ID: 905958990

View in Genome Browser
Species Human (GRCh38)
Location 1:42027558-42027580
Sequence CTGTGTGAAGAACAGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1311
Summary {0: 1, 1: 2, 2: 18, 3: 156, 4: 1134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905958990_905958996 29 Left 905958990 1:42027558-42027580 CCTCCTTGCTGTTCTTCACACAG 0: 1
1: 2
2: 18
3: 156
4: 1134
Right 905958996 1:42027610-42027632 GCACTTGCTGAACCCTCTGTAGG 0: 1
1: 0
2: 3
3: 21
4: 159
905958990_905958993 0 Left 905958990 1:42027558-42027580 CCTCCTTGCTGTTCTTCACACAG 0: 1
1: 2
2: 18
3: 156
4: 1134
Right 905958993 1:42027581-42027603 GTCAAGCATACAATTACCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 64
905958990_905958994 1 Left 905958990 1:42027558-42027580 CCTCCTTGCTGTTCTTCACACAG 0: 1
1: 2
2: 18
3: 156
4: 1134
Right 905958994 1:42027582-42027604 TCAAGCATACAATTACCTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905958990 Original CRISPR CTGTGTGAAGAACAGCAAGG AGG (reversed) Intronic
900380128 1:2379813-2379835 CGCTGTGGAGAACAGCATGGCGG + Intronic
900628686 1:3622261-3622283 CTATGACAAGAACAGCACGGGGG - Intergenic
900738200 1:4313483-4313505 CTATCACAAGAACAGCAAGGGGG + Intergenic
900743747 1:4346101-4346123 CTGTCCGGAGAACAGCATGGGGG - Intergenic
901259367 1:7860374-7860396 CTGTTTGAGGAACAGCCAGGAGG + Intergenic
901315862 1:8307860-8307882 CTGTCCAGAGAACAGCAAGGAGG + Intergenic
901481281 1:9527049-9527071 TTGTGTGAGGAACTGAAAGGAGG - Intergenic
902571493 1:17349879-17349901 AAGTTTGAAGAACAGGAAGGAGG - Intronic
902800039 1:18823686-18823708 GTGTCTGAGAAACAGCAAGGAGG + Intergenic
902900588 1:19512856-19512878 CTATCACAAGAACAGCAAGGGGG - Intergenic
903477440 1:23629195-23629217 CTGCTCGAAGAACAGCAAGGAGG - Intronic
903483414 1:23671089-23671111 CTTTGAGGAGATCAGCAAGGAGG + Intergenic
903707444 1:25296665-25296687 CTGTCACAAGAACAGCATGGGGG - Intronic
903719795 1:25396689-25396711 CTGTCACAAGAACAGCATGGGGG + Intronic
904195406 1:28781775-28781797 CTGTGTGGAGAACAGACTGGAGG - Intergenic
904317538 1:29675444-29675466 CTATCACAAGAACAGCAAGGGGG + Intergenic
904534620 1:31190871-31190893 CTGAGTCAAGAACATCAAGCTGG - Intronic
904828851 1:33293970-33293992 CTGTGGGAAAAACAACAAGATGG - Intronic
905659345 1:39709562-39709584 CTGTCAGAAGAACAGCTTGGAGG - Intronic
905958990 1:42027558-42027580 CTGTGTGAAGAACAGCAAGGAGG - Intronic
906083605 1:43110393-43110415 CTATCACAAGAACAGCAAGGGGG + Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906771322 1:48487435-48487457 CTATCACAAGAACAGCAAGGGGG - Intergenic
906846234 1:49195904-49195926 CTATGACAAGAACAGCATGGGGG - Intronic
907018682 1:51043289-51043311 CTATCACAAGAACAGCAAGGGGG + Intergenic
907029810 1:51159700-51159722 CACTGTGAAAAACAGCATGGTGG - Intergenic
907086047 1:51675216-51675238 CTGTGTAAAGACTAGCAAGTTGG + Intronic
908094225 1:60720382-60720404 CTATCACAAGAACAGCAAGGGGG - Intergenic
908223496 1:62032974-62032996 CTGTCACAAGAACAGCATGGGGG + Intronic
908478892 1:64517585-64517607 CAGTGGGATGAAGAGCAAGGAGG + Intronic
908727551 1:67193075-67193097 CTGTTCAAAGAGCAGCAAGGAGG - Intronic
908735216 1:67269313-67269335 CTCTTTGAAGAACAGGAGGGAGG + Intergenic
908816079 1:68035764-68035786 CTGTTATGAGAACAGCAAGGGGG - Intergenic
908967032 1:69777847-69777869 CTGTGTGAGGAATAGAATGGGGG - Intronic
909072886 1:71017583-71017605 CTATTATAAGAACAGCAAGGGGG - Intronic
909136624 1:71809078-71809100 ATGTGTGAAAAGCAGCACGGGGG + Intronic
909525081 1:76613627-76613649 CTGTCCGGAGAACAGCAAGGGGG - Intronic
909731778 1:78900598-78900620 CTGTCACAAGAACAGCAAAGGGG - Intronic
910203701 1:84725965-84725987 CTGTCACAAGAACAGCAAGGGGG - Intergenic
910345659 1:86233672-86233694 CTATCATAAGAACAGCAAGGGGG + Intergenic
910553275 1:88500571-88500593 CTGTCGTAAGAACAGCATGGGGG - Intergenic
910668024 1:89745025-89745047 CTGTTTGAAGAATGGCAAGGAGG - Intronic
911466248 1:98256901-98256923 CTATCAGAAGAACAGCATGGGGG + Intergenic
911691061 1:100835380-100835402 CTATCACAAGAACAGCAAGGGGG - Intergenic
911701143 1:100953022-100953044 CTATCACAAGAACAGCAAGGGGG - Intronic
911760427 1:101608315-101608337 CTATGACAAGACCAGCAAGGGGG - Intergenic
912204369 1:107493936-107493958 GTGTGTGAGGAACAGCAAGAGGG + Intergenic
912395329 1:109338271-109338293 CTGTGTTAAGAACTGGCAGGTGG + Intronic
912484156 1:110011296-110011318 CTGTGTGAAGAACATCAAGCAGG + Exonic
912732886 1:112125293-112125315 CTGTTTGAGAAACAGCATGGTGG + Intergenic
912942805 1:114059887-114059909 CTATCACAAGAACAGCAAGGAGG - Intergenic
912964752 1:114227900-114227922 GTGTGGGAAGGACAGCAAGCAGG + Intergenic
913447950 1:118969973-118969995 CTATCACAAGAACAGCAAGGGGG - Intronic
915901916 1:159853795-159853817 CTGGGTGAAGTGCAGGAAGGAGG - Intronic
915985974 1:160465165-160465187 CACTGTGGAGAACAGCAGGGAGG - Intergenic
916225963 1:162489878-162489900 GTGTTTGAAGAACAGGAAGCTGG + Intergenic
916250877 1:162736872-162736894 GTGTTTGAGGAACAACAAGGAGG + Intronic
916384958 1:164256474-164256496 CTATCACAAGAACAGCAAGGGGG - Intergenic
916541986 1:165765744-165765766 ATGTGTAAAGAACAGCAAGCTGG + Intronic
916693890 1:167217891-167217913 CTGTCACCAGAACAGCAAGGGGG - Intergenic
916699098 1:167272667-167272689 CTATTACAAGAACAGCAAGGGGG + Intronic
917127108 1:171696731-171696753 GTGTCTGAGGAACAGCAAAGAGG + Intergenic
917137022 1:171797800-171797822 CTGTGGAAAGAAGAGCCAGGTGG - Intronic
917508794 1:175652569-175652591 CTATCACAAGAACAGCAAGGGGG - Intronic
917601661 1:176580552-176580574 CACTGTGGAGAACAGCATGGAGG - Intronic
917628764 1:176872728-176872750 ATGTTTGAAGAAGAGGAAGGAGG - Intronic
917696945 1:177534924-177534946 CTCTAACAAGAACAGCAAGGGGG + Intergenic
917918388 1:179727610-179727632 TTGTCTGAGGAACAGAAAGGAGG + Intergenic
917922146 1:179759573-179759595 CTGTTTGAAGAACAGAAAGAGGG + Intronic
917971250 1:180209273-180209295 CTGTGATGAGAACAGCATGGGGG - Intergenic
918394555 1:184100431-184100453 CTGTCATGAGAACAGCAAGGGGG - Intergenic
918532593 1:185539627-185539649 CTATCACAAGAACAGCAAGGGGG - Intergenic
918806623 1:189055357-189055379 CTGTCAAAAGAACAGCATGGGGG - Intergenic
918986425 1:191633823-191633845 CACTGTGAAGAACAGTATGGAGG + Intergenic
919349147 1:196426829-196426851 CTATCAGGAGAACAGCAAGGGGG - Intronic
919540473 1:198839269-198839291 CTATTAGAATAACAGCAAGGTGG + Intergenic
919877708 1:201882652-201882674 CTGTAGGAAGAAAAGCAATGAGG + Exonic
920078842 1:203357371-203357393 CTGTCACAAGAACAGCATGGGGG + Intergenic
920193797 1:204212880-204212902 GTGTTTGAAGAACAACAAGGAGG - Intronic
920273632 1:204787171-204787193 CTATCACAAGAACAGCAAGGAGG - Intergenic
920700682 1:208216148-208216170 GTGTCTGAGGAACAGTAAGGAGG - Intronic
920912076 1:210228380-210228402 CTGTTAGAGGAACAGAAAGGAGG + Intergenic
921068792 1:211642198-211642220 CTGTGTGTGGGTCAGCAAGGTGG - Intergenic
921364502 1:214360900-214360922 CTGTCACAAGAACAGCAAGAGGG - Intronic
921550413 1:216528779-216528801 CTGAATCAAAAACAGCAAGGAGG + Intronic
921721501 1:218477272-218477294 CTGTCACAAGAACAGCATGGGGG + Intergenic
921941462 1:220844307-220844329 CTGTGCGAAGAAAAGCCAGCAGG + Intergenic
922132073 1:222789885-222789907 CTATGATGAGAACAGCAAGGGGG + Intergenic
922248536 1:223824832-223824854 GTGTTTGATGAACAGCAAAGAGG - Intronic
922249930 1:223839351-223839373 CAGTGTGAGGCACAGAAAGGGGG + Intronic
922456109 1:225774887-225774909 CTATCACAAGAACAGCAAGGGGG - Intergenic
922457106 1:225783874-225783896 CTGTATCAAAAGCAGCAAGGAGG - Intronic
922573506 1:226647174-226647196 CTGTGTGATGGACTGCAAGATGG - Exonic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
922859070 1:228800021-228800043 CTATCATAAGAACAGCAAGGAGG - Intergenic
922927903 1:229365721-229365743 CTATGACGAGAACAGCAAGGAGG - Intergenic
922976429 1:229787594-229787616 ATGGGTGAAAAACAGGAAGGGGG - Intergenic
923698337 1:236276928-236276950 CTATCAGGAGAACAGCAAGGGGG - Intronic
924002564 1:239570162-239570184 CTGTCACAAGAACAGCATGGGGG - Intronic
924283885 1:242465615-242465637 ATTTGTGAAGAACAGCAGAGAGG - Intronic
924695612 1:246396691-246396713 CTGTCACAAGAACAGCAAGGGGG - Intronic
924936465 1:248776216-248776238 CTATGGTGAGAACAGCAAGGGGG - Intergenic
1062773564 10:125517-125539 CTATCACAAGAACAGCAAGGGGG - Intergenic
1062942702 10:1435945-1435967 CATTGTCAAGAACAGAAAGGTGG - Intronic
1063418863 10:5895155-5895177 CTCTGTGAAGACCAGCAAGTGGG - Exonic
1063714945 10:8517537-8517559 CTGTGTGCATACCAGCAAGCCGG - Intergenic
1063905348 10:10775283-10775305 CTGTCTGAGGCACAGCAAGGAGG + Intergenic
1064214792 10:13391268-13391290 CTGTCACGAGAACAGCAAGGGGG - Intergenic
1064486929 10:15802481-15802503 CTATCAGAAGAACAGCATGGGGG + Intronic
1064885473 10:20106570-20106592 ATGTGGGAAGAACAGGAGGGGGG + Intronic
1065211378 10:23406727-23406749 CTATCTCAAGAACAGCAATGGGG + Intergenic
1065213349 10:23425662-23425684 CTATCACAAGAACAGCAAGGGGG + Intergenic
1065502314 10:26394402-26394424 CTGTCACAAGAACAGCATGGGGG + Intergenic
1065738453 10:28774880-28774902 CTATCACAAGAACAGCAAGGGGG - Intergenic
1066058446 10:31702144-31702166 CTATCACAAGAACAGCAAGGGGG - Intergenic
1066317887 10:34267008-34267030 CTGTGTGAAAAACTGCTACGTGG + Intronic
1066684380 10:37966650-37966672 CTATCTCAAGAACAGCAAGGGGG + Intronic
1067158013 10:43799187-43799209 ATGTGTGATGAACAACATGGGGG + Intergenic
1067457980 10:46437056-46437078 CTATCACAAGAACAGCAAGGGGG + Intergenic
1067629219 10:47947578-47947600 CTATCACAAGAACAGCAAGGGGG - Intergenic
1068128293 10:52867672-52867694 CTATCACAAGAACAGCAAGGAGG - Intergenic
1068235931 10:54232184-54232206 CTGTCACCAGAACAGCAAGGGGG - Intronic
1068305061 10:55198363-55198385 CTGTCACAAGAACAGCAAGGGGG - Intronic
1068604356 10:58989121-58989143 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1069060372 10:63888554-63888576 ATGTTTGAGGAACAGCAAGGAGG + Intergenic
1069515099 10:69070986-69071008 CTGTGTGAAGACCTGGAACGTGG - Intergenic
1070035716 10:72721515-72721537 ATGTTTGAGGAATAGCAAGGAGG - Intronic
1070043702 10:72808848-72808870 CTCTCTTGAGAACAGCAAGGGGG + Intronic
1070068907 10:73066739-73066761 CTGTCACAAGAACAGCATGGGGG - Intronic
1070339573 10:75484754-75484776 CTGTGTGAGACACAGCAAGAAGG + Intronic
1070401721 10:76058792-76058814 CCTTGTGAAGAACAGCAAGTAGG - Intronic
1070427559 10:76304331-76304353 CAGTCTGAAGTACAGGAAGGAGG + Intronic
1070469682 10:76766480-76766502 CTGTGTGAAGAAAGGAAGGGAGG + Intergenic
1070798710 10:79232354-79232376 CTGTGTGTTGGACAGCAAAGGGG + Intronic
1071394477 10:85207802-85207824 GTGTGACAAGAACAGAAAGGAGG - Intergenic
1071446173 10:85749702-85749724 CTGTCTGAGGAACAGAAAGTGGG - Intronic
1071470362 10:85979897-85979919 ATGAGTGAAGATCAGCTAGGAGG - Intronic
1071528568 10:86372533-86372555 CTGTGGGGAGAGCAGCAAGGTGG + Intergenic
1071557871 10:86619838-86619860 CTGTGTCAAGAAAAGAATGGTGG + Intergenic
1071877066 10:89853277-89853299 CTGTCAGGAGAACAGCATGGGGG - Intergenic
1071902062 10:90131353-90131375 CTATCACAAGAACAGCAAGGGGG - Intergenic
1071952141 10:90715855-90715877 CTGTCACAAGAATAGCAAGGGGG - Intergenic
1072048435 10:91680297-91680319 TTGTTTGAAGAACAGAAAGCTGG - Intergenic
1072808347 10:98439907-98439929 CTGTCACAAGAACAGCATGGGGG - Intronic
1072978383 10:100078940-100078962 ACATGTGAGGAACAGCAAGGGGG - Intronic
1072984214 10:100125587-100125609 CTATCACAAGAACAGCAAGGGGG + Intergenic
1073438987 10:103541298-103541320 CTGTGTGAAGAAAAATAAGGAGG + Intronic
1073547723 10:104365948-104365970 GTATGTGCAGAAGAGCAAGGAGG + Exonic
1073633523 10:105173778-105173800 CTGTGAGAAGAACAGAAAGATGG - Intronic
1073681794 10:105712768-105712790 CTGTGTGATGAACAGAAAGCAGG + Intergenic
1073717209 10:106121225-106121247 CTCTCAGAAGAACAGCAAGGGGG + Intergenic
