ID: 905956656

View in Genome Browser
Species Human (GRCh38)
Location 1:42002711-42002733
Sequence TACAGGAGAGTGGAACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905956656_905956661 -2 Left 905956656 1:42002711-42002733 CCCTGGGGTTCCACTCTCCTGTA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 905956661 1:42002732-42002754 TACAAGTCAGTAGCCCAAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 206
905956656_905956666 27 Left 905956656 1:42002711-42002733 CCCTGGGGTTCCACTCTCCTGTA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 905956666 1:42002761-42002783 CCAGACATCATTCTGGCTCCAGG 0: 1
1: 0
2: 0
3: 30
4: 235
905956656_905956660 -3 Left 905956656 1:42002711-42002733 CCCTGGGGTTCCACTCTCCTGTA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 905956660 1:42002731-42002753 GTACAAGTCAGTAGCCCAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 92
905956656_905956664 20 Left 905956656 1:42002711-42002733 CCCTGGGGTTCCACTCTCCTGTA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 905956664 1:42002754-42002776 GAAACATCCAGACATCATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905956656 Original CRISPR TACAGGAGAGTGGAACCCCA GGG (reversed) Intronic
900166438 1:1245931-1245953 AGCAGGAGAGAGGAAGCCCAGGG + Intronic
903356912 1:22754033-22754055 TACAGCGGCCTGGAACCCCAGGG - Intronic
904378793 1:30097484-30097506 TAAGGGAGAGGGGAATCCCAGGG + Intergenic
905956656 1:42002711-42002733 TACAGGAGAGTGGAACCCCAGGG - Intronic
906606956 1:47179534-47179556 GACAGGAGAAGGGAAGCCCAAGG - Intergenic
910476416 1:87612256-87612278 TACATTAAAATGGAACCCCAGGG - Intergenic
912582593 1:110734179-110734201 TACAGGATAGTGGCTTCCCATGG - Intergenic
916056581 1:161072715-161072737 TTCAGGAGAATGGGACCCTACGG - Exonic
916506770 1:165435383-165435405 GACAGGAAAGTGGAGCCACAGGG + Intronic
919428885 1:197468793-197468815 TACAGGTGAGTGGAGTCACATGG + Intronic
919688972 1:200511542-200511564 TAAAGGAGGGTGGAGCCACAAGG + Intergenic
920770341 1:208878843-208878865 TACAGGAAAGTGAGGCCCCAGGG + Intergenic
920980374 1:210828765-210828787 TACCTAAGAGTGGAGCCCCAGGG - Intronic
922758254 1:228108696-228108718 TAAAGGAGAATGGAGGCCCAGGG + Intronic
924680314 1:246224446-246224468 TACATCAGAGAGGAAACCCAGGG + Intronic
1066066581 10:31765391-31765413 TCCTGGAGAGAGGAATCCCAGGG + Intergenic
1070340924 10:75497920-75497942 TACATGAGAGTGGAACTACTGGG + Intronic
1073295047 10:102433765-102433787 GACAGGAGAGCTGAACTCCAGGG + Intergenic
1076440279 10:130476749-130476771 GTCATGAGAGTGGAGCCCCATGG - Intergenic
1079359040 11:19755072-19755094 TGCAGAAGAGTGGATCCCAAGGG - Intronic
1084771635 11:71346377-71346399 TAAAGAAGAGTGGAAACGCAAGG - Intergenic
1084893616 11:72249916-72249938 TCCAGAAGAGTGGAGCCTCAGGG - Intergenic
1086747056 11:90441875-90441897 GACTGGAGAGTGGATCCACATGG - Intergenic
1087181291 11:95144885-95144907 GACAGGAGAGAGGAATCCCATGG + Intergenic
1088692187 11:112337581-112337603 TTCATGAGGGTGGAACCTCATGG - Intergenic
1092089641 12:5793904-5793926 TGGAGGAGAGTGGCACTCCATGG + Intronic
1092772104 12:11906139-11906161 CACAGCAGAATGGAAGCCCATGG + Intergenic
