ID: 905956432

View in Genome Browser
Species Human (GRCh38)
Location 1:42001253-42001275
Sequence GAGCTGACAGTTCAGTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905956432_905956434 19 Left 905956432 1:42001253-42001275 CCTAGACACTGAACTGTCAGCTC 0: 1
1: 0
2: 0
3: 20
4: 393
Right 905956434 1:42001295-42001317 CGTAGCCCCAACATTGTCTATGG 0: 1
1: 0
2: 1
3: 6
4: 44
905956432_905956436 23 Left 905956432 1:42001253-42001275 CCTAGACACTGAACTGTCAGCTC 0: 1
1: 0
2: 0
3: 20
4: 393
Right 905956436 1:42001299-42001321 GCCCCAACATTGTCTATGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
905956432_905956435 22 Left 905956432 1:42001253-42001275 CCTAGACACTGAACTGTCAGCTC 0: 1
1: 0
2: 0
3: 20
4: 393
Right 905956435 1:42001298-42001320 AGCCCCAACATTGTCTATGGAGG 0: 1
1: 0
2: 0
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905956432 Original CRISPR GAGCTGACAGTTCAGTGTCT AGG (reversed) Intronic
900839465 1:5036257-5036279 GAGCAGACGCGTCAGTGTCTGGG - Intergenic
902715162 1:18267657-18267679 GATCTGAGAGCTCAGTGTCTGGG - Intronic
904037109 1:27564876-27564898 GACCTGAGATGTCAGTGTCTAGG + Intronic
904499218 1:30904545-30904567 CAGCTGTGAGTTCAGTGTGTTGG - Intronic
905313510 1:37066522-37066544 GAGCTGTGTCTTCAGTGTCTAGG + Intergenic
905956432 1:42001253-42001275 GAGCTGACAGTTCAGTGTCTAGG - Intronic
906886607 1:49655396-49655418 AATCTGACAATTAAGTGTCTTGG + Intronic
906894204 1:49753527-49753549 GATCTGACAATTATGTGTCTTGG + Intronic
907780893 1:57564956-57564978 GAACTGACAATTATGTGTCTTGG - Intronic
908099567 1:60776988-60777010 AATCTGACAGTTATGTGTCTTGG + Intergenic
912110146 1:106331071-106331093 AATCTGACAGTTATGTGTCTTGG - Intergenic
912270861 1:108207887-108207909 GATCTGACAATTATGTGTCTTGG + Intergenic
912899970 1:113637689-113637711 AATCTGACAGTTATGTGTCTTGG + Intronic
913258473 1:116976405-116976427 AATCTGACAGTTTTGTGTCTTGG - Intronic
915621666 1:157089923-157089945 GAGCTGACTCTGCTGTGTCTCGG + Intergenic
915790317 1:158662717-158662739 TAGCTGAGGGTTCAGTCTCTTGG + Exonic
915831807 1:159138260-159138282 AAGCTGACAGGTCAGTGTGGTGG - Intronic
916075571 1:161198290-161198312 GGGCTGACAGTGCAGTACCTGGG - Exonic
916469303 1:165107696-165107718 AATCTGACAGTTATGTGTCTTGG + Intergenic
917010518 1:170465542-170465564 AATCTGACAGTTATGTGTCTTGG - Intergenic
917181592 1:172303561-172303583 AATCTGACAGTTATGTGTCTTGG - Intronic
917192569 1:172433285-172433307 AATCTGACAGTTATGTGTCTTGG - Intronic
917382432 1:174428305-174428327 GAGCTGACAATGCAGTGTATTGG + Intronic
917391658 1:174544054-174544076 AATCTGACAGTTATGTGTCTTGG + Intronic
919776693 1:201198944-201198966 GAGCTGCCATTTCAGGGTATAGG - Intronic
921857046 1:219998284-219998306 GAGATGCCTGTTAAGTGTCTAGG - Intronic
922374232 1:224944952-224944974 AATCTGACAGTTATGTGTCTTGG + Intronic
923431550 1:233926092-233926114 AATCTGACAGTTAGGTGTCTTGG + Intronic
1064958654 10:20939120-20939142 AATCTGACAGTTATGTGTCTTGG - Intronic
1067335601 10:45360434-45360456 AAGCTGACAATTATGTGTCTTGG - Intergenic
1069308232 10:66999950-66999972 AAGCTGACAGAGCAGTGACTGGG - Intronic
1070231474 10:74572463-74572485 AATCTGACAGTTATGTGTCTTGG + Intronic
1070477911 10:76847891-76847913 AATCTGACAGTTATGTGTCTTGG - Intergenic
1071247916 10:83785519-83785541 AATCTGACAGTTATGTGTCTTGG + Intergenic
1072287437 10:93929325-93929347 AATCTGACAGTTATGTGTCTTGG - Intronic
1072569660 10:96647692-96647714 GAGCAGAGAGTTAAGTTTCTGGG + Intronic
1073554363 10:104434364-104434386 AAGCTGAGAATTCATTGTCTAGG + Intronic
1073975371 10:109094937-109094959 AATCTGACAGTTATGTGTCTTGG + Intergenic
1074286428 10:112102186-112102208 GAGCTGTCAGTCCAGGGACTTGG - Intergenic
1077741922 11:4855754-4855776 AATCTGACAGTTATGTGTCTTGG - Intronic