1073815112 10:107197857-107197879 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1073949265 10:108787200-108787222 TTGTGTGGAGAACAGCAGCGAGG - Intergenic
1074440091 10:113470660-113470682 CTGTTTCAAGTAAAGCAAGGTGG + Intergenic
1074443702 10:113500595-113500617 TTGTGTGCAGAACAGCAAGAAGG - Intergenic
1074534992 10:114322405-114322427 GTGTCTGAGGAACAACAAGGAGG - Intronic
1074663993 10:115696962-115696984 CTATCAGGAGAACAGCAAGGGGG + Intronic
1074930889 10:118124830-118124852 CTGTCACAAGAACAACAAGGGGG - Intergenic
1075065914 10:119288754-119288776 GTGGGTGAGGAACAGCAGGGAGG - Intronic
1075126759 10:119706614-119706636 CTATCAGAAGAACAGCATGGAGG - Intergenic
1075681683 10:124337853-124337875 CTATCGCAAGAACAGCAAGGGGG - Intergenic
1075821986 10:125322500-125322522 GTGTTTGAGGAACAGCAAGAAGG + Intergenic
1076434893 10:130433655-130433677 CTATCACAAGAACAGCAAGGGGG + Intergenic
1076448115 10:130532566-130532588 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1076460372 10:130640162-130640184 CTGTTTTGAGAACAGCAAGGGGG + Intergenic
1076561092 10:131364738-131364760 CTCTGTGAAGGAAATCAAGGTGG - Intergenic
1077078605 11:712645-712667 AGGTGTGGAGGACAGCAAGGGGG - Intronic
1077138941 11:1015070-1015092 CTGTGAGAGGAACACCCAGGAGG + Intronic
1077237205 11:1487446-1487468 CTGTGTGCAGACCAGCCAGAAGG - Intronic
1077741615 11:4852418-4852440 CTGTGTGAAGAACTGTAGGCTGG + Intronic
1078250058 11:9609492-9609514 GTGTTTGAGGAACGGCAAGGAGG + Intergenic
1078266950 11:9762163-9762185 CTGTGTGAGGAACATCAGTGAGG + Intergenic
1078296379 11:10075534-10075556 CTATCATAAGAACAGCAAGGGGG - Intronic
1078642275 11:13107955-13107977 GTGTCTGAAGAACTACAAGGAGG - Intergenic
1078648478 11:13164765-13164787 GTGGGTGAAGAAGAGCAAGAGGG - Intergenic
1078697449 11:13648660-13648682 CTATCACAAGAACAGCAAGGGGG - Intergenic
1079100014 11:17535270-17535292 CTGTGGGAAGAACTGAAAGGAGG - Intronic
1079120151 11:17677185-17677207 CTATCATAAGAACAGCAAGGGGG + Intergenic
1079259918 11:18868476-18868498 CTGTATGCAGAACCCCAAGGTGG + Intergenic
1079346380 11:19656411-19656433 GTGTGTGAGGAACAGAAAGAAGG + Intronic
1079769850 11:24445271-24445293 CTATTACAAGAACAGCAAGGGGG - Intergenic
1080165502 11:29231521-29231543 ATGTGTGAGAAACAGCAAGGAGG + Intergenic
1080236831 11:30079670-30079692 CTGTTATAAGAACTGCAAGGGGG - Intergenic
1080924325 11:36740240-36740262 ATGTTTGAAGAACATCAAGGAGG + Intergenic
1081076064 11:38675383-38675405 CTGTCACAAGAACAGCATGGGGG - Intergenic
1081123204 11:39291444-39291466 CTGTCATAAGAACAGCAAGGGGG - Intergenic
1081270065 11:41072442-41072464 CTGTCACAGGAACAGCAAGGGGG - Intronic
1081300090 11:41440717-41440739 CTGTCATGAGAACAGCAAGGGGG - Intronic
1081444293 11:43115444-43115466 CTATCACAAGAACAGCAAGGGGG + Intergenic
1081558449 11:44189624-44189646 CTGTCATGAGAACAGCAAGGGGG + Intronic
1082193704 11:49276636-49276658 CTATCACAAGAACAGCAAGGGGG - Intergenic
1083553250 11:63606722-63606744 GTGTCTGAGCAACAGCAAGGAGG + Intronic
1083557918 11:63646976-63646998 GTATTTGAAGAACAGGAAGGAGG - Intronic
1084200019 11:67550459-67550481 CTATCTCAAGAACAGCATGGGGG - Intergenic
1084268328 11:68016324-68016346 CTGCTTGAGGAGCAGCAAGGAGG + Intronic
1084300691 11:68249461-68249483 CTGTCATAAGAACAGCATGGGGG - Intergenic
1084788999 11:71461775-71461797 CTGTCAGGAGAACAGCACGGAGG + Intronic
1085287697 11:75374882-75374904 ATGGCTGAAGAACAGCAAGGAGG + Intergenic
1085490891 11:76915867-76915889 CAGTCTCAAGAACAGCATGGGGG + Intronic
1086672440 11:89564423-89564445 CTATCACAAGAACAGCAAGGGGG + Intergenic
1086821714 11:91443676-91443698 CTGTCATAAGAAGAGCAAGGGGG + Intergenic
1087601989 11:100328625-100328647 CTATCAAAAGAACAGCAAGGGGG + Intronic
1087847850 11:102993477-102993499 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1087923977 11:103898497-103898519 TAGTGTGAGGAACAGCAAGACGG - Intergenic
1088045081 11:105440605-105440627 CTGTGTGGAAAACAGCAGGCTGG + Intergenic
1088097594 11:106118152-106118174 GTGTGTGAATAACAGCAAGAAGG - Intergenic
1088273705 11:108061967-108061989 CTGTCACAAGAACAGCATGGGGG + Intronic
1088539250 11:110896087-110896109 CTATAAGGAGAACAGCAAGGGGG + Intergenic
1088771213 11:113037669-113037691 TTTAGTGAAGAACAGTAAGGAGG - Intronic
1090732197 11:129581574-129581596 CTGTGTGAATAAGCGCATGGAGG + Intergenic
1091398921 12:171202-171224 CGGTGAGAAGAAGAACAAGGGGG - Intronic
1092221965 12:6720131-6720153 GTGTCTGAAGAGCACCAAGGAGG - Intergenic
1092618313 12:10235608-10235630 CTGTCAGGAGAACAGCATGGGGG + Intergenic
1092621598 12:10277292-10277314 CTGAGCTAAGAAAAGCAAGGAGG + Intergenic
1093046268 12:14448722-14448744 CTCTATGAAGAACAGAATGGGGG - Intronic
1093510417 12:19920553-19920575 CTGTGATGAGAACAGCAAGGGGG - Intergenic
1093547379 12:20365090-20365112 ATGTATGAAGAACACAAAGGTGG + Intergenic
1093671952 12:21886979-21887001 CTGTGTGAAGAAAATGAAAGAGG - Intronic
1094120639 12:26970370-26970392 CCGTGTGAAGAGCAGTAAGAGGG - Intergenic
1094277059 12:28689371-28689393 CTATCACAAGAACAGCAAGGGGG - Intergenic
1094465432 12:30749182-30749204 ATGTCTGAGGAGCAGCAAGGAGG + Intronic
1094773846 12:33698133-33698155 CAGTGGGAAGAAAAGCAAAGAGG + Intergenic
1095196921 12:39330263-39330285 CTGTGTAAATAACAGCAAAAAGG + Intronic
1095361841 12:41351637-41351659 CTGTCACAAGATCAGCAAGGGGG + Intronic
1095715766 12:45344553-45344575 CTATCACAAGAACAGCAAGGGGG + Intronic
1096015073 12:48263886-48263908 CTATCACAAGAACAGCAAGGGGG + Intergenic
1096735486 12:53650453-53650475 TTGAGAGATGAACAGCAAGGTGG + Intronic
1096811312 12:54172292-54172314 GTGTTGGAAGAACAGCAATGAGG - Intronic
1096907783 12:54951181-54951203 CTGTCATGAGAACAGCAAGGGGG - Intronic
1097139148 12:56885263-56885285 CTGTCACAAGAATAGCAAGGTGG - Intergenic
1097401495 12:59133962-59133984 CTGTGACAAAAACAGCAAGGGGG + Intergenic
1097652633 12:62320232-62320254 CTATCACAAGAACAGCAAGGGGG - Intronic
1097979654 12:65724833-65724855 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1098158935 12:67629266-67629288 GTGTGTGAGGAACAGCAACAAGG + Intergenic
1098378390 12:69842151-69842173 CTGTGTTAAGAAATGCAATGTGG + Intronic
1098420572 12:70292560-70292582 GTGTTTGAGGAATAGCAAGGAGG + Intronic
1098614527 12:72506948-72506970 CTATCAGGAGAACAGCAAGGGGG - Intronic
1098882149 12:75927556-75927578 CTATCACAAGAACAGCAAGGGGG + Intergenic
1098908864 12:76188974-76188996 CTGTTTAAAGAACATTAAGGAGG - Intergenic
1099408035 12:82286569-82286591 CTGTGAGGAGAATAGCATGGGGG + Intronic
1099429467 12:82564979-82565001 CTATCATAAGAACAGCAAGGGGG + Intergenic
1099587274 12:84533981-84534003 CTATCACAAGAACAGCAAGGGGG - Intergenic
1099843220 12:87993684-87993706 GTGTGTGAAGAGTAGGAAGGAGG - Intronic
1099868990 12:88322412-88322434 CTATCACAAGAACAGCAAGGGGG + Intergenic
1100024966 12:90116945-90116967 CTATCACAAGAACAGCAAGGGGG - Intergenic
1100376235 12:94018467-94018489 CTATCACAAGAACAGCAAGGGGG - Intergenic
1100403197 12:94250130-94250152 ATGTTTGAAGAGCAGCAAGGAGG + Intronic
1100442221 12:94627578-94627600 GTGTTTGAGGCACAGCAAGGAGG - Intronic
1101051927 12:100872935-100872957 CTATCACAAGAACAGCAAGGAGG - Intronic
1101139717 12:101782809-101782831 ATGTTTGAAGAAAAGCCAGGAGG - Intronic
1101270466 12:103138327-103138349 CTATCACAAGAACAGCAAGGAGG - Intergenic
1101360466 12:104021466-104021488 CTGTGGGAAGAGCAGCGTGGAGG - Exonic
1101635688 12:106539622-106539644 CTATCACAAGAACAGCAAGGAGG + Intronic
1102198979 12:111044419-111044441 TTGTTTGAGGCACAGCAAGGAGG - Intronic
1102278687 12:111601167-111601189 GAGTCTGAGGAACAGCAAGGAGG + Intergenic
1102387690 12:112523947-112523969 CTATCACAAGAACAGCAAGGGGG - Intergenic
1102403082 12:112647786-112647808 CGGTTTGAGGAATAGCAAGGAGG + Intronic
1102456547 12:113074446-113074468 GTATTTGAGGAACAGCAAGGAGG + Intronic
1102500819 12:113351139-113351161 ATGTTTTAAGAACATCAAGGAGG + Intronic
1102656904 12:114489725-114489747 CTGTGTGCAAAACAGCAAAGGGG - Intergenic
1102658429 12:114503452-114503474 CTCTCACAAGAACAGCAAGGGGG - Intergenic
1102662588 12:114542815-114542837 CTATCTTAAGAACAGCATGGAGG + Intergenic
1102694132 12:114785057-114785079 ATGTTTGAAGAAGAGCAAGGAGG + Intergenic
1102940365 12:116936289-116936311 GTGTTTGAAGAACAGCAGGAAGG + Intronic
1103468981 12:121165015-121165037 CTATCACAAGAACAGCAAGGAGG + Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104466918 12:128997986-128998008 CTGTCACAAGAACAGCACGGGGG - Intergenic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1104769874 12:131354758-131354780 CCCTGTGAAGAGCAGAAAGGAGG + Intergenic
1104967169 12:132513572-132513594 CTGTGCCAACAACAACAAGGTGG - Intronic
1106130942 13:26939017-26939039 CTATCACAAGAACAGCAAGGGGG + Intergenic
1106532552 13:30607370-30607392 CTTTCACAAGAACAGCAAGGGGG - Intronic
1106622056 13:31380157-31380179 TAGTGTGAACAACAGTAAGGTGG - Intergenic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1106909536 13:34448674-34448696 CTATGTGAGCTACAGCAAGGAGG - Intergenic
1106924135 13:34595412-34595434 CTATCACAAGAACAGCAAGGGGG + Intergenic
1107226215 13:38050701-38050723 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1107332128 13:39312286-39312308 CTGTCTGCAGAACAGGAAGGGGG + Intergenic
1107447655 13:40482846-40482868 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1107797898 13:44073357-44073379 TTGTTTGAGTAACAGCAAGGAGG - Intergenic
1108394837 13:49982035-49982057 ATGTTTGAGGAATAGCAAGGAGG + Intergenic
1108612276 13:52095961-52095983 CTATCACAAGAACAGCAAGGGGG - Intronic
1108979615 13:56493585-56493607 CTATGACAGGAACAGCAAGGAGG + Intergenic
1109013299 13:56976658-56976680 CTATCAGAAGAACAGCATGGGGG + Intergenic
1109490932 13:63099552-63099574 CTATCACAAGAACAGCAAGGGGG - Intergenic
1109576168 13:64262615-64262637 CTATCTCAAGAACAGCATGGTGG - Intergenic
1109672353 13:65625954-65625976 CTGTCGCAAGAACAGCATGGAGG + Intergenic
1110125984 13:71942689-71942711 CTATCTTGAGAACAGCAAGGGGG - Intergenic
1110319946 13:74149829-74149851 GTGTGTTCAGAACAACAAGGAGG - Intergenic
1110370527 13:74734976-74734998 CTATATTGAGAACAGCAAGGGGG - Intergenic
1110454774 13:75679092-75679114 CTGTGTCATGAAAAGAAAGGGGG - Intronic
1110636188 13:77769132-77769154 GTGTTTGAGGAAGAGCAAGGAGG + Intergenic
1110920485 13:81078024-81078046 CTATCACAAGAACAGCAAGGGGG + Intergenic
1110955854 13:81551286-81551308 CTATTTTAAGAACAGCATGGAGG + Intergenic
1111246379 13:85547338-85547360 CTGTCACAAGAACAGCAAAGGGG + Intergenic
1111568367 13:90047011-90047033 CTATCATAAGAACAGCAAGGGGG + Intergenic
1111574633 13:90136048-90136070 GTATCTGAAAAACAGCAAGGAGG - Intergenic
1111986660 13:95072753-95072775 TTATGTGAAGAACAGAAGGGAGG - Intronic
1111997104 13:95175957-95175979 CTGTGGGAAGGACAGCAGGCAGG - Intronic
1112109273 13:96276461-96276483 CTGTGTGATGCTCAGCAAGTTGG + Intronic
1112154769 13:96805251-96805273 CTATCACAAGAACAGCAAGGGGG - Intronic
1112653700 13:101425761-101425783 CTGTCACGAGAACAGCAAGGGGG - Intergenic
1112759435 13:102677377-102677399 CTGTGTGGAGAACAGGCAGCGGG - Intronic
1113068054 13:106391691-106391713 TTGTGTGAAGAAGAGAAGGGAGG - Intergenic
1113149775 13:107250812-107250834 CTATGCCAAGAATAGCAAGGGGG - Intronic
1113496463 13:110733843-110733865 CTATCACAAGAACAGCAAGGGGG + Intergenic
1113570250 13:111348709-111348731 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1113673327 13:112190010-112190032 CTATCACAAGAACAGCAAGGGGG - Intergenic
1114330237 14:21629472-21629494 CTATCACAAGAACAGCAAGGGGG + Intergenic
1115465906 14:33713904-33713926 GTGTTTGAGGAATAGCAAGGAGG - Intronic
1116397057 14:44459068-44459090 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1116543676 14:46135034-46135056 CTATTATAAGAACAGCAAGGAGG + Intergenic
1116549121 14:46211614-46211636 CTGTTATAAGAACAGCAAGGGGG - Intergenic
