 4:169325245-169325267 CCCCTGAAGGACAGAGGTGAAGG + Intergenic
985310119 4:188588627-188588649 GCTCTTCAGGAGAGAGGGGAGGG + Intergenic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
986444102 5:7806499-7806521 GAAATTCAGGACTGAGGTGCTGG + Intronic
986819229 5:11446970-11446992 GCCATTGAGGACTGAGGTGGGGG - Intronic
987858528 5:23452919-23452941 TTCCTTCATGGCTGAGGTGAGGG + Intergenic
992067226 5:73119877-73119899 GCCATTCAGGCCTGAGGTCCTGG - Intergenic
992483209 5:77171629-77171651 TCCCTTCAGGAAACAGGTGAGGG + Intergenic
995547488 5:113247647-113247669 GCAGTTTAGGAATGAGGTGATGG + Intronic
996392146 5:122973358-122973380 GCCCTGAAGGACAGTGGTGAAGG - Intronic
998679942 5:144455735-144455757 GCATTTAAGCACTGAGGTGAAGG + Intronic
999893607 5:156005248-156005270 GCCCATTAGGACTGGGATGAAGG - Intronic
1000084957 5:157880736-157880758 GTACTTCAGGGCTGAGCTGAGGG + Intergenic
1002573077 5:180155084-180155106 GCCCTGATGGACTGAGCTGAAGG + Intronic
1005735954 6:28746330-28746352 GCCCTTCGCGACTGAGCTCAAGG + Intergenic
1006010325 6:31037680-31037702 GCCCTGCAGGACAGTGGGGAAGG - Intergenic
1006060229 6:31413634-31413656 GCCCCTCAGGCCTGAGCAGATGG + Intronic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1008444543 6:51572712-51572734 CCCATTCAGGAGTGAGCTGAGGG - Intergenic
1008959668 6:57253546-57253568 ACCCTTCAGCACTGAGATCATGG + Intergenic
1017647489 6:156552303-156552325 CCCCTTCAGGACTGTGGTCCAGG + Intergenic
1020616940 7:10470753-10470775 GCAATTCAGGATTGAGATGAAGG + Intergenic
1021895935 7:25235743-25235765 GCCCTTCAGTACTGAGGAGTCGG + Intergenic
1024979115 7:55142690-55142712 GCACATCATGACTGAGGTAATGG - Intronic
1024996723 7:55278175-55278197 GCCCTTCAGGAGAGATGGGAAGG + Intergenic
1026894352 7:74001300-74001322 GCCCAGCAGGAGTGAGGTGACGG - Intergenic
1030355548 7:108538500-108538522 TCCCTTAAGGACAGTGGTGAAGG + Intronic
1030693130 7:112555470-112555492 GCCCTTCACGACTGGGCTCAAGG - Intergenic
1032577732 7:133073272-133073294 GCCCTTCAGCATTGAAGTGCAGG - Intronic
1034336546 7:150327359-150327381 GCAGTTCAGGACTGAGGGGCAGG + Intronic
1035636262 8:1146769-1146791 GCACTTCAGGACAGTGGGGACGG - Intergenic
1037012644 8:13863012-13863034 GCCCAAAAGGAATGAGGTGAGGG - Intergenic
1038205340 8:25459357-25459379 GCCCTTCCGGACAGAGGAGCCGG + Exonic
1039275718 8:35932776-35932798 GTACTTCTGGACTGAGCTGAGGG + Intergenic
1040560975 8:48523320-48523342 GCCCTGCAGGGCTGAGGTGGGGG + Intergenic
1040896122 8:52370184-52370206 GCTATTCAGGGTTGAGGTGAGGG + Intronic
1042005532 8:64175719-64175741 GTCCTTAAGGACTCAGTTGAAGG + Intergenic
1042856995 8:73277679-73277701 GCACATCAGGAATGAAGTGAAGG - Intergenic
1044819056 8:96143813-96143835 GGCCCTCAGGAGTGAGATGAAGG + Exonic
1044820158 8:96150667-96150689 GCGCTGCAGGACTGGGGTCAGGG - Intronic
1045239563 8:100387489-100387511 GCCCTTGAGGATTGTTGTGAAGG - Intronic
1046689338 8:117265523-117265545 GCAATTCAGGTCAGAGGTGATGG + Intergenic
1048045443 8:130768340-130768362 GCCCTTAAGGAGTGTGGTGAGGG + Intergenic
1048072476 8:131037115-131037137 CCCTTTCAGCACTGAAGTGAGGG + Intronic
1049335367 8:142081715-142081737 ACCCTTCAGGGCTGAGGTATAGG + Intergenic
1049556214 8:143283520-143283542 GCCCTGCAGGTCTGAGGTGCAGG - Intergenic
1049748858 8:144274228-144274250 GCCCTTCAGGGCTGTGGAGAGGG - Intronic
1052856017 9:33407036-33407058 GGCCTTCAGGACAGAGCAGATGG + Intergenic
1054926887 9:70598520-70598542 GCCCTTCAGGAGTGACGGGAGGG - Exonic
1056241105 9:84647441-84647463 TCCCTTAAGGACAGTGGTGAAGG - Intergenic
1056858958 9:90161988-90162010 TCCCATCAAGACTGAGGAGAGGG - Intergenic
1057525379 9:95795109-95795131 ACCCCACAGGACTGAGGTGGAGG - Intergenic
1060016782 9:120093519-120093541 ACCCTGAAGGACAGAGGTGAGGG + Intergenic
1062181257 9:135192438-135192460 GCCCATCAGGGCTGAGTGGAGGG - Intergenic
1185980256 X:4771435-4771457 GCCCTTCATGACTGGGCTCAAGG + Intergenic
1189611315 X:42739220-42739242 TTGCTTCAGGACTGAGGAGAAGG - Intergenic
1190070168 X:47273017-47273039 GCCCAACTGCACTGAGGTGAAGG + Intergenic
1192351556 X:70360594-70360616 GTCAACCAGGACTGAGGTGACGG - Intronic
1194084962 X:89515505-89515527 GCCCTTCATGACTGGGCTCAGGG - Intergenic
1194978161 X:100413349-100413371 TCCCTTCAGGATTGAAGTAAAGG - Intergenic
1195976524 X:110533475-110533497 GTCATTTAGGACCGAGGTGATGG + Intergenic
1200039863 X:153357069-153357091 GCCCTTCACGACTGGGCTCAAGG - Intronic
1200437611 Y:3171390-3171412 GCCCTTCATGACTGGGCTCAGGG - Intergenic
1200710997 Y:6484964-6484986 GTACTTCTGGGCTGAGGTGAGGG + Intergenic
1200750209 Y:6937963-6937985 TCCCTCCAGGGCTGAGGTCATGG + Intronic
1201022937 Y:9677022-9677044 GTACTTCTGGGCTGAGGTGAGGG - Intergenic
1201530311 Y:14984273-14984295 GCACTTCTGGGCTGAGCTGAGGG + Intergenic
1201744235 Y:17353110-17353132 GTACTTCTGGGCTGAGGTGAGGG - Intergenic