1077771124 11:5220440-5220462 AATCTGACAGTTATGTGTCTTGG + Intergenic
1078283986 11:9932313-9932335 AATCTGACAATTCTGTGTCTTGG - Intronic
1078813939 11:14800615-14800637 AATCTGACAGTTATGTGTCTTGG + Intronic
1078977863 11:16497999-16498021 AATCTGACAGTTATGTGTCTTGG - Intronic
1079822265 11:25145876-25145898 AATCTGACAGTTATGTGTCTTGG + Intergenic
1079977139 11:27105773-27105795 AATCTGACAGTTATGTGTCTTGG - Intronic
1080081230 11:28221020-28221042 AATCTGACAGTTATGTGTCTTGG + Intronic
1080666706 11:34342690-34342712 GAGTTGAGAATTCAGTCTCTTGG + Intronic
1080816105 11:35758959-35758981 AACCTGACAGTTATGTGTCTTGG + Intronic
1081701992 11:45158128-45158150 AAGCAGACAGTGCAGTGTCAGGG + Intronic
1082724041 11:56713833-56713855 GATCTGACAATTATGTGTCTTGG + Intergenic
1083009756 11:59386111-59386133 AATCTGACAGTTATGTGTCTTGG + Intergenic
1083885411 11:65571065-65571087 GAGGTGACAGTGGAGTCTCTGGG + Intronic
1084934916 11:72581700-72581722 TTATTGACAGTTCAGTGTCTAGG + Intronic
1086214830 11:84365995-84366017 AATCTGACAGTTATGTGTCTTGG - Intronic
1086628567 11:88988542-88988564 AATCTGACAGTTATGTGTCTTGG - Intronic
1087425613 11:97982063-97982085 GAACTGGCAGTTCAGTTTTTAGG - Intergenic
1087667972 11:101072010-101072032 AATCTGACAGTTATGTGTCTTGG - Intronic
1088790934 11:113225614-113225636 AATCTGACAATTAAGTGTCTTGG - Intronic
1089126325 11:116179017-116179039 GAGCTGACAGAACAGTGTGTGGG + Intergenic
1090103627 11:123828651-123828673 AATCTGACAGTTATGTGTCTTGG + Intergenic
1091417295 12:299230-299252 AATCTGACAGTTATGTGTCTTGG - Intronic
1091857200 12:3749451-3749473 GAGCAGACAGCTCAGTGGCATGG - Intronic
1092301328 12:7252784-7252806 AATCTGACAGTTATGTGTCTTGG - Intergenic
1093008716 12:14081114-14081136 AATCTGACAGTTATGTGTCTTGG - Intergenic
1093179123 12:15948162-15948184 AATCTGACAGTTAGGTGTCTTGG + Intronic
1093404414 12:18786887-18786909 AATCTGACAGTTATGTGTCTTGG - Intergenic
1095423259 12:42047952-42047974 AATCTGACAATTCTGTGTCTTGG + Intergenic
1095424932 12:42064652-42064674 AATCTGACAATTCTGTGTCTTGG - Intergenic
1095429067 12:42112823-42112845 AATCTGACAATTCTGTGTCTTGG - Intronic
1096895411 12:54817034-54817056 AATCTGACAGTTATGTGTCTTGG + Intergenic
1097263896 12:57735305-57735327 GAGCTGAGAGTGCAGTGGGTGGG + Intronic
1099106930 12:78508103-78508125 AATCTGACAGTTATGTGTCTTGG - Intergenic
1101069676 12:101061342-101061364 AATCTGACAGTTATGTGTCTTGG + Intronic
1103203467 12:119109281-119109303 AATCTGACAGTTATGTGTCTTGG + Intronic
1103360608 12:120351331-120351353 GAGCTTACAGGTCAGTCGCTCGG - Exonic
1103830161 12:123772639-123772661 AGGCTGACAGCTCAGAGTCTGGG + Intronic
1108308412 13:49162066-49162088 AATCTGACAGTTATGTGTCTTGG + Intronic
1108445725 13:50507492-50507514 AATCTGACAGTTATGTGTCTTGG + Intronic
1108713241 13:53054791-53054813 GAGCTGTCAGTTCAGTTGCCAGG + Intergenic
1109457287 13:62609950-62609972 AATCTGACAGTTATGTGTCTTGG + Intergenic
1110804240 13:79736279-79736301 GAGGTGACAATGCAGTGACTAGG + Intergenic
1110818695 13:79888736-79888758 AAGCTGACAATTATGTGTCTTGG - Intergenic
1110876667 13:80518531-80518553 AAGCTGACAATTATGTGTCTTGG - Intergenic
1112745621 13:102523695-102523717 GATCTGACAATTATGTGTCTTGG - Intergenic
1113912587 13:113850568-113850590 CAGCTAACAGTGCAGTGGCTTGG - Intronic
1114691424 14:24586146-24586168 GATCTGACAATTATGTGTCTTGG + Intergenic
1114935782 14:27534435-27534457 GATCTTACAGTATAGTGTCTTGG + Intergenic
1115278824 14:31638548-31638570 AATCTGACAGTTTTGTGTCTTGG + Intronic
1115477230 14:33827150-33827172 AATCTGACAGTTATGTGTCTTGG - Intergenic
1116212582 14:41967271-41967293 AATCTGACAGTTATGTGTCTTGG + Intergenic
1117104448 14:52383832-52383854 AATCTGACAGTTATGTGTCTTGG - Intergenic
1117936450 14:60912785-60912807 AATCTGACAGTTATGTGTCTTGG + Intronic