1116569796 14:46501523-46501545 CTGTGTTGAGCACAGAAAGGTGG + Intergenic
1116662870 14:47734513-47734535 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1116664192 14:47754086-47754108 CTATCAGAAGAACAGCAAGGGGG + Intergenic
1116694237 14:48151173-48151195 CTATCACAAGAACAGCAAGGGGG - Intergenic
1116713439 14:48397938-48397960 CTATCGTAAGAACAGCAAGGGGG - Intergenic
1116902677 14:50377051-50377073 GTGTTTCTAGAACAGCAAGGAGG + Intronic
1116967769 14:51031942-51031964 CTGTGTGGAGGGCAGAAAGGAGG + Intronic
1117236333 14:53780917-53780939 CTGTAAGGAGAAGAGCAAGGGGG + Intergenic
1117241586 14:53839090-53839112 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1117294998 14:54370961-54370983 GTGTCTGAGGAACAGCAAGGAGG - Intergenic
1117336225 14:54759342-54759364 GAGTCTGAGGAACAGCAAGGAGG - Intronic
1117475047 14:56085594-56085616 TTGTTTGAAGAACAGGAAAGAGG - Intergenic
1117555482 14:56879174-56879196 CTGTTTGAAGAACAGATAGTAGG - Intergenic
1118020825 14:61712286-61712308 GTGTTTTAAGAACAGTAAGGAGG + Intronic
1118101712 14:62613163-62613185 CTATCACAAGAACAGCAAGGGGG + Intergenic
1118113202 14:62746006-62746028 CTGTGTGGAGAACAAAATGGGGG + Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1118434537 14:65757495-65757517 CTGTTCGGAGAATAGCAAGGAGG + Intergenic
1118669152 14:68103035-68103057 CTATCAGAAGAACAGCATGGGGG + Intronic
1119007229 14:70942908-70942930 CTATCTCAAGAACAGCATGGGGG - Intronic
1120072792 14:80122614-80122636 CTATCACAAGAACAGCAAGGGGG - Intergenic
1120164591 14:81182860-81182882 GTATGTGAGGAACAGCAAGGAGG - Intronic
1120326683 14:83038240-83038262 CTATTACAAGAACAGCAAGGAGG + Intergenic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1120664568 14:87290864-87290886 CTATCTCAAGAACAGCAAGGAGG - Intergenic
1120681899 14:87490043-87490065 CTGTCACAAGAACAGCATGGGGG + Intergenic
1120725571 14:87936095-87936117 TTGTGTGAAGAGCAGCCTGGAGG - Intronic
1120844770 14:89116129-89116151 CTGTTTGAGGAACAAGAAGGAGG - Intergenic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1121896337 14:97651458-97651480 CTATCACAAGAACAGCAAGGGGG - Intergenic
1122435224 14:101690782-101690804 CTATCACAAGAACAGCAAGGGGG + Intergenic
1122765358 14:104065765-104065787 CTATCACAAGAACAGCAAGGGGG + Intergenic
1123104903 14:105836826-105836848 CTGGGGGAAGCACAGGAAGGAGG + Intergenic
1123768375 15:23504194-23504216 TTGTGTGGAGAACAGCAGGTAGG + Intergenic
1123788131 15:23692725-23692747 CTATCAGGAGAACAGCAAGGAGG + Intergenic
1123841483 15:24252422-24252444 CTGTCATAAGAACAGCAAGGGGG + Intergenic
1123856267 15:24415388-24415410 CTATCACAAGAACAGCAAGGGGG + Intergenic
1123872250 15:24588777-24588799 CTATCAAAAGAACAGCAAGGGGG - Intergenic
1124216202 15:27808769-27808791 CTGGGTGAGGAACAGCGAGGAGG + Intronic
1124387999 15:29225776-29225798 CAGTTTGGAGAACAGGAAGGTGG - Intronic
1124463148 15:29911632-29911654 CTGTCACGAGAACAGCAAGGGGG + Intronic
1124837565 15:33210003-33210025 CTATCACAAGAACAGCAAGGGGG + Intergenic
1125206693 15:37161487-37161509 CTATTTCAAGAACAGCATGGGGG - Intergenic
1125236362 15:37518638-37518660 CTATGACAAGAACAGCATGGGGG + Intergenic
1126441481 15:48694333-48694355 TTGTTTGAGAAACAGCAAGGAGG - Intergenic
1126466204 15:48963430-48963452 CTGTGTGCAGAACAGAAGGCTGG - Exonic
1126824931 15:52539596-52539618 CTGTTGCAAGAACAGCATGGGGG + Intergenic
1127059728 15:55169909-55169931 CTGTGAGAAGAGCAGCAGGTAGG - Intergenic
1127107089 15:55628053-55628075 CAGTTTTAAGAACAGGAAGGAGG - Intronic
1127410698 15:58703735-58703757 CTATCAGAAGAACAGCAAGGGGG - Intronic
1127735623 15:61835967-61835989 ATGTGTGAAACACATCAAGGAGG - Intergenic
1127791218 15:62400075-62400097 CTATCAGAAGAACAGCATGGCGG - Intronic
1128239810 15:66094256-66094278 CTGTGTGAACATCAGGGAGGAGG - Intronic
1128334774 15:66778942-66778964 GTGTGTCAGGCACAGCAAGGTGG - Intronic
1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG + Intronic
1128671647 15:69578327-69578349 TGGTGTGAAGACCAGAAAGGAGG + Intergenic
1129040876 15:72685354-72685376 CTGTGTGATGAACAAAACGGAGG - Intronic
1129138166 15:73572911-73572933 CTGTCAGGAGAACAGCAAAGGGG - Intronic
1129278516 15:74464354-74464376 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1129503557 15:76061819-76061841 TAGTGTGAAGGGCAGCAAGGAGG - Intronic
1129552381 15:76466992-76467014 CTATCACAAGAACAGCAAGGGGG - Intronic
1129639597 15:77361647-77361669 CACTATGGAGAACAGCAAGGAGG + Intronic
1129763132 15:78143467-78143489 CCGATTAAAGAACAGCAAGGAGG + Intronic
1130095433 15:80852018-80852040 CTGTGGGTAGAACTTCAAGGGGG + Intronic
1130428593 15:83823684-83823706 CTGTGTGAAGAACAGACTGGAGG - Intronic
1130448620 15:84028839-84028861 CTGTCACAAGAACAGCATGGGGG - Intronic
1130763847 15:86850388-86850410 ATGTGTGAAAAACAGGAAGGGGG - Intronic
1130830125 15:87590873-87590895 TTGTGTGAAGAATAGTAAGAAGG + Intergenic
1131336914 15:91558038-91558060 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1131808451 15:96147683-96147705 CTGTGTGAAGAATAACAATTAGG - Intergenic
1132147495 15:99437327-99437349 CTGGGTCACGGACAGCAAGGAGG - Intergenic
1132237452 15:100232776-100232798 CAGTGTGAAGAACTGTGAGGAGG - Intronic
1132349590 15:101131285-101131307 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1133105893 16:3509275-3509297 GTGTTTGAGGAAAAGCAAGGAGG + Intronic
1133606158 16:7390155-7390177 CTATCAAAAGAACAGCAAGGGGG + Intronic
1133696335 16:8266550-8266572 CTGTCATGAGAACAGCAAGGAGG - Intergenic
1133851218 16:9505659-9505681 CTCTCCCAAGAACAGCAAGGGGG + Intergenic
1133873598 16:9712412-9712434 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1134041325 16:11070733-11070755 GTGTTTGAAGAAGAGCAAGGAGG - Intronic
1134243424 16:12522561-12522583 CTGTCATGAGAACAGCAAGGAGG - Intronic
1134372826 16:13641322-13641344 CTGTCACAAGAACAGCATGGGGG - Intergenic
1134504054 16:14791048-14791070 CTGGGTGAAGAACAGGTGGGTGG - Intronic
1134527892 16:14958283-14958305 CTATCAGGAGAACAGCAAGGAGG - Intergenic
1134576518 16:15337860-15337882 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1134660729 16:15982498-15982520 CTGTCACAAGAACAGCATGGAGG + Intronic
1134725925 16:16418639-16418661 CTGGGTGAAGAACAGGTGGGTGG - Intergenic
1134784164 16:16925726-16925748 CTGTCATAAGAACAGCATGGGGG - Intergenic
1134937663 16:18260012-18260034 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1134941509 16:18293220-18293242 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1135089190 16:19499216-19499238 CAGTGTTAAGAACAGCCACGTGG - Intergenic
1135645826 16:24160921-24160943 GTGTTTGAGGAACAGCGAGGAGG + Intronic
1135814314 16:25618312-25618334 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1135917266 16:26616332-26616354 CTGTCACGAGAACAGCAAGGGGG + Intergenic
1136343001 16:29657060-29657082 CTGTGTGGAAAACAGCCCGGAGG + Intergenic
1136527387 16:30840852-30840874 CTGTCACAAGAACAGCATGGAGG + Intronic
1137358804 16:47793212-47793234 CTATCAGAAGAACACCAAGGGGG + Intergenic
1137382355 16:48011225-48011247 CTATCAGGAGAACAGCAAGGGGG + Intergenic
1137399060 16:48138533-48138555 CTGTCTGAGGAACACCATGGGGG + Intronic
1137399373 16:48140917-48140939 CTGTCTGTAAAACAGCATGGTGG + Intronic
1137707143 16:50543586-50543608 CAGTGTGAAGAAGAGCAGAGAGG + Intergenic
1137724558 16:50648215-50648237 CTGTGAGAAGGACAGGAATGAGG - Intergenic
1137778831 16:51079293-51079315 CTATCACAAGAACAGCAAGGGGG + Intergenic
1137840068 16:51632594-51632616 CTATCACAAGAACAGCAAGGGGG + Intergenic
1138028487 16:53540608-53540630 CTATCACAAGAACAGCAAGGGGG + Intergenic
1138150173 16:54649647-54649669 ATGTTTGAGGAGCAGCAAGGTGG + Intergenic
1138167663 16:54818222-54818244 CAGTATGAAGAAGAGCAGGGGGG - Intergenic
1138518601 16:57555883-57555905 CTATCAGGAGAACAGCAAGGGGG - Intronic
1138773032 16:59687591-59687613 CTATCACAAGAACAGCAAGGGGG + Intergenic
1138828316 16:60348300-60348322 CTATCACAAGAACAGCAAGGGGG + Intergenic
1138902316 16:61287670-61287692 CTGTCTGAGGAAAAGCCAGGAGG - Intergenic
1139166225 16:64567551-64567573 CTGTCACAAGAACAGCATGGGGG - Intergenic
1139173501 16:64659879-64659901 CTGTGTGGAGAACAGTATGGAGG - Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1140059844 16:71559090-71559112 CTATCACAAGAACAGCAAGGGGG - Intronic
1140324449 16:73988002-73988024 CTATCACAAGAACAGCAAGGGGG + Intergenic
1140384322 16:74521146-74521168 GTATCTGAAGAATAGCAAGGAGG + Intronic
1140424530 16:74849693-74849715 CTGTCACGAGAACAGCAAGGGGG - Intergenic
1140820221 16:78656586-78656608 CTGTCATGAGAACAGCAAGGGGG + Intronic
1140907697 16:79423326-79423348 TTGTCTGGAGAGCAGCAAGGAGG + Intergenic
1141373593 16:83509186-83509208 CTTTGTGAATACCATCAAGGTGG - Intronic
1141661107 16:85442045-85442067 CTGTTTGGAGACCAGCAAGGTGG - Intergenic
1141824602 16:86470286-86470308 CGGTGGGGAGAACAGCATGGGGG + Intergenic
1141834820 16:86531801-86531823 CTGTGAGATGAACCGCAGGGCGG + Exonic
1141887698 16:86903948-86903970 CTTTCACAAGAACAGCAAGGGGG - Intergenic
1143015979 17:3891558-3891580 CAGTATGAAGAACAGCAGGGAGG + Intronic
1143097719 17:4487354-4487376 ATGTTTGAGGATCAGCAAGGAGG + Intronic
1143329017 17:6120487-6120509 CTGCGTGGAGAACAACAAGGAGG + Exonic
1143916125 17:10294770-10294792 CTATCACAAGAACAGCAAGGGGG + Intergenic
1144126536 17:12207749-12207771 ATGTTTGAAGGACAGCAAGAGGG - Intergenic
1144193834 17:12871584-12871606 CTGTCTTGAGAACAACAAGGGGG + Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1144508629 17:15856133-15856155 CTATCCGAAGAACAGCATGGGGG - Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1144798063 17:17905947-17905969 GTGTTTGAGGAATAGCAAGGTGG - Intronic
1145009440 17:19359352-19359374 ATGTTTGAGGACCAGCAAGGAGG - Intronic
1146467627 17:33098785-33098807 CTGTGTGGAAAAAACCAAGGAGG + Intronic
1146542746 17:33711741-33711763 CTGTCAAGAGAACAGCAAGGGGG + Intronic
1146601815 17:34223917-34223939 CTGTGTGAGTAATAGCAAGTGGG - Intergenic
1146655872 17:34634888-34634910 CTGGGTGAAGACCTGCAGGGTGG - Exonic
1147227557 17:38991510-38991532 CTATCACAAGAACAGCAAGGAGG - Intergenic
1148761980 17:50009185-50009207 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1149050903 17:52303628-52303650 CTTTGTAAAGAACTGCAATGTGG + Intergenic
1149076675 17:52603796-52603818 CTGTCACAAGAACAGCATGGAGG + Intergenic
1149248816 17:54744225-54744247 ATGTTTGAAGAACAACAAGAAGG + Intergenic
1149616144 17:58001506-58001528 ATGTGGGCTGAACAGCAAGGTGG + Intronic
1149902312 17:60491830-60491852 TTGTGAGAAGAACTGCAAGCTGG + Intronic
1150263924 17:63819673-63819695 CTGTCTGAAGAACAGTGAGGTGG - Exonic
1150515863 17:65808579-65808601 CTATCACAAGAACAGCAAGGGGG - Intronic
1150862135 17:68811575-68811597 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1151635648 17:75346026-75346048 CTGTGAGATGAACTGCAAGGAGG + Intronic
1152596943 17:81242416-81242438 CAGGGTGAAGGACAGCGAGGGGG - Intergenic
1153055553 18:942593-942615 CAGTGAGAAGAACAGCCAGAAGG + Intergenic
1153243822 18:3054378-3054400 ATGTTTGAATAACAGCAAGTTGG - Intergenic
1153440959 18:5118399-5118421 CTATTACAAGAACAGCAAGGGGG - Intergenic
1154091677 18:11369776-11369798 CTATCACAAGAACAGCAAGGGGG + Intergenic
1154249939 18:12736093-12736115 CTATGTGAGGAACAGCGAGAAGG - Intergenic
1154372209 18:13774611-13774633 CTATGATGAGAACAGCAAGGGGG + Intergenic
1155186200 18:23388753-23388775 CTATCATAAGAACAGCAAGGGGG - Intronic
1155463899 18:26114507-26114529 CTATCACAAGAACAGCAAGGGGG - Intergenic
1155482663 18:26306103-26306125 GTGTCCGAAGAACAGAAAGGAGG - Intronic
1155583220 18:27335855-27335877 CTATCACAAGAACAGCAAGGAGG + Intergenic
1156243736 18:35277480-35277502 CTGTCATAAGAACAGCATGGAGG - Intronic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1157389191 18:47287201-47287223 CTATCACAAGAACAGCAAGGCGG - Intergenic