1095908041 12:47397495-47397517 TCCAGGAGAGTGGTGCTCCAGGG - Intergenic
1098042746 12:66368694-66368716 TACAGGCTAGTAGTACCCCAGGG + Intronic
1100873447 12:98937643-98937665 TACAGTACAGTGGAAGCCCAAGG - Intronic
1103326443 12:120124401-120124423 TGCAGGATAGTGGAGCCACAGGG - Intergenic
1104979798 12:132568763-132568785 CACAGGAGAGAGGGAGCCCACGG - Intronic
1108705566 13:52982416-52982438 AACTGGAGAGTGGAATCCCATGG + Intergenic
1111386540 13:87536208-87536230 TCCTGGAGAGTGGTGCCCCAGGG + Intergenic
1113069602 13:106407664-106407686 AACCGGAGTGTGGAGCCCCAAGG + Intergenic
1114633938 14:24177056-24177078 TCCAGGAGAGTGGATCCCAGAGG - Intronic
1116805351 14:49489075-49489097 TACCGAAGAGTGGAGCTCCAGGG + Intergenic
1121735993 14:96218511-96218533 TACAGGACAAGGGAAGCCCAAGG + Intronic
1122411331 14:101527591-101527613 TACTGGAGGCTGGAACCCAAGGG + Intergenic
1123833439 15:24165097-24165119 TACAGGATGATGAAACCCCAAGG - Intergenic
1124359967 15:29029560-29029582 CTCAGGAGATGGGAACCCCAGGG + Intronic
1124382339 15:29177207-29177229 TACACGAGAGCGGGACCCCTCGG - Intronic
1124701890 15:31921448-31921470 TACAGAAGAGTGCCACCACAGGG + Intergenic
1127309914 15:57743526-57743548 GGCAGGAGTGTGGAACCCCCTGG + Intronic
1127913657 15:63437977-63437999 TATTGGAGGGTGGAACCCAAGGG + Intergenic
1128128213 15:65208536-65208558 TATGGGAGAGTGGACTCCCAAGG - Intronic
1128747263 15:70123364-70123386 TCCAGGAAAGGGGAACCCAAGGG + Intergenic
1131390313 15:92042758-92042780 TATAGGAGAGTGAAAGCACAAGG + Intronic
1135458991 16:22624664-22624686 CACAGGAGAGAGGAATTCCAAGG + Intergenic
1136532191 16:30877083-30877105 AGGAGGAGAGTGGAACACCAGGG + Intronic
1139177014 16:64700947-64700969 TTCAGGAGGGTGGAGCCACAAGG - Intergenic
1139273614 16:65706330-65706352 TAAGGGACAGGGGAACCCCAAGG + Intergenic
1151387901 17:73766511-73766533 TACAGGAGATTGGAGCCCACAGG + Intergenic
1151513785 17:74579288-74579310 GACTGGAGACTTGAACCCCACGG + Intergenic
1154124176 18:11674824-11674846 TATAGGAGCGTGGAACCCAGGGG + Intergenic
1154310944 18:13265803-13265825 TGCAGCAGAGTGGAGTCCCAGGG - Intronic
1156549979 18:38005088-38005110 TAAATGAGAGTAAAACCCCAGGG - Intergenic
1157411537 18:47466981-47467003 TACTGGAGGGTGCAATCCCAGGG - Intergenic
1157738896 18:50074788-50074810 TCCAGGAGATTGGAGACCCATGG + Intronic
1157904591 18:51558293-51558315 TACAGGAGTCTGCAACCCCTGGG + Intergenic
1160736400 19:664444-664466 GACAGGAGCGTGGAACTCAAGGG + Intergenic
1160774799 19:850542-850564 CACAGGCAAGTGGACCCCCATGG - Intergenic
1160985366 19:1836108-1836130 GAGAGGAGAGTGGATGCCCAGGG - Intronic
1161856216 19:6767369-6767391 CCCAGGTGAGTGGAGCCCCAGGG - Exonic
1166307738 19:41944519-41944541 TACACGAGAGTGACACCCCCAGG + Intergenic
1167560766 19:50225717-50225739 TACAGGAGCTGGGAACCTCAGGG + Intronic
1168650011 19:58086824-58086846 TGCAGGAGACTGTGACCCCAGGG - Intronic
926292573 2:11542429-11542451 TACGGGAGAGTGGATCTGCAAGG - Intronic
928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG + Intronic
933865445 2:86512208-86512230 TTCAGGAGGGTGGAACCTCATGG - Intronic
933994940 2:87661269-87661291 TCCAAGAGAGTGGGAACCCAAGG + Intergenic
934773225 2:96921264-96921286 TGCAGGAGAACGGCACCCCATGG + Intronic