1120112801 14:80577861-80577883 GAACTGAAAGTTCAGTATGTTGG - Intronic
1122719316 14:103713328-103713350 GAGCTCCCAGGCCAGTGTCTGGG - Intronic
1126201989 15:45996770-45996792 GAGCTGGCAGATCAGGGTCATGG + Intergenic
1127017070 15:54700488-54700510 AATCTGACAGTTATGTGTCTTGG - Intergenic
1127021247 15:54750929-54750951 AATCTGACAGTTATGTGTCTTGG - Intergenic
1127055445 15:55126509-55126531 GAGCTTACAGTTCAGTGTAGGGG - Intergenic
1127193878 15:56563082-56563104 AATCTGACAGTTATGTGTCTTGG - Intergenic
1127253704 15:57270016-57270038 AATCTGACAGTTATGTGTCTTGG + Intronic
1127666356 15:61151280-61151302 GAGCTTAGAGTTCAGGGTGTAGG - Intronic
1128548302 15:68581815-68581837 GAGCTCCCAGGGCAGTGTCTAGG + Intronic
1130066817 15:80611773-80611795 GAGCTGACAGTCTAGTAGCTGGG + Intergenic
1131962748 15:97806894-97806916 AAGATGACAGTTCACTGACTGGG + Intergenic
1132260361 15:100418613-100418635 AATCTGACAGTTATGTGTCTTGG - Intronic
1132417040 15:101627994-101628016 AATCTGACAGTTATGTGTCTTGG - Intronic
1133876185 16:9736952-9736974 GAGCTGAGAGCTCAGGTTCTAGG + Intergenic
1135202468 16:20450389-20450411 GATCCTACAGTTCTGTGTCTTGG - Intergenic
1135216636 16:20577477-20577499 GATCCTACAGTTCTGTGTCTTGG + Intergenic
1135608379 16:23842519-23842541 GAGTGCTCAGTTCAGTGTCTGGG + Intronic
1138712130 16:58981966-58981988 AAGCTGACAATTATGTGTCTTGG + Intergenic
1141333415 16:83132921-83132943 GAACTGACAGTTCAAAGACTTGG - Intronic
1142750010 17:1981740-1981762 GAACCCACAGTGCAGTGTCTGGG + Intronic
1144548771 17:16220983-16221005 GAGCTGACAGTGCAGTCTAGAGG - Intronic
1145861382 17:28213258-28213280 AATCTGACAATTCTGTGTCTTGG - Intergenic
1149372054 17:56004135-56004157 GATCTGACAATTATGTGTCTTGG - Intergenic
1152931265 17:83111394-83111416 GAGCTGACCCTTCAGAGGCTGGG + Intergenic
1153064773 18:1033776-1033798 AATCTGACAGTTGTGTGTCTTGG + Intergenic
1154104597 18:11510680-11510702 AAGCTCACAGTTCAGTGGCATGG - Intergenic
1154320516 18:13347531-13347553 AATCTGACAGTTATGTGTCTTGG + Intronic
1155562014 18:27088888-27088910 GAGCTGCCAGTTCATTGACCTGG - Intronic
1155660411 18:28241986-28242008 AATCTGACAGTTATGTGTCTTGG - Intergenic
1156002145 18:32396838-32396860 AATCTGACAGTTATGTGTCTTGG - Intronic
1156188207 18:34688601-34688623 GATCTGACAATTATGTGTCTTGG + Intronic
1156932516 18:42662072-42662094 AAGCTGACAATTATGTGTCTTGG - Intergenic
1157272855 18:46290012-46290034 AAGGTGCCAGGTCAGTGTCTGGG - Intergenic
1158054166 18:53259670-53259692 AATCTGACAATTAAGTGTCTTGG + Intronic
1158064344 18:53387606-53387628 GAGCTAACAGATGGGTGTCTGGG + Intronic
1158103562 18:53859058-53859080 GATGTCACACTTCAGTGTCTGGG + Intergenic
1162853618 19:13451080-13451102 GTGCTCACAGTTCGGTGGCTTGG - Intronic
1163698608 19:18776147-18776169 CAGCTGACAGGTCAGTGGCCTGG - Intronic
1163975035 19:20842672-20842694 AATCTGACAGTTATGTGTCTTGG - Intronic
1166263354 19:41658715-41658737 AATCTGACAGTTATGTGTCTTGG - Intronic
1168601669 19:57723640-57723662 GAGCTGACGGTCCTGTGACTTGG - Intronic
926074589 2:9931626-9931648 AATCTGACAGTTATGTGTCTTGG + Intronic
926303631 2:11621444-11621466 GAGCAGGGAGGTCAGTGTCTTGG + Intronic
926917566 2:17907919-17907941 GATCTGACAATTGTGTGTCTTGG + Intronic
927318589 2:21716374-21716396 GAACTTTCAGTTCAGTGGCTTGG + Intergenic
928795509 2:35014115-35014137 AATCTGACAGTTATGTGTCTTGG - Intergenic
928802458 2:35111312-35111334 AATCTGACAGTTATGTGTCTTGG + Intergenic
928975748 2:37084577-37084599 GAGCTGTCAGGTAAGGGTCTGGG + Intronic
930216835 2:48706353-48706375 AATCTGACAGTTATGTGTCTTGG + Intronic
930725319 2:54676031-54676053 GGGCTGACAGTTCAGGTTGTGGG - Intergenic
932172672 2:69571831-69571853 GAGCTGACGGATCAGTGTTAGGG + Intronic
933054277 2:77642647-77642669 GAGCATACAGTTCAGGGACTTGG - Intergenic
935273773 2:101458669-101458691 AATCTGACAATTAAGTGTCTTGG + Intronic