1157797208 18:50585896-50585918 CTGTCACAAGAACAGCATGGGGG + Intronic
1157861219 18:51142413-51142435 CTATCACAAGAACAGCAAGGGGG + Intergenic
1158106486 18:53890475-53890497 CTGTCTGGAGAACAGGATGGGGG + Intergenic
1158129607 18:54138426-54138448 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1158449092 18:57547423-57547445 CTGTCACAAGAACAGCATGGGGG - Intergenic
1158524098 18:58197112-58197134 ATGTGGGAGGAACAGCAAAGTGG + Intronic
1158624014 18:59056446-59056468 CTATCACAAGAACAGCAAGGGGG + Intergenic
1158777810 18:60607271-60607293 CTGTATGAAACACAGAAAGGGGG + Intergenic
1158918635 18:62164564-62164586 CTATCAGGAGAACAGCAAGGGGG + Intronic
1159234282 18:65650975-65650997 CTATCAGAAGAACAGCAAGGGGG + Intergenic
1159280220 18:66275152-66275174 CTTTATTAAGAACAGCATGGAGG - Intergenic
1159468200 18:68813104-68813126 CTATCACAAGAACAGCAAGGGGG - Intronic
1159574814 18:70162601-70162623 CTGTTAGAAGAACAGGATGGGGG + Intronic
1159617002 18:70592411-70592433 CTATCACAAGAACAGCAAGGGGG - Intergenic
1159647502 18:70936424-70936446 CTGTTAGGAGAACAGCAAGGAGG - Intergenic
1159680080 18:71338476-71338498 ATGCTTGAAGAGCAGCAAGGAGG - Intergenic
1159714247 18:71801745-71801767 CTATCTCGAGAACAGCAAGGGGG + Intergenic
1159752054 18:72314804-72314826 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1159752887 18:72324728-72324750 CTGTGTGCAGACCAGGAAGAGGG + Intergenic
1159840981 18:73398825-73398847 CTATCATAAGAACAGCAAGGGGG + Intergenic
1160067961 18:75594960-75594982 CTGTCACAAGAACAGCATGGGGG + Intergenic
1160278349 18:77461415-77461437 CTGTGTGAAGAACAGAAACTAGG - Intergenic
1160396108 18:78573288-78573310 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1160410833 18:78674410-78674432 CTGGGTGACAACCAGCAAGGTGG + Intergenic
1160756737 19:761432-761454 CAGCATGAGGAACAGCAAGGGGG + Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1161243046 19:3233626-3233648 GTGTTGGAGGAACAGCAAGGAGG + Intronic
1161257291 19:3316456-3316478 CTGTTGGAGGAACAGCGAGGAGG + Intergenic
1161258904 19:3324768-3324790 ATGTTGGAGGAACAGCAAGGAGG - Intergenic
1161262489 19:3345556-3345578 GTGTTGGAGGAACAGCAAGGAGG - Intergenic
1161424197 19:4193485-4193507 CTGTTTGAAGGACAAGAAGGAGG + Intronic
1161488315 19:4547844-4547866 GTGTTGGAAGAACAGCAAGGTGG - Intronic
1161492149 19:4567927-4567949 CTGTTGGAGGAACAGCAAGGAGG - Intergenic
1161760587 19:6168205-6168227 GTGTTGGAGGAACAGCAAGGAGG - Intronic
1161863708 19:6818452-6818474 ATGTTGGAGGAACAGCAAGGAGG - Intronic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1162175909 19:8830079-8830101 CTATCAGGAGAACAGCAAGGGGG - Intronic
1162394699 19:10410246-10410268 GTGTTTGAAGAACAACAAAGGGG + Intronic
1163171415 19:15534019-15534041 CTCTGTGGAAAACAGCAAGGTGG - Intronic
1163518587 19:17779211-17779233 CTGTCTGAAGAACAGCAAGGAGG + Intronic
1164606002 19:29598570-29598592 CTGTGTCCAGACCAGAAAGGGGG + Intergenic
1165313052 19:35040105-35040127 ATGTGTGCAAATCAGCAAGGAGG - Intronic
1165342407 19:35222500-35222522 CTGTGGAGAGAACATCAAGGAGG - Intergenic
1165394357 19:35556241-35556263 CTGTCGGAGGAACAGCAGGGAGG + Intronic
1166327284 19:42059030-42059052 GTGTGTACAGAACAGCAAGGAGG - Intronic
1166327576 19:42060656-42060678 GTGTGTGCAGAACAGCAAGGAGG - Intronic
1166810899 19:45514192-45514214 CTGCGGGAAGAGCAGCATGGGGG + Intronic
1166862079 19:45816578-45816600 CTGGGTGGAGAGCAGGAAGGGGG + Intronic
1166875577 19:45895214-45895236 GTGTTTGAGGATCAGCAAGGAGG - Intronic
1167199191 19:48052350-48052372 CTATCACAAGAACAGCAAGGGGG - Intronic
1167472687 19:49684386-49684408 CTGCGTGTGGAACAGCAGGGAGG + Intronic
1168008437 19:53509986-53510008 CTATCAGCAGAACAGCAAGGGGG + Intergenic
1168299093 19:55393163-55393185 CTGTGTAGAGAACAGCCTGGAGG - Intronic
1168469777 19:56630562-56630584 CTGTGTGGAGAACAGGCTGGGGG + Intergenic
925010700 2:483740-483762 TTGTCAGCAGAACAGCAAGGGGG + Intergenic
925342277 2:3145873-3145895 CTGTGTGAAGGACAGGCGGGTGG - Intergenic
925369704 2:3335701-3335723 CTGTCACAAGAACAGCAAGGGGG - Intronic
925479716 2:4256494-4256516 CTGTCATAAGAACAGCAAGGCGG - Intergenic
925482457 2:4291523-4291545 CTGTCACAATAACAGCAAGGGGG - Intergenic
925623326 2:5816651-5816673 CTATCAGAAGAACAGCAAGAGGG - Intergenic
925863189 2:8200202-8200224 CTATCACAAGAACAGCAAGGGGG + Intergenic
925929851 2:8698221-8698243 CTATCACAAGAACAGCAAGGAGG - Intergenic
926219321 2:10924623-10924645 ATGTGGGAATTACAGCAAGGAGG + Intergenic
926221337 2:10937583-10937605 CTATCACAAGAACAGCAAGGGGG + Intergenic
926340949 2:11903898-11903920 CTATCACAAGAACAGCAAGGGGG - Intergenic
926560760 2:14414996-14415018 CTTTCATAAGAACAGCAAGGGGG + Intergenic
926609313 2:14929913-14929935 CTATCACAAGAACAGCAAGGGGG - Intergenic
926638088 2:15205712-15205734 CTATGACAAGAACAGCAAAGGGG - Intronic
926638346 2:15207643-15207665 CTATCACAAGAACAGCAAGGGGG - Intronic
926831776 2:16971083-16971105 CTATCACAAGAACAGCAAGGGGG - Intergenic
926855947 2:17256373-17256395 CTGTTTGAGGAATAGCAAGGAGG - Intergenic
927246508 2:20960934-20960956 CTATCACAAGAACAGCAAGGGGG - Intergenic
927272098 2:21222697-21222719 GTGTTTGAATAATAGCAAGGAGG + Intergenic
927576971 2:24208291-24208313 CTGGGTGCAGAAGATCAAGGCGG - Exonic
928244023 2:29611687-29611709 CTATCACAAGAACAGCAAGGGGG - Intronic
928490255 2:31776504-31776526 ATGTTTGAGGAACAGCAAGGGGG - Intergenic
928541126 2:32284448-32284470 CTATGACAAGAACAGCAAGAGGG - Intronic
928552008 2:32381842-32381864 TTGAGTGAAAAAAAGCAAGGTGG - Intronic
928708131 2:33974109-33974131 ATGGTTGAAGAAAAGCAAGGAGG + Intergenic
928930637 2:36620275-36620297 CTCTTTGCAGAACACCAAGGTGG - Intronic
929100872 2:38312311-38312333 CTGTTAAAAGAACAGCAAGGGGG - Intronic
929326987 2:40626157-40626179 CTGTGTGACAAAGATCAAGGAGG - Intergenic
929351232 2:40957856-40957878 CTATCACAAGAACAGCAAGGGGG + Intergenic
929782965 2:44969533-44969555 GTGCTTGAGGAACAGCAAGGGGG + Intergenic
929925735 2:46206591-46206613 CTATCCCAAGAACAGCAAGGGGG - Intergenic
930216372 2:48701410-48701432 GTATTTGAAGAACAGCAAGGAGG - Intronic
930247740 2:49002626-49002648 TTGTCAGAAGAACAGCATGGGGG + Intronic
930675174 2:54192891-54192913 CTATCTGGAGAACAGCATGGGGG + Intronic
930934319 2:56929170-56929192 CTATCAGGAGAACAGCAAGGGGG - Intergenic
931790564 2:65660169-65660191 CTGTGTTGAGGACAGCGAGGGGG + Intergenic
932235665 2:70119286-70119308 GTGTTTTAAGAACAGCAAGGAGG + Intergenic
932271924 2:70418627-70418649 CTGTCACCAGAACAGCAAGGAGG + Intergenic
932377758 2:71253115-71253137 ATGTTTGAGGAACAGCAAGAAGG - Intergenic
933354842 2:81197607-81197629 CTCTGTGAAGATGAGCAAAGGGG - Intergenic
933465581 2:82646868-82646890 CTGTCACAAGAACAGCATGGGGG + Intergenic
933671208 2:85009149-85009171 CTATCTCAAGAACAGCAAGGGGG - Intronic
933864009 2:86499782-86499804 CTGTCATGAGAACAGCAAGGGGG + Intergenic
934251985 2:90363222-90363244 CCATGTGAAGAAAAGCAATGAGG - Intergenic
934257455 2:91439734-91439756 CCATGTGAAGAAAAGCAATGAGG + Intergenic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935498392 2:103808984-103809006 CTGTCACAAGAACAGCATGGGGG - Intergenic
935743423 2:106170873-106170895 CTGTTTGAAGCACCGTAAGGTGG - Intronic
935851497 2:107225587-107225609 CTGTCATGAGAACAGCAAGGGGG - Intergenic
935855360 2:107267470-107267492 CTTTGTGAAGAACTGGAAGTTGG + Intergenic
935978133 2:108599595-108599617 CACTGTGAAGAACAGTATGGAGG - Intronic
936135751 2:109892191-109892213 CACTGTGAAGAACAGTATGGAGG - Intergenic
936208946 2:110479294-110479316 CACTGTGAAGAACAGTATGGAGG + Intergenic
936472245 2:112809626-112809648 CTATCTCAAGAACAGCAAGGGGG - Intergenic
937376906 2:121343313-121343335 CTCTGTGGAAAACAGCAGGGAGG + Intronic
937465203 2:122126294-122126316 CTATCACAAGAACAGCAAGGGGG - Intergenic
937852109 2:126644867-126644889 CTATCACAAGAACAGCAAGGGGG - Intergenic
937951609 2:127392207-127392229 CTATCACAAGAACAGCAAGGGGG - Intergenic
938020945 2:127905428-127905450 CTGTGTGAGGAACAGCAAGAAGG - Intergenic
938132579 2:128730448-128730470 CTGTGCCAAGGACAGTAAGGAGG + Intergenic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
939785743 2:146509569-146509591 CTGTGTAATGAAAAACAAGGGGG + Intergenic
940245724 2:151613689-151613711 CTATCACAAGAACAGCAAGGGGG - Intronic
940649408 2:156426422-156426444 CTGTGGTGAGAACAGCATGGGGG + Intergenic
940682682 2:156806203-156806225 CTGTCACAAGAAGAGCAAGGGGG + Intergenic
940789357 2:158015691-158015713 CTATCACAAGAACAGCAAGGGGG - Intronic
941187949 2:162340749-162340771 CTATTTGAAGAATAACAAGGAGG - Intronic
941363089 2:164577406-164577428 CTATCACAAGAACAGCAAGGGGG - Intronic
941597999 2:167502662-167502684 CTATTACAAGAACAGCAAGGGGG + Intergenic
942110936 2:172682214-172682236 ATGTCTGAGGAACAACAAGGAGG + Intergenic
942221239 2:173770859-173770881 CTGTGCCAAGAACAGGTAGGTGG + Intergenic
942224547 2:173803884-173803906 CTGTCACCAGAACAGCAAGGGGG - Intergenic
942994372 2:182243466-182243488 ATGTTTGAGGAACAGGAAGGAGG + Intronic
943112711 2:183625397-183625419 CTGTCACAAGAACAGCAAGGGGG - Intergenic
943128609 2:183828053-183828075 CTATCATAAGAACAGCAAGGGGG + Intergenic
943234841 2:185304371-185304393 CTGTCACGAGAACAGCAAGGGGG - Intergenic
943252988 2:185553530-185553552 CCCTGTGCAGAACAGCATGGAGG + Intergenic
943272605 2:185826378-185826400 ATGTTTGAGGAACAGCAAGGAGG - Intronic
944932530 2:204534630-204534652 CTATCACAAGAACAGCAAGGGGG - Intergenic
945074015 2:206019076-206019098 CTGTTCCAAGAACAGAAAGGAGG + Intronic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
945395280 2:209308063-209308085 CTATCATAAGAACAGCAAGGGGG + Intergenic
945426924 2:209717352-209717374 CCGTCTTGAGAACAGCAAGGGGG + Intronic
945530077 2:210942275-210942297 CTATCACAAGAACAGCAAGGGGG + Intergenic
945802126 2:214447310-214447332 CTCTGTGAAGAAGAGCTTGGGGG - Intronic
945828630 2:214756177-214756199 CTATCACAAGAACAGCAAGGAGG - Intronic
945900798 2:215534964-215534986 CTATCACAAGAACAGCAAGGGGG - Intergenic
945964396 2:216170543-216170565 CTGTCACAAGAACAGCAAAGGGG + Intronic
946079156 2:217102126-217102148 CTTTCAGGAGAACAGCAAGGGGG - Intergenic
946364677 2:219241594-219241616 GGGTCTGAAGAACAGCAATGAGG + Intronic
946523946 2:220497540-220497562 TTGCATGAAGAACAGCCAGGAGG + Intergenic
946769632 2:223075521-223075543 TTGTCTTGAGAACAGCAAGGAGG - Intronic
946960453 2:224979563-224979585 GTGTTAGAAGAACAGAAAGGAGG - Intronic
947474284 2:230428785-230428807 CTGTCACAAGAACAGCAAGGGGG + Intronic
948038265 2:234877461-234877483 CTATCACAAGAACAGCAAGGGGG + Intergenic
1168816575 20:741730-741752 CTATCACAAGAACAGCAAGGGGG - Intergenic
1168833024 20:857721-857743 GTGTTTGAGGAACAGCATGGAGG + Intergenic
1168923864 20:1563824-1563846 CTATCACAAGAACAGCAAGGGGG + Exonic
1168954604 20:1826236-1826258 GAATGTGATGAACAGCAAGGCGG - Intergenic
1169193129 20:3670178-3670200 CTGTGGGCAGAGGAGCAAGGTGG - Intronic
1169291287 20:4355285-4355307 CTGTGTCAAGAACAGAAAGCAGG - Intergenic
1169348012 20:4844757-4844779 CTGTCTCAAGAAAAGGAAGGAGG + Intergenic
1169464354 20:5824162-5824184 ATGTGTGAAGACCAGAAAGAAGG - Intronic
1170057825 20:12226448-12226470 CTGTCATGAGAACAGCAAGGAGG - Intergenic
1170134909 20:13062030-13062052 GTGTCTGAGGAAGAGCAAGGAGG - Intronic
1170168201 20:13383069-13383091 CTGCTCAAAGAACAGCAAGGAGG + Intergenic
1170426746 20:16242737-16242759 TTATTTGAAGAACAGCAAAGAGG + Intergenic
1170692748 20:18629900-18629922 CTGTCACGAGAACAGCAAGGGGG + Intronic
1170803881 20:19612958-19612980 CCGTGTGGGAAACAGCAAGGTGG - Intronic
1170941992 20:20855726-20855748 CTATCACAAGAACAGCAAGGGGG + Intergenic
1171002030 20:21424468-21424490 CTATCATAAGAACAGCAAGGGGG + Intergenic
1171220650 20:23393938-23393960 ATGTGTGCGGAACAGCAAGGAGG + Intronic
1171490805 20:25515699-25515721 CTGTCACAAAAACAGCAAGGGGG - Intronic