936019395 2:108983498-108983520 TACAGGAAAGTGGAAGGCCACGG - Intronic
939012582 2:136863903-136863925 TACAGGACCGTGAAACCCAAGGG + Intronic
940291519 2:152081945-152081967 TGAAGGTGAGTGGAACCACAAGG - Intronic
942322571 2:174748664-174748686 CAGGGGAGAGTGGAAGCCCATGG + Exonic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944061168 2:195570441-195570463 TACAGGAGACAGGAACCCGCTGG - Intergenic
944097471 2:195985288-195985310 TGAAGGAGAGTGGAACAGCATGG + Intronic
947368915 2:229425142-229425164 TACAGGAGAGAGTCACCCCATGG - Intronic
948035814 2:234857613-234857635 GGCAGAAGCGTGGAACCCCACGG - Intergenic
1171240795 20:23565674-23565696 CCCAGGAGACTGGGACCCCAGGG + Intronic
1172661463 20:36572092-36572114 TTCAGAAGAGGGGAGCCCCAGGG - Intergenic
1173061089 20:39661821-39661843 TACAGGAGACTAGAACCCGTTGG + Intergenic
1173860264 20:46278395-46278417 TCCAGGAGACTAGAACTCCATGG + Intronic
1174551570 20:51366198-51366220 TCCAGGGGCCTGGAACCCCAGGG - Intergenic
1175736973 20:61393846-61393868 TACAGAAGAGGAGAAGCCCATGG - Intronic
1179416914 21:41206155-41206177 TTCTGGAGACTGGAAACCCAAGG + Intronic
1180252790 21:46600570-46600592 TACAGAAGATTGTAACTCCACGG + Intronic
1184997874 22:48223628-48223650 CACAGGAAGGTGGGACCCCAGGG - Intergenic
950046595 3:9952007-9952029 TCCAGCAGAGTGGGAGCCCAGGG - Intronic
953553336 3:43922497-43922519 TACAGGAGAGTGTAATAGCAGGG + Intergenic
954684889 3:52365093-52365115 GACAGGACAGTCCAACCCCAGGG + Intronic
957092241 3:75742496-75742518 TTCAGTAAAGTGGAACCTCATGG - Intronic
957665415 3:83218868-83218890 TTCAGGAGTGGGGAACTCCAGGG + Intergenic
960753662 3:120983680-120983702 TATAGGAGTGTGGAGCCCTAGGG + Intronic
960902161 3:122564198-122564220 TGCAGGAGAGGGGACCCCGAGGG + Intronic
961469952 3:127105367-127105389 TTCAGGAGAATGAAACCCAATGG + Intergenic
961524733 3:127489516-127489538 CACAGGCCAGTGGAAGCCCAGGG + Intergenic
961551784 3:127673633-127673655 AACGGGATAGTGGAAGCCCAAGG - Intronic
962208246 3:133453601-133453623 TACAGGAGAGGGGAAAGGCAAGG + Intronic
962890494 3:139668066-139668088 TACAGGCAAGAGGAACCCAAGGG + Intronic
963612000 3:147481439-147481461 AGCAGCAGAGTGGAACCTCAGGG - Intronic
964902489 3:161676340-161676362 TAGAAGAGAGTGGAACCATAGGG - Intergenic
966378417 3:179320593-179320615 TACAGGCGCGTGGCACCACACGG - Intergenic
968177029 3:196559472-196559494 TGCAGGAGAGGGGAACAGCATGG + Intronic
968550632 4:1222004-1222026 TACAGGAATGTGGAAGCCCTGGG - Intronic
969905916 4:10395993-10396015 TCCAGGAGAGGGGTACCCCAGGG + Intergenic
971169167 4:24215699-24215721 TACAGGAGGGAGGAAAACCATGG - Intergenic
973932000 4:55802733-55802755 TATTGGGGAGTGCAACCCCAGGG - Intergenic
978744283 4:112174302-112174324 TACAGCAGGGTGTCACCCCAGGG + Intronic
979710683 4:123775789-123775811 TTCAGGAAAGTGGAAGCACAGGG + Intergenic
979940365 4:126754543-126754565 TTCAGGAGAGGGGCACCCCATGG - Intergenic
980421571 4:132566783-132566805 TGCAGAAGTGTGGAACCCCAGGG + Intergenic
982463164 4:155696426-155696448 TTCACAAGAGTGGAACACCACGG - Intronic
984827877 4:183943921-183943943 TACAGCAGAGTGGCATCCCCTGG - Intronic
984883498 4:184430171-184430193 TAGAGGAGAGAGGAAGTCCATGG - Intronic