935343043 2:102075197-102075219 GAGTTGAAGGTACAGTGTCTGGG - Intronic
935643323 2:105310767-105310789 AAGCTGACATTTCAATATCTGGG - Intronic
936175610 2:110217721-110217743 AAGCAGACAGCCCAGTGTCTTGG + Intergenic
936175848 2:110219217-110219239 AAGCAGACAGCCCAGTGTCTTGG + Intergenic
936640105 2:114302773-114302795 AATCTGACAGTTGTGTGTCTTGG + Intergenic
937656390 2:124381613-124381635 GAGCTGACTTTTCAGGGTCGGGG + Intronic
937741403 2:125359028-125359050 AATCTGACAGTTATGTGTCTTGG - Intergenic
938870864 2:135474815-135474837 AAGCTGAAAGTTCAATATCTAGG + Intronic
939072142 2:137556224-137556246 AATCTGACAGTTATGTGTCTGGG - Intronic
939157516 2:138543194-138543216 AATCTGACAGTTATGTGTCTTGG + Intronic
939381864 2:141446871-141446893 AATCTGACAGTTATGTGTCTTGG + Intronic
939652990 2:144786955-144786977 AATCTGACAGTTATGTGTCTTGG - Intergenic
940465695 2:154024154-154024176 AATCTGACAGTTATGTGTCTTGG + Intronic
941100333 2:161287840-161287862 AATCTGACAGTTATGTGTCTTGG - Intergenic
942898934 2:181090904-181090926 GATCTGACAATTATGTGTCTTGG - Intergenic
943038311 2:182773291-182773313 GATCTGACAATTATGTGTCTTGG + Intronic
943262719 2:185686814-185686836 AATCTGACAGTTATGTGTCTTGG + Intergenic
943346123 2:186738599-186738621 GAACTGGCAGTTCAGTTTTTAGG + Intronic
943624650 2:190184906-190184928 GGCCTAACAGTACAGTGTCTTGG - Intronic
944599871 2:201292208-201292230 AATCTGACAGTTATGTGTCTTGG - Intronic
945481668 2:210352290-210352312 AATCTGACAATTCTGTGTCTTGG - Intergenic
945486718 2:210405692-210405714 GATCTGACAATTATGTGTCTTGG + Intergenic
945495950 2:210507059-210507081 AATCTGACAATTCTGTGTCTTGG - Intronic
948260509 2:236601006-236601028 GAGCTGTCACTTGTGTGTCTTGG - Intergenic
948401405 2:237688370-237688392 GAGCTGAGAGGTCAGTGACCAGG - Intronic
1171781007 20:29417727-29417749 GAGCTGAATGTTCAGAATCTAGG - Intergenic
1173144078 20:40510019-40510041 AAGCTGCCAGGCCAGTGTCTTGG + Intergenic
1174458690 20:50667671-50667693 GAGCTGTGAGTTCAGTATCATGG - Intronic
1175097899 20:56556508-56556530 GAGTGGAGAGTTAAGTGTCTGGG - Intergenic
1177639269 21:23825693-23825715 GAGCATTCAGTTCAGTTTCTTGG + Intergenic
1177778175 21:25593291-25593313 AAGCTGAGAATTCAGTGTGTAGG + Intronic
1178614499 21:34119500-34119522 GTTTTGACAGTTCTGTGTCTTGG + Intronic
1178621913 21:34184790-34184812 GAGCTGACAGTTGAATGGCTGGG + Intergenic
1178876414 21:36417826-36417848 GAGCTGACATACCAGTGCCTGGG + Exonic
1180032078 21:45218830-45218852 GGCTTGACAGTTCAGTGTCTGGG + Intronic
1180867777 22:19129252-19129274 GAGCTGTGTGTTCAGTGTTTAGG - Intergenic
1181570308 22:23764704-23764726 GAGCTGGCAGGTGAGTGTCAGGG + Exonic
1182310876 22:29405592-29405614 GAGCTCTCAGTTCAGGGTCCAGG + Intronic
1182690176 22:32155166-32155188 GAGCTCTCAGTTCAGGGTCCAGG - Intronic
1183517620 22:38276293-38276315 GGGCTTTCAGTTCAGGGTCTTGG + Intergenic
1183804536 22:40196958-40196980 GTGCTGACAGCTCAGTGACCAGG + Intronic
1184466349 22:44670579-44670601 GGGCTGGCACTTCTGTGTCTTGG + Intronic
1185009083 22:48303119-48303141 GAGCAGACAGTGCAGTGTCCTGG + Intergenic
1185318932 22:50191312-50191334 GAGCTCTCTGTGCAGTGTCTAGG - Intronic
1203292483 22_KI270736v1_random:8774-8796 GAGCTGATAGGACAGGGTCTTGG + Intergenic
949425412 3:3910465-3910487 AATCTGACAGTTATGTGTCTTGG - Intronic
950251381 3:11468519-11468541 AAGCTGACAGGTCAGTGTTTGGG + Intronic
951747696 3:25997873-25997895 AATCTGACAGTTATGTGTCTTGG + Intergenic
953263147 3:41359449-41359471 GAGCTGAACGGTCAGTGTGTCGG + Intronic
953690197 3:45111369-45111391 GAGCTGACTGTTAAGTGTTCAGG - Intronic
954111451 3:48435729-48435751 GAGCTGAGAGTTTTCTGTCTTGG - Intronic
954486569 3:50858608-50858630 AATCTGACAGTTATGTGTCTTGG + Intronic
954524210 3:51255326-51255348 AATCTGACAGTTATGTGTCTTGG + Intronic