1171505298 20:25628204-25628226 CTATCTCAAGAACAGCAAGGGGG + Intergenic
1172477635 20:35250815-35250837 CTATCAGCAGAACAGCAAGGGGG + Intronic
1172767762 20:37359773-37359795 CTGTGTGAAGAGCAGACTGGGGG + Intronic
1173080935 20:39866776-39866798 CAGTGTGAGAAACAGCAAGGAGG + Intergenic
1173199218 20:40942266-40942288 CTATCACAAGAACAGCAAGGGGG + Intergenic
1173233502 20:41221842-41221864 ATGTTCAAAGAACAGCAAGGAGG + Intronic
1173560102 20:43998194-43998216 CTGTCACGAGAACAGCAAGGGGG + Intronic
1173887378 20:46472245-46472267 CAGGGTCTAGAACAGCAAGGAGG - Intergenic
1173890995 20:46510228-46510250 CAGTGTGAAGAACAGCCTTGAGG + Intronic
1173922316 20:46755557-46755579 GTGTTTAAGGAACAGCAAGGAGG - Intergenic
1174082810 20:47983064-47983086 CTGGGTGAGGAACAGCAGGGGGG + Intergenic
1174112703 20:48207182-48207204 GTGTTTGAGGAACAGCAATGAGG - Intergenic
1174133147 20:48359918-48359940 CTGGGTGAGGAACAGCAGGGAGG - Intergenic
1174511637 20:51057916-51057938 CTGGTGGAAGAAAAGCAAGGGGG - Intergenic
1174521398 20:51133301-51133323 CTGTGTCAAGAAAAAAAAGGTGG + Intergenic
1174988249 20:55480320-55480342 CTGTCACAAGAACAGCATGGGGG + Intergenic
1175033981 20:55982333-55982355 CTATCTCAAGAACAGCATGGGGG - Intergenic
1175070526 20:56329806-56329828 CTGTGTGAGGAATAACAGGGAGG + Intergenic
1175314583 20:58038565-58038587 GTGTTTGAGGATCAGCAAGGGGG - Intergenic
1175422437 20:58842983-58843005 CTGTTTAAAAAACAGCAAGATGG - Intronic
1175494682 20:59405356-59405378 CTGAGTGCAGAACAGCAGGAAGG + Intergenic
1175932948 20:62501979-62502001 CTGTCTTGAGAACAGCATGGGGG - Intergenic
1175936387 20:62516044-62516066 CTGTGTGGGCACCAGCAAGGTGG - Intergenic
1177199933 21:17942876-17942898 CTATAAGAAGAACAGCAAGAGGG - Intronic
1177312109 21:19411690-19411712 CTATTACAAGAACAGCAAGGGGG - Intergenic
1177407707 21:20691765-20691787 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1177592609 21:23190938-23190960 CTGACACAAGAACAGCAAGGGGG - Intergenic
1177625811 21:23657725-23657747 CTACCAGAAGAACAGCAAGGGGG + Intergenic
1177836161 21:26188499-26188521 GTGTTTGGAGAACAGCGAGGTGG + Intergenic
1177842002 21:26245229-26245251 CTCTCACAAGAACAGCAAGGGGG - Intergenic
1177846965 21:26300783-26300805 CTATCACAAGAACAGCAAGGGGG + Intergenic
1177861098 21:26455155-26455177 CTATTTGAGGAAGAGCAAGGAGG - Intergenic
1177899668 21:26898887-26898909 CTGTCACAAGAACAGCATGGGGG + Intergenic
1177930066 21:27270343-27270365 CTGTCACAAAAACAGCAAGGGGG + Intergenic
1177945838 21:27468753-27468775 CTATGTGAGGAATAGCAAGAAGG + Intergenic
1178180615 21:30157013-30157035 CTGTCACAAGAACAGCATGGAGG + Intergenic
1179043269 21:37823520-37823542 CTATCAGAAGAACAGCATGGGGG - Intronic
1179916512 21:44481422-44481444 CTGTCACAAGAACAGCATGGGGG + Intergenic
1180204929 21:46253863-46253885 CTGTAATGAGAACAGCAAGGGGG - Intronic
1181835059 22:25598666-25598688 CTGTGCGAAAAACAAAAAGGTGG + Intronic
1182247329 22:28969548-28969570 ATGTGGGAGGAACAGCAGGGAGG + Intronic
1182402218 22:30087317-30087339 ATGTGTTGAGAACATCAAGGTGG + Intronic
1183014544 22:34975062-34975084 CTATCACAAGAACAGCAAGGGGG + Intergenic
1183707164 22:39481155-39481177 GCCAGTGAAGAACAGCAAGGCGG - Intronic
1184297500 22:43534189-43534211 CTCTCACAAGAACAGCAAGGGGG - Intronic
1184826704 22:46957506-46957528 CTGTCACAAGAACAGCATGGGGG + Intronic
1185105022 22:48863848-48863870 CAGTGGGAGGAACAGCAGGGAGG - Intergenic
1185315628 22:50178062-50178084 GCGCGTGGAGAACAGCAAGGCGG + Exonic
949847791 3:8389432-8389454 CTATGAGAAGCACATCAAGGGGG - Intergenic
949941358 3:9157317-9157339 CTATCACAAGAACAGCAAGGGGG + Intronic
950351415 3:12357320-12357342 ATGTGGAAGGAACAGCAAGGAGG - Intronic
950457426 3:13101019-13101041 GTGTCTGAAGAGCTGCAAGGGGG + Intergenic
950677753 3:14564904-14564926 CTGTGTTTAGAATAGCAGGGTGG - Intergenic
951471630 3:23062683-23062705 CTGTGCCAAGAACTGCATGGTGG - Intergenic
951729696 3:25796932-25796954 CAGAGTGAAGAACAGCTTGGAGG + Intergenic
951781970 3:26373810-26373832 CTATCACAAGAACAGCAAGGGGG - Intergenic
952697120 3:36279061-36279083 CTGTCAGGAGAACAGCAAGAGGG + Intergenic
952808210 3:37377535-37377557 CACTGTCGAGAACAGCAAGGGGG + Intergenic
953163814 3:40446264-40446286 CATACTGAAGAACAGCAAGGAGG + Intergenic
953349617 3:42205561-42205583 CTGTGTTAAAAAGACCAAGGCGG + Intronic
953393686 3:42549481-42549503 CTGTGTGAGGCACAGGAAGCAGG - Intronic
953549672 3:43891814-43891836 CTGTGTTTGGAACATCAAGGTGG - Intergenic
953625018 3:44563615-44563637 CTATTACAAGAACAGCAAGGGGG + Intronic
953706823 3:45237468-45237490 CTGTCACAAGAAAAGCAAGGGGG - Intergenic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
953854701 3:46492319-46492341 CTGTGAAAGGAAGAGCAAGGAGG + Intergenic
953995269 3:47514409-47514431 TTGTGTGGAGAAAAGCAAAGTGG + Intergenic
954012230 3:47651469-47651491 ATACTTGAAGAACAGCAAGGAGG - Intronic
954288248 3:49634917-49634939 CTATGTGAAGAACAGCCTGCAGG + Intronic
954984554 3:54778207-54778229 CTGTGAGGAGAACAGCAAGGGGG + Intronic
955056681 3:55461379-55461401 CTATCAGAAGAACAGCATGGGGG + Intergenic
955146441 3:56324834-56324856 ATGATGGAAGAACAGCAAGGAGG - Intronic
955217288 3:56994884-56994906 CTGTCACAAGAACAGCAAGGGGG - Intronic
955958971 3:64319537-64319559 ATGCTTGAGGAACAGCAAGGAGG + Intronic
955984017 3:64554674-64554696 GTGTGTGATGAAATGCAAGGAGG - Intronic
956083192 3:65581532-65581554 TTGTATGAATAGCAGCAAGGGGG - Intronic
956347937 3:68300747-68300769 CTATCTCAAGAACAGCATGGAGG - Intronic
956358276 3:68417949-68417971 CTATCATAAGAACAGCAAGGGGG + Intronic
956384379 3:68701368-68701390 CTGTTACTAGAACAGCAAGGGGG - Intergenic
956753391 3:72362858-72362880 CTATCACAAGAACAGCAAGGGGG - Intergenic
956853920 3:73257391-73257413 CTGTTGGAAGAACAGAAAGGAGG - Intergenic
956974192 3:74561259-74561281 CTGGGAGGAGAATAGCAAGGAGG - Intergenic
957212098 3:77272467-77272489 CTATCACAAGAACAGCAAGGGGG + Intronic
957293280 3:78305434-78305456 CTATCACAAGAACAGCAAGGGGG - Intergenic
957437296 3:80194987-80195009 CTGTGAGAAGAAAATCAAGGTGG - Intergenic
957504421 3:81101200-81101222 CTATCACAAGAACAGCAAGGGGG - Intergenic
957746420 3:84348670-84348692 CTGTCACAAGAACAGCAAGGGGG + Intergenic
958506129 3:94979235-94979257 CTATCAAAAGAACAGCAAGGGGG - Intergenic
958543606 3:95511327-95511349 CTATCACAAGAACAGCAAGGGGG - Intergenic
958685295 3:97385879-97385901 CTATCACAAGAACAGCAAGGGGG + Intronic
959508350 3:107179312-107179334 CTGTCACCAGAACAGCAAGGAGG + Intergenic
959689442 3:109182725-109182747 ATGTTTGAAGAGCAGCAAGGGGG - Intergenic
959777647 3:110187947-110187969 CTATCAGAAGAACAGCAAGGGGG + Intergenic
960129735 3:114043255-114043277 GTGTTGGAAAAACAGCAAGGAGG + Intronic
960498812 3:118410124-118410146 CTGTTACAAGAACAGCAAGGGGG - Intergenic
960658625 3:120033702-120033724 CTATCACAAGAACAGCAAGGGGG - Intronic
961659400 3:128460504-128460526 CTGTTTGGAGAACAGCAAGAAGG - Intergenic
961973039 3:130990455-130990477 ATGTGTGAGGAACAACGAGGAGG + Intronic
962253978 3:133857951-133857973 CTGTGTGTGGAAGGGCAAGGAGG - Intronic
962327967 3:134451459-134451481 CTGTAATAAGAACAGCAAGGGGG - Intergenic
962334246 3:134511771-134511793 CTATCACAAGAACAGCAAGGGGG + Intronic
962356715 3:134700331-134700353 CTGTGTGAAGAATAGATTGGAGG - Intronic
963126524 3:141821739-141821761 CTGTCATGAGAACAGCAAGGGGG + Intergenic
963762657 3:149299575-149299597 ATGTTTGAAGAAAAGCAAAGGGG - Intergenic
963982280 3:151552083-151552105 CTATCACAAGAACAGCAAGGGGG - Intergenic
964091242 3:152878784-152878806 CTGTCACAAGAACAGCAAGAGGG - Intergenic
964154263 3:153565177-153565199 CTGTCACAAGAACAGCAAGGGGG - Intergenic
964316031 3:155445116-155445138 CTGTGGGCAGAAGAGAAAGGGGG - Intronic
964433443 3:156628589-156628611 CCCTCTGAAGAACAGCGAGGAGG - Intergenic
964464747 3:156978931-156978953 CTGTTTGAAAATCAGCATGGTGG + Intronic
964821029 3:160769593-160769615 GTGTTTGGAGAACAACAAGGTGG + Intronic
964859896 3:161189967-161189989 CTATGTGAAGAACAGCAAGAAGG + Intronic
964896441 3:161602346-161602368 CTATCACAAGAACAGCAAGGGGG + Intergenic
965065696 3:163845477-163845499 GTGTGTGAGAAAAAGCAAGGTGG - Intergenic
966182397 3:177198457-177198479 ATGTGTGAAGCACAGCAAGGCGG + Intergenic
966217546 3:177519008-177519030 CTATCATAAGAACAGCAAGGGGG + Intergenic
966315484 3:178640437-178640459 CTATCACAAGAACAGCAAGGGGG + Intronic
966749951 3:183312661-183312683 CTGTGTGAAGACCACACAGGTGG - Intronic
966755039 3:183361438-183361460 CTGTCATGAGAACAGCAAGGGGG - Intronic
966904968 3:184515395-184515417 GGGTTTGAAGAACAGCAAGAAGG - Intronic
967207046 3:187133306-187133328 CTGTCACAAGAACAGCACGGGGG - Intronic
967209767 3:187158023-187158045 CTATCTCAAGAACAGCAAGGGGG - Intronic
967549167 3:190769529-190769551 GGGTGTGAAGAATAGCAAGTGGG - Intergenic
967567527 3:190989326-190989348 CTGTCATGAGAACAGCAAGGGGG - Intergenic
967679993 3:192350665-192350687 GTGTTTGAGGAACAGCAAGATGG + Intronic
967686113 3:192418652-192418674 CTGTCACAAGAACAGCAAGAGGG - Intronic
969107840 4:4821245-4821267 TTATGACAAGAACAGCAAGGGGG - Intergenic
969986365 4:11215257-11215279 CTGTCAGTAGAACAGCATGGGGG + Intergenic
970404808 4:15752729-15752751 CTATTTGAGGAACGGCAAGGAGG + Intergenic
970487590 4:16540128-16540150 CTGCCAGGAGAACAGCAAGGGGG + Intronic
970560419 4:17276702-17276724 CTGGCTGAAGGGCAGCAAGGAGG + Intergenic
970609327 4:17710696-17710718 CTGTGTGAAGAACTGAATGAAGG + Intronic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
971224228 4:24736423-24736445 CTATCTCAAGAACAGCAAGAGGG - Intergenic
971255383 4:25009265-25009287 CTGTTTGAAGAACATCCAGGGGG - Intronic
971256576 4:25019632-25019654 CTGTTGGAGGAATAGCAAGGAGG - Intronic
971268826 4:25118258-25118280 GTGTTTGAGGAACAGCAAGATGG + Intergenic
971507882 4:27386286-27386308 ATTTTGGAAGAACAGCAAGGAGG - Intergenic
971698481 4:29936556-29936578 ATGTGTGAAGATCATTAAGGTGG + Intergenic
971725697 4:30308787-30308809 CTATCACAAGAACAGCAAGGGGG + Intergenic
971896557 4:32604702-32604724 CTGTCACAAGAACAGCAAAGGGG + Intergenic
971945538 4:33271455-33271477 CTGTCACAAGAACAGCAAGGGGG + Intergenic
972070526 4:35014206-35014228 CTATCATAAGAACAGCAAGGGGG + Intergenic
972113516 4:35596379-35596401 CTGTCACAAGAACAGCATGGGGG + Intergenic
972124542 4:35746653-35746675 CTATCACAAGAACAGCAAGGGGG + Intergenic
972296921 4:37748014-37748036 CTATCACAAGAACAGCAAGGGGG + Intergenic
972340419 4:38148151-38148173 CTGTGTGAAGAACAGACTGAGGG - Intergenic
972683903 4:41333156-41333178 CTATCACAAGAACAGCAAGGGGG + Intergenic
972688513 4:41373861-41373883 CTATCTCAAGAACAGCAAGGGGG - Intronic
973066618 4:45802775-45802797 CTATCTAAAGAACAGCAAAGGGG + Intergenic
973180115 4:47256749-47256771 CTGTCAGAAGAACAGCAAGAGGG + Intronic
974009088 4:56591158-56591180 CTATCACAAGAACAGCAAGGGGG - Intronic
974311167 4:60211163-60211185 CTGTCACAAGAACAGCAAGGGGG + Intergenic
974554765 4:63431719-63431741 ATGCCTGAAGAACAGCAAAGAGG + Intergenic
974618525 4:64323571-64323593 CTGTGTGAAAAATAGAAAGAAGG + Intronic
974620493 4:64347688-64347710 CTATCATAAGAACAGCAAGGAGG + Intronic
974853870 4:67435896-67435918 CTATCACAAGAACAGCAAGGGGG + Intergenic
975093143 4:70426412-70426434 CTATTATAAGAACAGCAAGGGGG - Intergenic
975142527 4:70933216-70933238 CTGTCACAAGAACAGCAAGCGGG + Intronic
975319856 4:72997604-72997626 ATATTTGAGGAACAGCAAGGAGG - Intergenic
975383763 4:73731563-73731585 GTGTATGAGGAACAGTAAGGAGG - Intergenic
975483255 4:74905463-74905485 CTATCACAAGAACAGCAAGGGGG + Intergenic
975626873 4:76359021-76359043 CTGTCACAAGAACAGCAAGGGGG - Intronic
975654621 4:76629286-76629308 CTGTTTGAAAAAGAGCAAGAAGG + Intronic
976056370 4:81072658-81072680 ATGTTTGAGGAAGAGCAAGGGGG + Intergenic
976096620 4:81515256-81515278 CTATGTGATAAACAGCATGGGGG + Intronic