988688754 5:33550536-33550558 TTCAGGACATGGGAACCCCAAGG - Intronic
992791454 5:80217989-80218011 TACAGAAGTGTGGAACCCAGAGG - Intronic
995978394 5:118071295-118071317 TACAGAATTGTGGAATCCCATGG - Intergenic
997688584 5:135809807-135809829 TACTGGTGAGTGGTACTCCACGG + Intergenic
1002332693 5:178455393-178455415 CACAGCAGGGTGGAACCCCAGGG + Intronic
1002564703 5:180104278-180104300 TCCATGAGGGTGGAACCTCATGG - Intronic
1003195291 6:3909096-3909118 TAGTGGAGAGTGGAAGCCCTGGG - Intergenic
1006335423 6:33418015-33418037 TACAGGAGAGTTGATCTCAAAGG + Intronic
1009190443 6:60623098-60623120 CACAGGAGAATAGAACCTCATGG + Intergenic
1011148283 6:84242722-84242744 TCATGGAGAGTGGAAGCCCATGG + Intergenic
1012939719 6:105403385-105403407 TGTAGGAGAGTGAAGCCCCAGGG + Intergenic
1017328889 6:153172591-153172613 TCCAGGAGGGAGGAGCCCCATGG + Intergenic
1018753199 6:166825423-166825445 TACAGCAGAGAGGGACCCCTGGG + Intronic
1018836098 6:167485345-167485367 TACAGGAGTGTGCAGCCCCACGG + Intergenic
1019875810 7:3809526-3809548 AACACGAGAGTGGAACCCTTTGG + Intronic
1020403000 7:7798824-7798846 TACAGGAGAGTGAAACCTAAGGG - Intronic
1024125175 7:46287228-46287250 TTCAGGACAGTGTAACCTCAGGG + Intergenic
1029142423 7:98421028-98421050 CAGGGGAGAGTGGAACTCCAGGG - Intergenic
1031073427 7:117188540-117188562 TACAGGAAAGTGAAAGCACAGGG - Intronic
1034505064 7:151482456-151482478 TCCAGGCAAGTGTAACCCCAGGG + Intronic
1036799130 8:11776769-11776791 TGCAGCAGAGGGGAGCCCCAAGG - Intronic
1038183536 8:25251026-25251048 CACAGGAGAGGGGAGCTCCATGG - Intronic
1040439482 8:47426111-47426133 TACAGGAGTGTGTGCCCCCATGG - Intronic
1043872767 8:85453191-85453213 TAGAGGAGACTGGAATTCCAGGG + Intergenic
1045861172 8:106816317-106816339 TAAAGGAAAGTGGGACCTCACGG + Intergenic
1046924004 8:119767447-119767469 AGTAGGAGTGTGGAACCCCAGGG - Intronic
1047914584 8:129568215-129568237 TTCAGGTGAGAGGAACCTCACGG - Intergenic
1050352198 9:4750914-4750936 CTCAGGAGGGTGGAGCCCCATGG + Intergenic
1052543499 9:29842636-29842658 TACAGTAGAGTTGAAGCCTAAGG + Intergenic
1055550181 9:77425920-77425942 TACAGGAGAGGGGACCCAGAAGG - Intronic
1057037977 9:91825376-91825398 TACAGGTGAGTGGAGCCCACCGG - Intronic
1057496200 9:95563529-95563551 TCCAGGAGACTGGGATCCCAAGG + Intergenic
1059247029 9:112857127-112857149 GACACGAGAGTGAAGCCCCAGGG - Intronic
1203769306 EBV:40822-40844 TCCAGGATAATGGAACCCTATGG - Intergenic
1203789584 EBV:143741-143763 TCCAGGATAATGGAACCCTATGG - Intergenic
1188890515 X:35606331-35606353 TCCTGGAGAGTGGCACGCCAAGG + Intergenic
1189307026 X:39994609-39994631 TCCAGGAGTCTGGAACCCGAAGG - Intergenic
1189401074 X:40669302-40669324 AACAGGATTGTAGAACCCCAGGG - Intronic
1193149748 X:78112829-78112851 CACAGGAAACTGGAAGCCCATGG - Intronic
1196090121 X:111731597-111731619 TACAGAAGATTGGAGGCCCAAGG + Intronic
1197767516 X:130068778-130068800 TACACGAGAGGGGCTCCCCAGGG - Intronic
1198044671 X:132889391-132889413 TACAGGAGAGTGTGAATCCATGG + Intronic
1200743058 Y:6876557-6876579 TGCAGAAGAGTGGAACCCTGGGG - Intergenic
1200964722 Y:9025641-9025663 TCCGGGAGAGAGCAACCCCAAGG + Intergenic
1202148387 Y:21823145-21823167 CCCAGGAGAGAGCAACCCCAAGG - Intergenic