954725203 3:52602377-52602399 GTGCTGACAGATCTGTGTATAGG + Intronic
956669554 3:71673706-71673728 GAGCTGACAATTTAGTGGATTGG - Intergenic
957702127 3:83727725-83727747 GAGCTGCCAGTTCAGTTTTCAGG - Intergenic
957942144 3:87018779-87018801 CATCTGACAGTTATGTGTCTTGG - Intergenic
959910334 3:111757108-111757130 AATCTGACAATTAAGTGTCTTGG + Intronic
959953873 3:112212888-112212910 GATCTGACAATTATGTGTCTTGG - Intronic
960752011 3:120965735-120965757 AATCTGACAGTTATGTGTCTTGG + Intronic
961419498 3:126790282-126790304 AATCTGACAGTTATGTGTCTTGG + Intronic
961420932 3:126802746-126802768 AATCTGACAGTTATGTGTCTTGG - Intronic
962699371 3:137981511-137981533 AATCTGACAGTTATGTGTCTTGG - Intergenic
963048342 3:141121371-141121393 AATCTGACAGTTATGTGTCTTGG + Intronic
963070328 3:141299998-141300020 AATCTGACAGTTATGTGTCTTGG + Intergenic
963581201 3:147128658-147128680 GATCTGACAATTATGTGTCTTGG + Intergenic
964135827 3:153344068-153344090 GAGCTGTCACTTCAGAGACTCGG + Intergenic
965163700 3:165168257-165168279 AATCTGACAGTTATGTGTCTTGG + Intergenic
968064888 3:195753130-195753152 GGGCTGACAGCCCAGAGTCTGGG + Exonic
968962062 4:3750670-3750692 CAGCTGACAGCTCTGTGTCTTGG - Intergenic
969187192 4:5485048-5485070 AATCTGACAGTTATGTGTCTTGG + Intronic
969365104 4:6689765-6689787 GAGCTGCCCGTTCAGTGGCTGGG - Intergenic
970811773 4:20102643-20102665 TAGCTGACAGCTCTGTGGCTGGG + Intergenic
971367196 4:25986659-25986681 GAGCAGCAAGTTCAATGTCTAGG - Intergenic
972376683 4:38478146-38478168 AATCTGACAGTTATGTGTCTTGG - Intergenic
972706804 4:41552850-41552872 GAGCTGAAAGTTCAGTTTCATGG + Intronic
972820893 4:42700748-42700770 AATCTGACAGTTATGTGTCTTGG + Intergenic
973009467 4:45053224-45053246 AATCTGACAATTCTGTGTCTTGG - Intergenic
973649433 4:52983639-52983661 GAGCTGAGAGCTCAGTTTCCAGG + Intronic
973701544 4:53542360-53542382 GAGCTGAATGCGCAGTGTCTTGG + Intronic
973736733 4:53878661-53878683 AATCTGACAGTTATGTGTCTTGG - Intronic
975295737 4:72732045-72732067 AATCTGACAGTTATGTGTCTTGG - Intergenic
975750501 4:77518254-77518276 AATCTGACAATTCTGTGTCTTGG + Intronic
975902906 4:79174026-79174048 GAACTGACAGGTCAGTGAATGGG - Intergenic
976159723 4:82185791-82185813 AATCTGACAGTTATGTGTCTTGG - Intergenic
976263238 4:83165730-83165752 AAGCTGACAATTATGTGTCTTGG - Intergenic
976698546 4:87944332-87944354 GAGCTGACTGTTAAATTTCTGGG - Intergenic
976977133 4:91179261-91179283 AATCTGACAGTTATGTGTCTTGG + Intronic
977203704 4:94146943-94146965 AATCTGACAGTTATGTGTCTTGG + Intergenic
977306262 4:95327448-95327470 CAGTTGACAGCTCAGAGTCTGGG - Intronic
978078739 4:104566776-104566798 AATCTGACAGTTATGTGTCTTGG + Intergenic
978412369 4:108439878-108439900 AATCTGACAATTAAGTGTCTTGG + Intergenic
979112677 4:116779498-116779520 GATCTGACAATTACGTGTCTTGG + Intergenic
979326411 4:119385118-119385140 AATCTGACAGTTATGTGTCTTGG + Intergenic
981073145 4:140566257-140566279 GAGCTTACAGTTGAGAGTATGGG - Intronic
982737279 4:159019648-159019670 GCACTGAAAGTTCAGTGTCCTGG + Intronic
982794363 4:159628184-159628206 AATCTGACAGTTATGTGTCTTGG + Intergenic
984198941 4:176693659-176693681 AATCTGACAGTTATGTGTCTTGG - Intronic
984947714 4:184982993-184983015 GAGCTGAGAGTTCTGTGTTGAGG - Intergenic
986096085 5:4555260-4555282 GAGCTGACAGTTTAGGCTCTGGG - Intergenic
986236209 5:5913161-5913183 GAGCTTACAGATCGTTGTCTGGG + Intergenic
986530595 5:8732523-8732545 AATCTGACAGTTATGTGTCTTGG - Intergenic
987424083 5:17754062-17754084 AATCTGACAGTTATGTGTCTTGG + Intergenic
989186300 5:38630053-38630075 AATCTGACAGTTATGTGTCTTGG + Intergenic
989226616 5:39035998-39036020 AATCTGACAGTTACGTGTCTTGG - Intronic
989353958 5:40519892-40519914 GGTCTAACAATTCAGTGTCTTGG - Intergenic
989696401 5:44206072-44206094 GATCTGACAGTTATGTGTCTTGG + Intergenic