977076896 4:92464910-92464932 CTGTCACAAGAACACCAAGGGGG - Intronic
977282718 4:95061900-95061922 CTGTCACAAGAACAGCAAGGGGG - Intronic
977415857 4:96732362-96732384 CTATCACAAGAACAGCAAGGGGG - Intergenic
977786597 4:101042312-101042334 GTGTGTGAAAACCAGCAAGCTGG + Intronic
977982157 4:103336910-103336932 GTGTTTGAAGAACAACAAAGGGG + Intergenic
977984082 4:103361144-103361166 CTATGACAAGAACAGCAAGGGGG - Intergenic
978145000 4:105362275-105362297 TTGTTCCAAGAACAGCAAGGAGG - Intergenic
978153827 4:105467361-105467383 ATGTCTGAGAAACAGCAAGGAGG + Intronic
978256096 4:106694329-106694351 CTATCTTAAGAATAGCAAGGAGG - Intergenic
978567084 4:110094601-110094623 ATGTTTGAGGAACAGCAAGGAGG + Intronic
978602522 4:110443651-110443673 CTGTCACAAGAATAGCAAGGGGG - Intronic
978645092 4:110920563-110920585 CTATCACAAGAACAGCAAGGGGG - Intergenic
978784221 4:112591618-112591640 TGGTGTGTAAAACAGCAAGGAGG - Intronic
979095201 4:116539861-116539883 CTATCACAAGAACAGCAAGGGGG - Intergenic
979350442 4:119638131-119638153 CTATCATAAGAACAGCAAGGGGG + Intergenic
979399705 4:120233474-120233496 CTATCAGAAGAAGAGCAAGGGGG + Intergenic
979610085 4:122680794-122680816 CTATCACAAGAACAGCAAGGGGG - Intergenic
979610483 4:122683951-122683973 CTCTCACAAGAACAGCAAGGGGG - Intergenic
979882080 4:125971975-125971997 CTTTCACAAGAACAGCAAGGGGG + Intergenic
980080730 4:128341221-128341243 CTATCACAAGAACAGCAAGGGGG - Intergenic
980430046 4:132683108-132683130 CTGTCACAAGAACAGCATGGGGG + Intergenic
980888888 4:138793152-138793174 CTATGATGAGAACAGCAAGGGGG - Intergenic
981065968 4:140486126-140486148 TCGTGTGAGGAACAGCAAGGAGG - Intronic
981231540 4:142362231-142362253 GTGTGTGAAGAACAGGGAGTAGG + Intronic
981690168 4:147499297-147499319 CTTTGTGAAGCAGAGGAAGGAGG - Intronic
981805145 4:148706824-148706846 CTATCAGGAGAACAGCAAGGGGG - Intergenic
981956249 4:150477690-150477712 CTGTCATGAGAACAGCAAGGGGG - Intronic
982187895 4:152820670-152820692 CTATCGCAAGAACAGCAAGGGGG + Intronic
982278180 4:153658341-153658363 CTGGGGAAAGAGCAGCAAGGTGG - Intergenic
982490238 4:156020892-156020914 CTATCACAAGAACAGCAAGGGGG - Intergenic
982592069 4:157326090-157326112 TTGGTTGAGGAACAGCAAGGAGG - Intronic
982903452 4:161037951-161037973 CTGTCTTGAGAACAGCAAGGGGG + Intergenic
982991415 4:162281037-162281059 CTATGACAAAAACAGCAAGGGGG - Intergenic
983068753 4:163243755-163243777 TTGTGGGAAGGACAGCAAGCAGG + Intergenic
983294598 4:165850213-165850235 CTATCTTGAGAACAGCAAGGGGG + Intergenic
983469186 4:168136098-168136120 CTATCAGAAGACCAGCAAGGGGG + Intronic
983665360 4:170176166-170176188 CTGTCATGAGAACAGCAAGGGGG - Intergenic
984085119 4:175300860-175300882 CTATCTCAAAAACAGCAAGGGGG - Intergenic
984159537 4:176234328-176234350 TTGTGTAAGGAAAAGCAAGGAGG - Intronic
984483271 4:180333430-180333452 CTGTTCAAGGAACAGCAAGGAGG + Intergenic
984504300 4:180597584-180597606 CTGTTTGAAGAAAATCAAGCAGG + Intergenic
984634702 4:182098255-182098277 CAGTATGAAGAACAGGATGGAGG + Intergenic
985028041 4:185758748-185758770 CAGTATGAGGCACAGCAAGGAGG - Intronic
985072042 4:186175910-186175932 ATGTCTGAAGAACAGCAGAGAGG + Intergenic
985183421 4:187290548-187290570 CTGTCATGAGAACAGCAAGGGGG + Intergenic
985191068 4:187373462-187373484 CTATCACAAGAACAGCAAGGGGG + Intergenic
985368731 4:189261940-189261962 CTATAACAAGAACAGCAAGGGGG + Intergenic
985399783 4:189583025-189583047 CTGAGGGAAGACCAGCCAGGAGG + Intergenic
985991081 5:3561866-3561888 CTGTCATGAGAACAGCAAGGGGG - Intergenic
986123431 5:4864361-4864383 CTATCACAAGAACAGCAAGGGGG + Intergenic
986424329 5:7615132-7615154 CTATCACAAGAACAGCAAGGGGG + Intronic
986805909 5:11309007-11309029 CTGTCATGAGAACAGCAAGGGGG + Intronic
986846545 5:11763031-11763053 CTGTCATGAGAACAGCAAGGGGG - Intronic
986881187 5:12173538-12173560 CTGTCATGAGAACAGCAAGGAGG - Intergenic
986914067 5:12594833-12594855 CTATCACAAGAACAGCAAGGGGG + Intergenic
986937477 5:12907413-12907435 CTATCTTAAGAACAGCAAGGAGG + Intergenic
986943004 5:12979545-12979567 CTGTGATGAGAACAGCATGGAGG + Intergenic
986998300 5:13632675-13632697 CTGTGTGAAACAGAGCAAGAGGG - Intergenic
987442222 5:17969642-17969664 CTATGACAAGAACAGCATGGGGG + Intergenic
987494984 5:18631591-18631613 CTATCACAAGAACAGCAAGGGGG + Intergenic
987532483 5:19140616-19140638 CTATCAGGAGAACAGCAAGGGGG + Intergenic
987694025 5:21304893-21304915 CTATCACAAGAACAGCAAGGAGG - Intergenic
987829629 5:23078234-23078256 CTGTGTGATGCACTGTAAGGTGG + Intergenic
987954806 5:24725289-24725311 CAGTGTAAAGAACAGCAGTGGGG + Intergenic
988310192 5:29547748-29547770 CTATCACAAGAACAGCAAGGGGG + Intergenic
988320160 5:29684792-29684814 CTGTCACAAGAACAGCAAGAAGG - Intergenic
988647080 5:33106596-33106618 CTATCACAAGAACAGCAAGGTGG + Intergenic
988691848 5:33580406-33580428 CTGTCACAAGAACAGCACGGGGG + Intronic
988701501 5:33679522-33679544 CTGTCACAAGAACAGCATGGGGG + Intronic
988720309 5:33870740-33870762 CTATCACAAGAACAGCAAGGGGG - Intronic
988729291 5:33954373-33954395 ATCTGTGAAGAACAGCATGTTGG + Exonic
988804325 5:34726459-34726481 CTATCACAAGAACAGCAAGGGGG + Intronic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
988942694 5:36162074-36162096 CTGTGTTTAGAACAGAAAGGTGG - Intronic
988983834 5:36597705-36597727 CTGTGAGGGGACCAGCAAGGGGG - Intergenic
989366203 5:40658641-40658663 CTATCAGGAGAACAGCAAGGGGG - Intergenic
989719804 5:44511748-44511770 CTATCACAAGAACAGCAAGGGGG - Intergenic
990213898 5:53509529-53509551 CTGTCATGAGAACAGCAAGGGGG + Intergenic
990232352 5:53727238-53727260 CTATCACAAGAACAGCAAGGGGG - Intergenic
990494759 5:56336030-56336052 CTATCAGAAGAACAGCAAGAGGG + Intergenic
990592090 5:57276572-57276594 CTGTCACAAGAACAGCACGGGGG + Intergenic
990759439 5:59112219-59112241 GTGCTTGAAGATCAGCAAGGAGG + Intronic
990939746 5:61189432-61189454 CTATCATAAGAACAGCAAGGGGG - Intergenic
991214541 5:64147602-64147624 ATGTTTGAGGAACATCAAGGAGG - Intergenic
991222787 5:64235739-64235761 CTATCATAAGAACAGCAAGGGGG - Intronic
991328639 5:65466295-65466317 GTGTTTGAGGAACAGCATGGAGG - Intronic
991746222 5:69744638-69744660 CTATCACAAGAACAGCAAGGAGG + Intergenic
991751483 5:69810603-69810625 CTATCACAAGAACAGCAAGGAGG - Intergenic
991797824 5:70324591-70324613 CTATCACAAGAACAGCAAGGAGG + Intergenic
991825600 5:70619952-70619974 CTATCACAAGAACAGCAAGGAGG + Intergenic
991830770 5:70685497-70685519 CTATCACAAGAACAGCAAGGAGG - Intergenic
991890167 5:71323910-71323932 CTATCACAAGAACAGCAAGGAGG + Intergenic
992140969 5:73796561-73796583 CTGTGTAGAGCAGAGCAAGGAGG + Intronic
992143841 5:73825385-73825407 CTGAGGCAAAAACAGCAAGGAGG + Intronic
992182367 5:74211251-74211273 GTGTGTGAAGACCAGAAAGTGGG - Intergenic
992409717 5:76493337-76493359 GGGTGAGAGGAACAGCAAGGAGG - Intronic
992580395 5:78169380-78169402 TGTTGTGAAGAACAGAAAGGTGG - Intronic
992648789 5:78836991-78837013 CTATCACAAGAACAGCAAGGGGG + Intronic
992839647 5:80675568-80675590 CTGTCATGAGAACAGCAAGGAGG + Intronic
992843103 5:80715800-80715822 CTATCACAAGAACAGCAAGGGGG + Intronic
992905133 5:81338360-81338382 CTATCACAAGAACAGCAAGGGGG - Intronic
993752738 5:91691253-91691275 CTGTTATGAGAACAGCAAGGAGG + Intergenic
994011677 5:94911441-94911463 CTATCATAAGAACAGCAAGGGGG - Intronic
994081605 5:95713388-95713410 CTGTCACAAGATCAGCAAGGGGG - Intergenic
994246490 5:97484548-97484570 CTATCACAAGAACAGCAAGGGGG + Intergenic
994787371 5:104181606-104181628 CAGTGTGAGGAACAGAAAGTAGG - Intergenic
995354150 5:111218717-111218739 CACTGTGAAGAACAGAATGGAGG - Intergenic
995477715 5:112564401-112564423 CTCTCACAAGAACAGCAAGGGGG - Intergenic
995512630 5:112923633-112923655 TTGTCTGAGGCACAGCAAGGAGG - Intergenic
995821378 5:116237168-116237190 ATGTTTGATGAACAGCAAGCAGG + Intronic
996128216 5:119751082-119751104 GTGTGCGAAGAATAGCAAGGAGG - Intergenic
996224670 5:120977318-120977340 CCCTGTAAAGAAGAGCAAGGAGG + Intergenic
996507491 5:124284737-124284759 TTGTTGGAAGAACAGCAAGTGGG + Intergenic
996616823 5:125452210-125452232 CTGTGTGAAGAAAAGAAATGTGG + Intergenic
996673176 5:126143468-126143490 CTGTCACAAGAACAGCATGGGGG + Intergenic
996911021 5:128656641-128656663 GTATCAGAAGAACAGCAAGGGGG + Intronic
997182443 5:131844138-131844160 CTGTCACAAGAACAGCAAGGGGG + Intronic
997285734 5:132676953-132676975 CTGTCTGAGGAACAGCAAAGTGG + Intronic
997702983 5:135917861-135917883 AGGTTTGAGGAACAGCAAGGAGG + Intergenic
998554215 5:143107218-143107240 CTCTGTGAATAAGAGCATGGTGG + Intronic
998620526 5:143789531-143789553 CTGTTTGAAGCATAGAAAGGAGG - Intergenic
998714938 5:144872397-144872419 GTGTTTTCAGAACAGCAAGGAGG + Intergenic
998774361 5:145582423-145582445 CTATCACAAGAACAGCAAGGGGG + Intronic
998793222 5:145788566-145788588 CTGTGTGCATGACAGCAATGGGG - Intronic
998908189 5:146929178-146929200 CTGTGAAAAGAACAGAAATGTGG - Intronic
998986452 5:147763269-147763291 CCATGTGAAGAACTGAAAGGGGG - Intronic
999065664 5:148683189-148683211 CTATCATAAGAACAGCAAGGAGG + Intergenic
999068533 5:148717377-148717399 CTATCACAAGAACAGCAAGGGGG - Intergenic
999448073 5:151657289-151657311 CTGTTTCAGGAACAGAAAGGAGG + Intergenic
999501018 5:152146800-152146822 CTGTCTCAAGAACAGCATGAGGG - Intergenic
999681297 5:154062804-154062826 GTGTTAGAGGAACAGCAAGGAGG - Intronic
999808746 5:155108319-155108341 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1000287358 5:159838168-159838190 GTGTTTGAAGGACAGCAAGAAGG - Intergenic
1000752718 5:165116763-165116785 CTATGTCAAGAACAGTATGGGGG - Intergenic
1000755006 5:165147423-165147445 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1000901830 5:166920853-166920875 GTGTCTTAAGAACAGCAAGAAGG - Intergenic
1001275078 5:170344915-170344937 CTGTGTGACGAGCAACAAGAAGG + Intergenic
1001373755 5:171234268-171234290 TTGTCTGAAGGGCAGCAAGGAGG + Intronic
1001610930 5:173001407-173001429 CTGTGTGATGGACAGCAACGGGG - Intronic
1001845812 5:174920110-174920132 CTGCTTAAAGACCAGCAAGGAGG + Intergenic
1001884021 5:175272076-175272098 ATGTGTGAGGAAGAGCCAGGAGG - Intergenic
1001907880 5:175488040-175488062 CTGTGTGGAGAACAGACAGTGGG - Intronic
1001973043 5:175972125-175972147 CTGTAACGAGAACAGCAAGGGGG + Intronic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002244392 5:177871657-177871679 CTGTAACGAGAACAGCAAGGGGG - Intergenic
1002588082 5:180265429-180265451 CTGTCACAAGAACAGCACGGGGG - Intronic
1003000080 6:2324039-2324061 CTATCACAAGAACAGCAAGGGGG - Intergenic
1003598447 6:7495953-7495975 TGGTTTAAAGAACAGCAAGGAGG - Intergenic
1003800813 6:9664895-9664917 CTGTTACAAGAACAGCATGGGGG - Intronic
1003820837 6:9895340-9895362 CTGTCACAAGAACAGCATGGGGG + Intronic
1004062253 6:12208997-12209019 ACGTGTGCAGAACAGCGAGGAGG - Intergenic
1004473672 6:15951338-15951360 CTGTCAGGAGAACAGAAAGGGGG - Intergenic
1004555719 6:16695615-16695637 CAGTGTTAACCACAGCAAGGAGG - Intronic
1004613433 6:17267637-17267659 CTACGACAAGAACAGCAAGGGGG + Intergenic
1004739750 6:18447320-18447342 CTGTTTGAGAAACAGCAAGGAGG + Intronic
1004846338 6:19647342-19647364 CTATCTTGAGAACAGCAAGGAGG + Intergenic
1004951920 6:20682572-20682594 CTATCAGGAGAACAGCAAGGGGG + Intronic
1005003016 6:21261681-21261703 CTATCACAAGAACAGCAAGGGGG - Intergenic
1005286735 6:24335822-24335844 CTATGAGTAGAACAGCATGGGGG + Intronic
1005385752 6:25282431-25282453 CTGTTCAAGGAACAGCAAGGAGG - Intronic
1005492740 6:26361687-26361709 TTGTGTGAAGAAAAGCAATGAGG + Intergenic
1005496904 6:26395808-26395830 TTGTGTGAAGAACAGCAATGAGG + Intergenic
1005556883 6:26995027-26995049 CTATCACAAGAACAGCAAGGAGG + Intergenic
1005594597 6:27367691-27367713 CTATCAAAAGAACAGCAAGGTGG + Intergenic
1005808490 6:29497395-29497417 CTGTCATGAGAACAGCAAGGAGG - Intergenic
1006333068 6:33405901-33405923 CTGGTTGAGGAACAGCCAGGAGG - Intronic