989778977 5:45242299-45242321 AATCTGACAGTTATGTGTCTTGG + Intergenic
989857277 5:46313891-46313913 AATCTGACAATTCTGTGTCTTGG - Intergenic
990234592 5:53753124-53753146 AATCTGACAGTTATGTGTCTTGG - Intergenic
992269162 5:75048459-75048481 TAGAGGACAGTTCAGTGTTTTGG + Intergenic
992753000 5:79878444-79878466 GAGCTGCCAGTTCAGTATTTTGG + Intergenic
993345404 5:86776770-86776792 AATCTGACAGTTATGTGTCTTGG + Intergenic
993542726 5:89172443-89172465 GAGCTTACAGTTCAATGTGGAGG + Intergenic
993627187 5:90239919-90239941 AATCTGACAGTTATGTGTCTTGG - Intergenic
993676386 5:90820875-90820897 AATCTGACAGTTATGTGTCTTGG + Intronic
994969533 5:106718326-106718348 AATCTGACAGTTATGTGTCTTGG + Intergenic
994983240 5:106903448-106903470 AATCTGACAGTTATGTGTCTTGG + Intergenic
996090999 5:119351974-119351996 GAGATGAGATTTCACTGTCTTGG + Intronic
996357789 5:122615964-122615986 GAGCTGAAAGTCATGTGTCTGGG - Intergenic
998780631 5:145652432-145652454 AATCTGACAGTTATGTGTCTTGG - Intronic
999064614 5:148672658-148672680 AATCTGACAATTAAGTGTCTTGG + Intronic
999306473 5:150522658-150522680 GAGCTGGCATTTCAGTGCTTTGG + Intronic
999358984 5:150965794-150965816 AATCTGACAGTTATGTGTCTTGG - Intergenic
999602752 5:153284596-153284618 AATCTGACAGTTACGTGTCTTGG - Intergenic
999963656 5:156784483-156784505 AAGCTGACAATTATGTGTCTTGG - Intergenic
1000295582 5:159910830-159910852 CAGCTGACATTTCAGGGCCTTGG - Intergenic
1001792224 5:174467595-174467617 AATCTGACAGTTATGTGTCTTGG - Intergenic
1003132896 6:3410953-3410975 GAGCTGACAGTGCAGCCCCTCGG + Intronic
1003416719 6:5916312-5916334 AATCTGACAATTAAGTGTCTTGG + Intergenic
1003434253 6:6071172-6071194 AATCTGACAGTTATGTGTCTTGG + Intergenic
1004794413 6:19065033-19065055 GAGCTGACACTTTTGTGCCTGGG + Intergenic
1008796560 6:55310570-55310592 AATCTGACAGTTATGTGTCTTGG + Intergenic
1008825311 6:55686203-55686225 AATCTGACAGTTATGTGTCTTGG - Intergenic
1009233389 6:61093352-61093374 AATCTGACAGTTATGTGTCTTGG - Intergenic
1009697905 6:67133824-67133846 GAGCTGATGGTTCCTTGTCTTGG - Intergenic
1009829874 6:68916494-68916516 AAGCTCACAGTTCAGTGGTTTGG + Intronic
1010482637 6:76373889-76373911 AATCTGACAGTTTTGTGTCTTGG + Intergenic
1010593239 6:77735093-77735115 GAACTGACAATTATGTGTCTTGG + Intronic
1010633313 6:78226830-78226852 GAACTGACAATTATGTGTCTTGG - Intergenic
1010844206 6:80684895-80684917 AATCTGACAGTTATGTGTCTTGG - Intergenic
1011395262 6:86899251-86899273 AATCTGACAGTTATGTGTCTTGG - Intergenic
1011956825 6:93033687-93033709 GATCTGACAATTATGTGTCTTGG - Intergenic
1012876938 6:104738850-104738872 AATCTGACAGTTATGTGTCTTGG - Intronic
1012881978 6:104801399-104801421 AATCTGACAGTTATGTGTCTTGG - Intronic
1013762334 6:113532663-113532685 AATCTGACAGTTATGTGTCTTGG - Intergenic
1013906310 6:115223740-115223762 AATCTGACAGTTATGTGTCTTGG - Intergenic
1014128929 6:117809456-117809478 AATCTGACAGTTATGTGTCTTGG + Intergenic
1014145856 6:117997456-117997478 AATCTGACAGTTATGTGTCTTGG - Intronic
1014419367 6:121222055-121222077 CAGCTGACTGATCAGTGTGTTGG - Intronic
1014449896 6:121570488-121570510 AATCTGACAGTTACGTGTCTTGG + Intergenic
1015046123 6:128778636-128778658 AATCTGACAGTTACGTGTCTTGG + Intergenic
1016412790 6:143801154-143801176 AATCTGACAGTTATGTGTCTTGG + Intronic
1016436719 6:144045647-144045669 AATCTGACAGTTATGTGTCTTGG + Intronic
1018760122 6:166886499-166886521 AATCTGACAGTTATGTGTCTTGG - Intronic
1019780953 7:2939392-2939414 GAGCTTACAGTTGAGTTTCTTGG + Intronic
1020443243 7:8241097-8241119 AATCTGACAGTTATGTGTCTTGG - Intronic
1020645521 7:10810363-10810385 AATCTGACAATTAAGTGTCTTGG + Intergenic
1020795716 7:12676578-12676600 AATCTGACAGTTATGTGTCTTGG - Intergenic
1022347397 7:29529675-29529697 AATCTGACAGTTATGTGTCTTGG - Intergenic