1006427790 6:33976930-33976952 CTGCTTGAAGAGCAGCAAAGAGG - Intergenic
1006753320 6:36393317-36393339 GTGTTTGAAGAATGGCAAGGAGG - Intronic
1006914513 6:37585687-37585709 TTGTGTGCAGAGCAGCAGGGAGG - Intergenic
1008486252 6:52039354-52039376 CTATCACAAGAACAGCAAGGGGG - Intronic
1008578781 6:52886345-52886367 CTGTCAGGAGAACAGCATGGGGG - Intronic
1008716408 6:54295174-54295196 CTCTGTGAATACCAGCATGGAGG - Intergenic
1008802648 6:55388901-55388923 CTGGGGGAAGAACAGGAAGAGGG - Intronic
1008830981 6:55761536-55761558 CTGTGAGTGAAACAGCAAGGAGG - Intronic
1008848329 6:55994841-55994863 CTATCACAAGAACAGCAAGGGGG + Intergenic
1009449484 6:63784656-63784678 CTATCACAAGAACAGCAAGGGGG + Intronic
1009637693 6:66286226-66286248 CTGTAACAAGAACAGCATGGAGG - Intergenic
1009667816 6:66705882-66705904 CTATCATAAGAACAGCAAGGAGG + Intergenic
1009968615 6:70603751-70603773 CTATCACAAGAACAGCAAGGGGG - Intergenic
1010268395 6:73892600-73892622 CTATTTTGAGAACAGCAAGGGGG - Intergenic
1010473012 6:76252065-76252087 GTGTTCGAGGAACAGCAAGGAGG + Intergenic
1010550564 6:77217328-77217350 ATGTATGATGAATAGCAAGGTGG + Intergenic
1011294537 6:85811632-85811654 CTATCAGAAGAACAGCATGGAGG + Intergenic
1011344060 6:86349561-86349583 CTGTGTGGATAACTGGAAGGAGG - Intergenic
1011463473 6:87630832-87630854 ATATTTGAAGAAGAGCAAGGAGG + Intronic
1011805635 6:91069979-91070001 TTGTCAGAAGAACAGCAAGAGGG + Intergenic
1011879134 6:92001585-92001607 CTATCACAAGAACAGCAAGGGGG - Intergenic
1011898570 6:92262869-92262891 CTATTTGAGGAATAGCAAGGAGG + Intergenic
1011902381 6:92314855-92314877 CTGTCACAAGAACAGCATGGGGG - Intergenic
1011977813 6:93327817-93327839 CTGTGTTAAGAATAGCTAAGAGG - Intronic
1012029329 6:94037874-94037896 CTGCCACAAGAACAGCAAGGGGG - Intergenic
1012306407 6:97663465-97663487 CTGTGTGAAGCACAGCTGGCTGG - Intergenic
1012937172 6:105380292-105380314 AGGTGTGAAGAAGAGTAAGGAGG + Intronic
1013084905 6:106848104-106848126 CTATCAGAAGAACAGCATGGGGG - Intergenic
1013396037 6:109740996-109741018 CTGTCACAAAAACAGCAAGGGGG + Intronic
1014147163 6:118011453-118011475 CTATCACAAGAACAGCAAGGGGG + Intronic
1014152681 6:118076587-118076609 CTATCACAAGAACAGCAAGGGGG + Intronic
1014853111 6:126365521-126365543 CTGTTATGAGAACAGCAAGGGGG + Intergenic
1014930183 6:127326197-127326219 CTATCACAAGAACAGCAAGGGGG - Intronic
1014983822 6:127978333-127978355 CTATCTGGAGAACAGCATGGGGG - Intronic
1015093755 6:129389800-129389822 CTATCACAAGAACAGCAAGGGGG + Intronic
1015128127 6:129777208-129777230 CTATCACAAGAACAGCAAGGGGG + Intergenic
1016157251 6:140825971-140825993 CTGTCTTGAGAACAGCCAGGGGG + Intergenic
1016222272 6:141689399-141689421 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1016264435 6:142214485-142214507 CTGTCACAAGAACAGCAAGGGGG + Intronic
1016452021 6:144193164-144193186 GTGTCACAAGAACAGCAAGGGGG + Intergenic
1016589363 6:145727943-145727965 CTTTCACAAGAACAGCAAGGAGG - Intronic
1016646818 6:146419785-146419807 CTATCACAAGAACAGCAAGGGGG + Intronic
1016653823 6:146494823-146494845 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1016751411 6:147634387-147634409 CTGTCACAAGAATAGCAAGGGGG + Intronic
1016860984 6:148718624-148718646 CTATCTCAAGCACAGCAAGGGGG + Intergenic
1017321689 6:153101713-153101735 CTATCACAAGAACAGCAAGGAGG - Intronic
1017379343 6:153810384-153810406 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1017448161 6:154528406-154528428 CTATCAGAAGAACAGCAATGAGG + Intergenic
1018027885 6:159819828-159819850 TTGTGAGCAAAACAGCAAGGAGG + Intronic
1018178484 6:161199662-161199684 CTGTCACGAGAACAGCAAGGGGG - Intronic
1018229379 6:161661285-161661307 GAGTGTGGAGAAGAGCAAGGTGG - Intronic
1018418191 6:163619789-163619811 CTATCACAAGAACAGCAAGGGGG + Intergenic
1018507328 6:164485364-164485386 CTATCACAAGAACAGCAAGGGGG + Intergenic
1018534544 6:164806590-164806612 CTGTCATAAGAACAGCATGGGGG + Intergenic
1018796564 6:167190057-167190079 GTGTCTGAGGAAGAGCAAGGAGG + Intronic
1018819755 6:167365060-167365082 GTGTCTGAGGAAGAGCAAGGAGG - Intronic
1019788546 7:2995324-2995346 CTGTCAGGAGAACAGCATGGTGG - Intronic
1019789639 7:3002732-3002754 CTGTCAGGAAAACAGCAAGGGGG + Intronic
1020042677 7:5016026-5016048 CTGTCACGAGAACAGCAAGGGGG - Intronic
1020372263 7:7444930-7444952 CTATTATAAGAACAGCAAGGGGG - Intronic
1020799619 7:12717857-12717879 CTGTTTGTAAAACAGGAAGGGGG + Intergenic
1021121450 7:16800382-16800404 CTGTGGGAGGAACAGCACGAAGG + Intronic
1021126048 7:16852068-16852090 CTATCTGGAGAACAGCATGGGGG + Intergenic
1021246663 7:18271519-18271541 CTGGATCAAGAAAAGCAAGGGGG - Intronic
1021574519 7:22095083-22095105 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1021702374 7:23332053-23332075 CTATCACAAGAACAGCAAGGGGG + Intronic
1021973263 7:25985352-25985374 CTGTGCAAAGAACAGAAAGAAGG - Intergenic
1022127816 7:27375185-27375207 CTATCAGAAGAACAGCAAGGGGG + Intergenic
1022161299 7:27713792-27713814 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1022569404 7:31436870-31436892 CTATCACAAGAACAGCAAGGGGG - Intergenic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1022800678 7:33774454-33774476 CTGTGACAAGAACAGCATGGAGG - Intergenic
1022806587 7:33828744-33828766 CTATCACAAGAACAGCAAGGGGG - Intergenic
1022858265 7:34338743-34338765 CTGTCATGAGAACAGCAAGGCGG + Intergenic
1022979182 7:35588095-35588117 CTATCGGGAGAACAGCAAGGGGG - Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023584689 7:41716842-41716864 CTGTTGGAAGGATAGCAAGGGGG - Intergenic
1023706912 7:42950584-42950606 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1024729038 7:52234366-52234388 CTATCAGTAGAACAGCAAGGGGG - Intergenic
1024766247 7:52664391-52664413 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1024841587 7:53593290-53593312 CTATCACAAGAACAGCAAGGGGG - Intergenic
1024895888 7:54261478-54261500 CTATCACAAGAACAGCAAGGGGG + Intergenic
1025849719 7:65236097-65236119 CTATCACAAGAACAGCAAGGGGG - Intergenic
1026121108 7:67538545-67538567 CTATCACAAGAACAGCAAGGGGG - Intergenic
1026125839 7:67578814-67578836 CTATCACAAGAACAGCAAGGGGG - Intergenic
1026253967 7:68694770-68694792 CTGTGTGGAGAATAGCCTGGGGG - Intergenic
1026261530 7:68759707-68759729 CTGTGTGATGCAGAGCAAGAAGG - Intergenic
1026444453 7:70471897-70471919 GTGTGTGAGGAATAGCAAGCAGG + Intronic
1026655549 7:72253616-72253638 CTGTCATAAGAACAGCACGGGGG + Intronic
1026683753 7:72490627-72490649 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1027600765 7:80237827-80237849 CTATCAGGAGAACAGCAAGGGGG + Intergenic
1027654163 7:80908327-80908349 CTGTGTGAAGTACACCAAGCTGG - Intronic
1027775412 7:82458674-82458696 CTGTCTCAAGAACAGCAAGGGGG + Intergenic
1027865195 7:83637564-83637586 CTGTCAGAAGAAGAGCATGGGGG - Intronic
1027879789 7:83820097-83820119 CTATCACAAGAACAGCAAGGGGG - Intergenic
1027959151 7:84921032-84921054 CTATCACAAGAACAGCAAGGGGG + Intergenic
1028083974 7:86614369-86614391 CTGTCACAAGAACAGCATGGGGG - Intergenic
1028110080 7:86929801-86929823 CTATCACAAGAACAGCAAGGGGG - Intronic
1028141145 7:87275710-87275732 CTATCACAAGAACAGCAAGGGGG + Intergenic
1028480724 7:91301674-91301696 ATGTTTGAGGAACAACAAGGAGG - Intergenic
1028600775 7:92598122-92598144 ATGTCCAAAGAACAGCAAGGGGG - Intergenic
1028622823 7:92843684-92843706 CTGTCACAAGAACAGCATGGGGG - Intergenic
1028741691 7:94282591-94282613 CTGTGTAAAGCAGAGTAAGGGGG - Intergenic
1028916440 7:96264289-96264311 ATGTGTGAGGAACAGCATGATGG - Intronic
1029018349 7:97338116-97338138 GTGTCTGAAGAACAACAAAGAGG - Intergenic
1029060912 7:97797189-97797211 CTATCACAAGAACAGCAAGGAGG + Intergenic
1029136760 7:98378430-98378452 CTGTTTGGAGAACAGCCCGGAGG - Intronic
1029241423 7:99165944-99165966 CTATGACAAGAACAGCAAGGGGG - Intergenic
1029867331 7:103648217-103648239 CTATCACAAGAACAGCAAGGGGG - Intronic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030914480 7:115295658-115295680 CTATCAGAATAACAGCAAGGAGG - Intergenic
1030993074 7:116324877-116324899 CTATTACAAGAACAGCAAGGGGG + Intronic
1031026608 7:116686269-116686291 GTGTCTGAAGCACAGCAAGGGGG - Intronic
1031106800 7:117553944-117553966 TGGTTTGAAGAACAGTAAGGAGG + Intronic
1031124928 7:117762874-117762896 GTGTCTGAGGAACTGCAAGGAGG - Intronic
1031210269 7:118815819-118815841 CTATCAGAAGAACAGCAAGGGGG - Intergenic
1031258612 7:119488498-119488520 CTATCACAAGAACAGCAAGGGGG + Intergenic
1031265708 7:119577499-119577521 CTATCTCAAGAACAGCAAGGGGG + Intergenic
1031581960 7:123487056-123487078 CTGTCTTGAGAATAGCAAGGGGG - Intronic
1031990426 7:128194570-128194592 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1032103651 7:129005533-129005555 CTATCACAAGAACAGCAAGGGGG - Intronic
1032146684 7:129389138-129389160 CTGTGTTAAGAACATCAAACAGG + Exonic
1032149653 7:129417263-129417285 CTGTTTGAGGAACAACAAGGAGG + Intronic
1032248267 7:130231480-130231502 CTGTCATGAGAACAGCAAGGAGG + Intergenic
1032372257 7:131368618-131368640 CTTTGACAAGAACAGCATGGGGG + Intronic
1032380517 7:131475012-131475034 CTATCACAAGAACAGCAAGGGGG + Intronic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1032423454 7:131801620-131801642 CTGTCACAAGAACAGCAAAGGGG - Intergenic
1033048214 7:137981243-137981265 CTGGGTGGAGAATAGGAAGGTGG + Intronic
1033489645 7:141829671-141829693 CTATCACAAGAACAGCAAGGAGG - Intergenic
1033533188 7:142286907-142286929 CTATCACAAGAACAGCAAGGGGG + Intergenic
1033632082 7:143168735-143168757 CTATCAGGAGAACAGCAAGGGGG + Intergenic
1033764430 7:144472880-144472902 CTATGTGGAGAACACTAAGGGGG + Intronic
1033789654 7:144776060-144776082 ATGTTTTAAGAGCAGCAAGGAGG - Intronic
1033820198 7:145125856-145125878 CTGTCATGAGAACAGCAAGGAGG + Intergenic
1034016270 7:147590377-147590399 CTGTCACAAGAACAGCATGGGGG - Intronic
1034137482 7:148784246-148784268 CTGTTTGAAAAACAGCCAGTGGG - Intronic
1034476533 7:151287599-151287621 CTGTTAGAGGAACAGCAATGTGG + Intergenic
1034744764 7:153513994-153514016 CAGTGTGGAGAAGAGGAAGGAGG + Intergenic
1035050698 7:155997645-155997667 GTGTGTGGAGGACAGCATGGAGG - Intergenic
1035548052 8:498814-498836 CTATCACAAGAACAGCAAGGGGG - Intronic
1035582195 8:747441-747463 CTGGCTGATGAAAAGCAAGGCGG + Intergenic
1035951547 8:4027442-4027464 CTGTCACAAGAACAGCATGGAGG - Intronic
1036024695 8:4892358-4892380 TGGTGTGAACAAGAGCAAGGGGG + Intronic
1036120033 8:6006286-6006308 CTCTCAGGAGAACAGCAAGGTGG + Intergenic
1036729071 8:11245861-11245883 CTATGGTGAGAACAGCAAGGGGG - Intergenic
1036967747 8:13319494-13319516 CTATCAGGAGAACAGCAAGGGGG - Intronic
1037007019 8:13794706-13794728 CTGTCAGGAGAACAGCATGGGGG - Intergenic
1037274747 8:17165938-17165960 ATGTGTGAGGAAGAGCAAGGAGG + Intronic
1037331243 8:17745925-17745947 CTGTCATAAGAACAGCAAGGGGG - Intronic
1038260410 8:25988174-25988196 CTGTGTGAAGAGCCCCAGGGTGG - Intronic
1038646818 8:29368994-29369016 CTGTCTGAACAACAGCAAGGAGG + Intergenic
1038677203 8:29634075-29634097 CTATCAGGAGAACAGCAAGGGGG + Intergenic
1038928553 8:32167865-32167887 CTGTTTCAAAAAGAGCAAGGTGG - Intronic
1039078647 8:33714902-33714924 CTATTATAAGAACAGCAAGGGGG + Intergenic
1039148288 8:34474742-34474764 CTGTGTGAGGAACAGCAAGGAGG + Intergenic
1039178165 8:34832981-34833003 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1039496971 8:37987647-37987669 CTGTGACAAGAACAGCAAGGGGG + Intergenic
1040486078 8:47873110-47873132 CAGTATGGAGAACAGCATGGAGG + Intronic
1040575943 8:48651649-48651671 CATTGTGAACAACAGAAAGGTGG - Intergenic
1040798028 8:51308437-51308459 CTGTCACAAGAATAGCAAGGGGG - Intergenic
1041066856 8:54090829-54090851 CTGTCATAAGAACAGCATGGGGG - Intronic
1041312023 8:56526700-56526722 CTGTCACAAGAACAGCATGGGGG + Intergenic
1041826425 8:62100434-62100456 TTGTGTGGAGAACAGCAACTAGG + Intergenic