1023509244 7:40933392-40933414 AATCTGACAGTTATGTGTCTTGG + Intergenic
1024591424 7:50888538-50888560 AATCTGACAATTAAGTGTCTTGG - Intergenic
1026954957 7:74371351-74371373 GGGCTACCAGTTCAGTGTGTAGG + Intronic
1027573882 7:79907363-79907385 AAGCTGACAGATCAGCGACTAGG + Intergenic
1027929800 7:84518046-84518068 AATCTGACAATTCTGTGTCTTGG - Intergenic
1028321432 7:89464807-89464829 AATCTGACAATTCTGTGTCTTGG + Intergenic
1028369207 7:90071633-90071655 AATCTGACAGTTATGTGTCTTGG - Intergenic
1028915154 7:96251015-96251037 GAGCTTACAGTCAAGTGTGTGGG + Intronic
1028918995 7:96289942-96289964 AATCTGACAGTTATGTGTCTTGG - Intronic
1029006378 7:97214498-97214520 AATCTGACAGTTATGTGTCTTGG + Intergenic
1029829992 7:103246262-103246284 AATCTGACAATTCTGTGTCTTGG - Intergenic
1030220879 7:107097969-107097991 AATCTGACAGTTATGTGTCTTGG + Intronic
1030817669 7:114056600-114056622 AATCTGACAGTTATGTGTCTTGG - Intronic
1032686651 7:134240735-134240757 AATCTGACAATTAAGTGTCTTGG - Intronic
1032972679 7:137183154-137183176 AATCTGACAGTTATGTGTCTTGG - Intergenic
1033375832 7:140761071-140761093 AATCTGACAGTTATGTGTCTTGG - Intronic
1033680209 7:143586075-143586097 AATCTGACAATTCTGTGTCTTGG - Intergenic
1033691629 7:143743367-143743389 AATCTGACAATTCTGTGTCTTGG + Intergenic
1035070466 7:156141032-156141054 GAGCTGCCAGTTTGCTGTCTGGG + Intergenic
1035586311 8:777810-777832 AATCTGACAGTTATGTGTCTTGG + Intergenic
1037719833 8:21433042-21433064 AAGCTGAAAGTTATGTGTCTTGG - Intergenic
1039077242 8:33702663-33702685 AATCTGACAATTAAGTGTCTTGG + Intergenic
1039120320 8:34138764-34138786 GAGCTGGCAGTTCTGTGGCCTGG - Intergenic
1039127217 8:34216602-34216624 AATCTGACAATTAAGTGTCTTGG - Intergenic
1039423179 8:37461954-37461976 AATCTGACAATTAAGTGTCTTGG - Intergenic
1041744184 8:61189055-61189077 AATCTGACAGTTACGTGTCTTGG - Intronic
1041957194 8:63569222-63569244 GAACTGAGAGGTCAGTGTGTGGG - Intergenic
1042105899 8:65325983-65326005 CAGCAGCCAGTGCAGTGTCTGGG + Intergenic
1043535869 8:81203875-81203897 GATCTGACAATTATGTGTCTTGG + Intergenic
1043538030 8:81227554-81227576 AACCTGACAGTTGAGTGCCTAGG - Intergenic
1045976873 8:108139337-108139359 GAGCTGAAAGATCAGTATTTTGG + Intergenic
1046287869 8:112119146-112119168 GAGCTGAGAGGTCAGTGATTTGG + Intergenic
1047312981 8:123708047-123708069 GAGGTCACTGTTCAGTGACTGGG - Intronic
1048381095 8:133865383-133865405 AATCTGACAATTCAGTGTCTTGG + Intergenic
1049646021 8:143735973-143735995 GGTCTCACAGGTCAGTGTCTGGG - Intergenic
1049694139 8:143975457-143975479 GTGGGGAGAGTTCAGTGTCTAGG - Intronic
1050404653 9:5294673-5294695 AATCTGACAGTTATGTGTCTTGG - Intergenic
1050509125 9:6375857-6375879 AATCTGACAATTCTGTGTCTTGG - Intergenic
1050509397 9:6377939-6377961 AATCTGACAATTCTGTGTCTTGG - Intergenic
1050942990 9:11484229-11484251 AATCTGACAGTTATGTGTCTTGG + Intergenic
1051082100 9:13305995-13306017 AATCTGACAGTTATGTGTCTTGG + Intergenic
1052145551 9:25044425-25044447 AATCTGACAGTTATGTGTCTTGG + Intergenic
1053521178 9:38781031-38781053 AATCTGACAGTTATGTGTCTTGG - Intergenic
1053726459 9:41006761-41006783 GATCTGACAATTATGTGTCTTGG + Intergenic
1054193340 9:62005024-62005046 AATCTGACAGTTATGTGTCTTGG - Intergenic
1054425572 9:65063535-65063557 AATCTGACAGTTATGTGTCTTGG - Intergenic
1054645067 9:67583667-67583689 AATCTGACAGTTATGTGTCTTGG + Intergenic
1054890138 9:70241985-70242007 AATCTGACAGTTATGTGTCTTGG - Intergenic
1055548716 9:77409977-77409999 AATCTGACAATTAAGTGTCTTGG - Intronic
1055556809 9:77482514-77482536 AATCTGACAATTAAGTGTCTTGG + Intronic
1057402592 9:94737950-94737972 GTGCTGAGAGTTCAGGGTCTGGG + Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058517279 9:105789536-105789558 AATCTGACAGTTACGTGTCTTGG + Intergenic
1059459754 9:114422200-114422222 GAGCTCTCAGTTCAGCATCTGGG + Intronic
1061552229 9:131343837-131343859 AATCTGACAGTTATGTGTCTTGG + Intergenic
1061804640 9:133131206-133131228 GAGCAGACAGTTCAGGGCCTGGG + Intronic
1203399647 Un_KI270519v1:74408-74430 GATCTGACAATTATGTGTCTTGG - Intergenic
1186087755 X:6009601-6009623 GAGCTGACATTTCGGTGGGTGGG + Intronic
1186702674 X:12108105-12108127 GATCTGACAATTATGTGTCTTGG - Intergenic
1187631410 X:21177046-21177068 GGGCTGGCTGTGCAGTGTCTGGG - Intergenic
1187763278 X:22610842-22610864 AATCTGACAGTTATGTGTCTTGG - Intergenic
1188076356 X:25780254-25780276 CAGCTGTAAGTTCAGAGTCTGGG - Intergenic
1188157565 X:26758622-26758644 GATCTGATAATTAAGTGTCTTGG - Intergenic
1189498346 X:41529889-41529911 GACCTGACAGCTCAGTTTCTGGG - Intronic
1189968938 X:46398604-46398626 GAGCTGACCCTTCAGAGTCGAGG + Intergenic
1190790106 X:53691120-53691142 GAGCTCACTGTTCAGTGTAGAGG - Intergenic
1191096229 X:56675356-56675378 GATCTGACAATTATGTGTCTTGG - Intergenic
1191196531 X:57729837-57729859 AATCTGACAGTTACGTGTCTTGG + Intergenic
1191772303 X:64774486-64774508 GATCTGACAATTATGTGTCTTGG + Intergenic
1192554100 X:72076692-72076714 GAGCTGACACATCAGTGTGCAGG - Intergenic
1193071077 X:77306112-77306134 AATCTGACAGTTATGTGTCTTGG - Intergenic
1193387817 X:80892076-80892098 AATCTGACAGTTATGTGTCTTGG + Intergenic
1193522738 X:82551005-82551027 AATCTGACAGTTATGTGTCTTGG + Intergenic
1193571838 X:83153346-83153368 AATCTGACAGTTATGTGTCTTGG - Intergenic
1193729171 X:85081548-85081570 AATCTGACAGTTATGTGTCTTGG + Intronic
1194043646 X:88973468-88973490 GAGATGAGAGTTCAGCATCTTGG + Intergenic
1194255501 X:91628772-91628794 AATCTGACAATTCTGTGTCTTGG - Intergenic
1194266036 X:91754342-91754364 AATCTGACAATTCTGTGTCTTGG - Intergenic
1194636397 X:96349823-96349845 AATCTGACAATTAAGTGTCTTGG + Intergenic
1195847797 X:109247461-109247483 AATCTGACAGTTATGTGTCTTGG + Intergenic
1196587383 X:117445105-117445127 AATCTGACAGTTATGTGTCTTGG - Intergenic
1197147939 X:123189518-123189540 GAGCTGACACTGCAGAGGCTGGG - Intronic
1197917769 X:131554363-131554385 AATCTGACAGTTATGTGTCTTGG - Intergenic
1198168530 X:134081138-134081160 AATCTGACAGTTATGTGTCTTGG - Intergenic
1198592561 X:138199956-138199978 AATCTGACAGTTATGTGTCTTGG - Intergenic
1198660216 X:138960480-138960502 AAGCTGACAGTTATGTGTCTTGG + Intronic
1200288383 X:154847243-154847265 AATCTGACAGTTATGTGTCTTGG + Intronic
1200389996 X:155935159-155935181 GATCTGACAATTATGTGTCTCGG + Intronic
1200583196 Y:4974913-4974935 AATCTGACAATTCTGTGTCTTGG - Intergenic
1200588944 Y:5045571-5045593 AATCTGACAATTCTGTGTCTTGG + Intronic
1200771918 Y:7134247-7134269 AATCTGACAGTTATGTGTCTTGG + Intergenic
1200871223 Y:8100934-8100956 AATCTGACAATTAAGTGTCTTGG + Intergenic
1201363892 Y:13183549-13183571 AATCTGACAATTAAGTGTCTTGG + Intergenic
1201393739 Y:13525561-13525583 AATCTGACAATTAAGTGTCTTGG - Intergenic
1201572341 Y:15427590-15427612 AATCTGACAATTCCGTGTCTTGG - Intergenic
1201783478 Y:17747424-17747446 AACCTGACAGTTATGTGTCTTGG - Intergenic
1201800127 Y:17945824-17945846 AACCTGACAGTTATGTGTCTTGG - Intergenic
1201801426 Y:17960132-17960154 AACCTGACAGTTATGTGTCTTGG + Intergenic
1201818075 Y:18158563-18158585 AACCTGACAGTTATGTGTCTTGG + Intergenic
1201919416 Y:19218413-19218435 AATCTGACAGTTATGTGTCTTGG + Intergenic
1202064501 Y:20924303-20924325 AAGCTGACAATTATGTGTCTTGG + Intergenic
1202085050 Y:21127977-21127999 GATCTGACAATTATGTGTCTTGG + Intergenic
1202250932 Y:22872098-22872120 AATCTGACAATTAAGTGTCTTGG - Intergenic
1202361358 Y:24114068-24114090 AACCTGACAGTTATGTGTCTTGG + Intergenic
1202403921 Y:24505847-24505869 AATCTGACAATTAAGTGTCTTGG - Intergenic
1202466858 Y:25164235-25164257 AATCTGACAATTAAGTGTCTTGG + Intergenic
1202509420 Y:25556050-25556072 AACCTGACAGTTATGTGTCTTGG - Intergenic