1041827588 8:62114077-62114099 CTATCACAAGAACAGCAAGGGGG - Intergenic
1042102435 8:65287949-65287971 CTATCAGGAGAACAGCAAGGGGG - Intergenic
1042104174 8:65307164-65307186 CTGTGATGAGAACAGCAAGGGGG + Intergenic
1042324018 8:67509096-67509118 CTATCACAAGAACAGCAAGGGGG + Intronic
1042840121 8:73115233-73115255 CTATGTGAAGAACTGAAATGCGG + Intronic
1042887213 8:73565229-73565251 CTATCAGGAGAACAGCAAGGGGG - Intronic
1043196902 8:77306502-77306524 ATGTTTGAAGAATAGCAAGGGGG + Intergenic
1043211190 8:77520868-77520890 CAGTCAGGAGAACAGCAAGGGGG + Intergenic
1043217975 8:77620381-77620403 CTATCACAAGAACAGCAAGGGGG + Intergenic
1043992917 8:86778155-86778177 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1044066363 8:87704372-87704394 CTTTGTCAAGACCATCAAGGTGG + Intergenic
1044843822 8:96360875-96360897 AGGTATGAAGACCAGCAAGGAGG + Intergenic
1044923509 8:97189466-97189488 CTATGAGGAGAACAGCATGGGGG + Intergenic
1045643619 8:104279337-104279359 CTATCACAAGAACAGCAAGGGGG + Intergenic
1045685395 8:104706188-104706210 ATGTTTGAAGAATAGCAAGGAGG - Intronic
1046724374 8:117658463-117658485 CTATCAGCAGAACAGCAAGGGGG + Intergenic
1046735013 8:117767636-117767658 CTATCACAAGAACAGCAAGGGGG - Intergenic
1046839322 8:118839942-118839964 CTGTCACAAGAACAGCATGGGGG - Intergenic
1047309510 8:123679971-123679993 CTGTGACGAGAACAGCATGGGGG - Intergenic
1048023237 8:130559985-130560007 CTATCACAAGAACAGCAAGGGGG - Intergenic
1048052356 8:130829981-130830003 TTGTGTGAAGAACAGCAGCTAGG - Intronic
1048148025 8:131864587-131864609 CTATGATGAGAACAGCAAGGGGG + Intergenic
1048302552 8:133262164-133262186 TTGTCTGAAGAACAGCAGTGAGG + Exonic
1048325260 8:133434255-133434277 CTGCCTGAAGACCAGCAAGAGGG + Intergenic
1048375853 8:133821929-133821951 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1048739609 8:137539978-137540000 CTATCTCGAGAACAGCAAGGAGG - Intergenic
1049115034 8:140678776-140678798 ATGTGTGAGGAACAGCAAGGTGG + Intronic
1049757627 8:144317808-144317830 CTGGGTGAAGAACAGCTGGGGGG + Exonic
1050174624 9:2856895-2856917 TTGTTTGAAGAACAGCAAGAAGG + Intergenic
1050760604 9:9065421-9065443 ATGTGTGAGGAACACCAAGGAGG + Intronic
1051048386 9:12902132-12902154 CTGTTATAAGAACAGCATGGGGG - Intergenic
1051988336 9:23118995-23119017 CTATCACAAGAACAGCAAGGGGG + Intergenic
1052347200 9:27421703-27421725 ATGTGTGAGGACTAGCAAGGAGG - Intronic
1052686694 9:31765559-31765581 CTATCACAAGAACAGCAAGGGGG + Intergenic
1052724155 9:32209279-32209301 CTGTCATGAGAACAGCAAGGGGG - Intergenic
1053010857 9:34632319-34632341 GTGTTGGAAGAAAAGCAAGGAGG + Intergenic
1053083538 9:35197686-35197708 CTGTCACAAGAACAGCAAGGGGG - Intronic
1053519588 9:38764275-38764297 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1053619472 9:39800908-39800930 CTATCACAAGAACAGCAAGGGGG - Intergenic
1053877641 9:42560236-42560258 CTATCACAAGAACAGCAAGGGGG - Intergenic
1053895020 9:42734130-42734152 CTATCACAAGAACAGCAAGGGGG + Intergenic
1054234053 9:62541458-62541480 CTATCACAAGAACAGCAAGGGGG + Intergenic
1054264685 9:62906535-62906557 CTATCACAAGAACAGCAAGGGGG + Intergenic
1054759701 9:68993274-68993296 CTGTGAGAGGAACACCAAGGAGG - Intronic
1054797305 9:69314352-69314374 CTATCACAAGAACAGCAAGGAGG + Intergenic
1054999536 9:71433303-71433325 CTGTCACAAGAACAGCACGGGGG - Intronic
1055023495 9:71694750-71694772 CTGTGTTAAGAATATCAAGATGG - Intronic
1055421023 9:76142468-76142490 CTGTTCAAAGAAAAGCAAGGAGG + Intronic
1055544583 9:77356160-77356182 GTATATGAAGAAGAGCAAGGAGG - Intronic
1055555647 9:77470908-77470930 CTTTCACAAGAACAGCAAGGGGG + Intronic
1055768217 9:79688081-79688103 AAATGTGAAGACCAGCAAGGTGG - Intronic
1055811185 9:80149701-80149723 CTATCACAAGAACAGCAAGGGGG - Intergenic
1056019048 9:82422685-82422707 CTGTCACAAGAACAGCATGGGGG - Intergenic
1056104914 9:83337447-83337469 GTGTGTGAACCACAGCATGGAGG + Intronic
1056275623 9:84991772-84991794 GTGTGAGAGGAACTGCAAGGGGG - Intronic
1056878489 9:90363555-90363577 CTATCATAAGAACAGCAAGGGGG - Intergenic
1058397704 9:104574058-104574080 CTATCACAAGAACAGCAAGGGGG - Intergenic
1058493085 9:105523325-105523347 GTGTCTGAAGAACAGCGTGGTGG - Intronic
1058555189 9:106159396-106159418 ATGTTTGAAGAATAGCAAGAAGG + Intergenic
1058565823 9:106284028-106284050 CTTCTTGAAGAACAGCAAGCTGG + Intergenic
1058575300 9:106394716-106394738 AAGTTTGAACAACAGCAAGGAGG + Intergenic
1059474664 9:114535498-114535520 CTGTCAGGAGAACAGCATGGGGG + Intergenic
1059786649 9:117593531-117593553 CTATTACAAGAACAGCAAGGGGG - Intergenic
1059788973 9:117618970-117618992 ATGTTTAAAGAACAGCAAGTAGG + Intergenic
1059826776 9:118038817-118038839 CTGTCATAAGAACAGCATGGGGG - Intergenic
1059974112 9:119697676-119697698 CTGTCAGGAGAACAGCATGGGGG + Intergenic
1060227674 9:121804527-121804549 CAGTATGGAGAACAGTAAGGAGG - Intergenic
1060385820 9:123227370-123227392 CTGTTTGAAGAAGAGCAAGGAGG + Intronic
1060612851 9:124984199-124984221 ATGTTTCAGGAACAGCAAGGGGG + Intronic
1060672705 9:125484096-125484118 CTGAGTTAAGAACAGGCAGGTGG + Intronic
1060726644 9:126010561-126010583 CTATCACAAGAACAGCAAGGGGG - Intergenic
1060813502 9:126623148-126623170 CTGGGTGAGGAACAGAAGGGTGG - Intronic
1061200240 9:129133827-129133849 CTGTTTGAGGAACACTAAGGAGG - Intronic
1061447238 9:130646996-130647018 CTATGATGAGAACAGCAAGGGGG + Intergenic
1061779720 9:132988450-132988472 CTGTGTGAAGTGCAACAAGGTGG + Exonic
1185752013 X:2619133-2619155 CTGTATGAAGAAGAGCAACATGG - Intergenic
1185820121 X:3194828-3194850 CTATCTCAAGAACAGCATGGGGG - Intergenic
1185939523 X:4300016-4300038 CTATCACAAGAACAGCAAGGGGG - Intergenic
1186075120 X:5870189-5870211 CTGTCAGGAGAGCAGCAAGGGGG + Intronic
1186567132 X:10675489-10675511 CTGTGTGAAGAAGAGAGAAGTGG - Intronic
1186601144 X:11038770-11038792 CTGTCATAAGAATAGCAAGGGGG + Intergenic
1186656207 X:11614512-11614534 CTGTCATGAGAACAGCAAGGGGG + Intronic
1186892376 X:13971737-13971759 CTATAGGAAGGACAGCAAGGAGG - Intergenic
1186977570 X:14924565-14924587 CTATCACAAGAACAGCAAGGGGG + Intergenic
1187038454 X:15567064-15567086 CTGTTAAAGGAACAGCAAGGAGG - Intronic
1187274666 X:17806911-17806933 CTATCGTAAGAACAGCAAGGGGG + Intronic
1187544523 X:20234815-20234837 CTGTGAAAAGCACAGCAAGCAGG + Intronic
1187650123 X:21392557-21392579 CTATCACAAGAACAGCAAGGGGG + Intronic
1187654408 X:21453905-21453927 CTATCACAAGAACAGCAAGGGGG + Intronic
1188148121 X:26639167-26639189 CTGTTTGAGGAATAGCAAGAAGG - Intergenic
1188221366 X:27545590-27545612 CTATGATGAGAACAGCAAGGGGG - Intergenic
1188392995 X:29644337-29644359 GTGTGTGAGGAAGAGCATGGTGG + Intronic
1188412066 X:29885100-29885122 ATGTCAGAAGAACAGCAAGAAGG - Intronic
1188875596 X:35426516-35426538 CTATGACGAGAACAGCAAGGGGG - Intergenic
1188926831 X:36054103-36054125 TTCTGTGAAGAACAGCAACCAGG - Intronic
1189067354 X:37824602-37824624 ATGTGTGAGGGGCAGCAAGGTGG - Intronic
1189136581 X:38556875-38556897 TTGTTTGAAGAACAGAAAGAAGG + Intronic
1189509872 X:41652167-41652189 CAGTCTGAAGAACAGCAAGGAGG + Intronic
1189518050 X:41735681-41735703 CTGCTCGAGGAACAGCAAGGAGG - Intronic
1189560968 X:42191232-42191254 ATGTTTGAAGAATAGCAAGGAGG + Intergenic
1189605376 X:42672195-42672217 TTGCTTGAAGAAAAGCAAGGAGG + Intergenic
1189644339 X:43110390-43110412 CTGCCTGAGGAACAGAAAGGGGG + Intergenic
1189670540 X:43403951-43403973 CTGTTCGAGGAATAGCAAGGAGG + Intergenic
1189711525 X:43817698-43817720 GTGTCTAAAGAACAGCAGGGAGG - Intronic
1189739923 X:44107023-44107045 CTATGACAAGAACAGCAAGGGGG - Intergenic
1189994615 X:46626688-46626710 CTATCACAAGAACAGCAAGGGGG - Intronic
1190153719 X:47969841-47969863 CTATCACAAGAACAGCAAGGGGG + Intronic
1190221484 X:48515068-48515090 GTGTGTGGGGAACAGCAAGAAGG + Intronic
1190310014 X:49110571-49110593 ATGTGTGAGGAACAGCCGGGAGG - Intergenic
1190366649 X:49700939-49700961 CTGTTACAGGAACAGCAAGGGGG - Intergenic
1190397417 X:49999013-49999035 CTGGGTGAAAAAAAGCAAGGGGG - Intronic
1190411817 X:50144158-50144180 CTATCACAAGAACAGCAAGGAGG + Intergenic
1190507005 X:51136276-51136298 CTATCACAAGAACAGCAAGGGGG + Intergenic
1190632949 X:52406193-52406215 CTGTCAGGAGAACAACAAGGAGG + Intergenic
1190640758 X:52481543-52481565 CTGTGGGAAGCACATTAAGGTGG - Intergenic
1190646914 X:52531322-52531344 CTGTGGGAAGCACATTAAGGTGG + Intergenic
1190797836 X:53760651-53760673 CTCTGTGATGAACATGAAGGTGG - Intergenic
1190917325 X:54820559-54820581 CTCTGTGATGAACATGAAGGTGG + Intergenic
1191674620 X:63781857-63781879 TTGTTTAAAGAACAGCAAGGAGG - Intronic
1191734866 X:64377906-64377928 CTGTCATGAGAACAGCAAGGGGG - Intronic
1191833098 X:65436201-65436223 CTGTCACAAGAACAGCAAGGGGG + Intronic
1191927181 X:66326221-66326243 CTGTGTGAAGGCTACCAAGGAGG - Intergenic
1192066488 X:67890586-67890608 CTATCACAAGAACAGCAAGGAGG - Intergenic
1193333099 X:80257015-80257037 CTCTCACAAGAACAGCAAGGGGG - Intergenic
1193439707 X:81524530-81524552 CTGTCACTAGAACAGCAAGGGGG + Intergenic
1193779980 X:85689335-85689357 CTATCACAAGAACAGCAAGGGGG - Intergenic
1193801337 X:85940197-85940219 CTATCACAAGAACAGCAAGGGGG + Intronic
1193978666 X:88155148-88155170 TTGTTTGAGGAACAGCAAGAAGG + Intergenic
1194302839 X:92209003-92209025 CTATCATAAGAACAGCAAGGGGG + Intronic
1194409717 X:93543125-93543147 CTATCTTGAGAACAGCAAGGGGG + Intergenic
1194450582 X:94040617-94040639 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1194819125 X:98484446-98484468 CTATCTTGAGAACAGCAAGGGGG - Intergenic
1194910220 X:99632095-99632117 CTGTCATAAGAACAGCAAGGGGG + Intergenic
1195178178 X:102331094-102331116 CTATCACAAGAACAGCAAGGGGG - Intergenic
1195180686 X:102355999-102356021 CTATCACAAGAACAGCAAGGGGG + Intergenic
1195345715 X:103949130-103949152 CTGTTTGTAGAATAGCAAGAAGG + Intronic
1195345833 X:103950323-103950345 TTGTTTGAGGAACAGCAGGGAGG + Intronic
1195361765 X:104089114-104089136 TTGTTTGAGGAACAGCAGGGAGG - Intergenic
1195361883 X:104090308-104090330 CTGTTTGAAGGATAGCAAGAAGG - Intergenic
1195565304 X:106333166-106333188 CTATCAGAAGAACAGCATGGGGG - Intergenic
1195945444 X:110205619-110205641 CTGTTTGAAGTACAGCCAGGTGG + Intronic
1195989905 X:110672137-110672159 CTATCACAAGAACAGCAAGGAGG + Intergenic
1196021635 X:110997109-110997131 ATGTTTGAAGAACAGCAAGGGGG + Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1196148344 X:112344556-112344578 CTGTCATGAGAACAGCAAGGGGG + Intergenic
1196196908 X:112846362-112846384 ATGTGTGGAAAACAGCAATGTGG + Intergenic
1196376447 X:115038393-115038415 GTGTGTAAAAAACAGGAAGGTGG + Intergenic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1196706558 X:118722322-118722344 TTGTGTGAAGAACAGCCAGGTGG + Intergenic
1197649740 X:129051774-129051796 CTGTCACAAGAACAGCATGGGGG + Intergenic
1197902370 X:131388157-131388179 CTATCACAAGAACAGCAAGGAGG - Intronic
1197957864 X:131972273-131972295 GTGTTTGAGGTACAGCAAGGTGG + Intergenic
1198031790 X:132760346-132760368 CTGTCACAAGAACAGCATGGGGG - Intronic
1198081272 X:133242095-133242117 CTATCACAAGAACAGCAAGGGGG + Intergenic
1198506748 X:137308802-137308824 CTATCACAAGAACAGCAAGGGGG - Intergenic
1198534290 X:137571893-137571915 CTGCATGAATAACAGAAAGGTGG + Intronic
1198887128 X:141351880-141351902 CTGTCACAAGAACAGCATGGAGG + Intergenic
1199059334 X:143335686-143335708 ATGTTTGAGGAACAGCAAGGAGG - Intergenic
1199273947 X:145920898-145920920 CTATCACAAGAACAGCAAGGAGG - Intergenic
1199370353 X:147041291-147041313 CTGTCATAAGAACAGCACGGGGG - Intergenic
1199929636 X:152505677-152505699 CTGTCACAAGAACAGCATGGAGG + Intergenic
1200210554 X:154345052-154345074 CCGCGGGAAGAACAGCGAGGAGG + Intergenic
1200220298 X:154387040-154387062 CCGCGGGAAGAACAGCGAGGAGG - Intergenic
1200291760 X:154882088-154882110 CTATCAGAAGAATAGCAAGGGGG - Intronic
1200338598 X:155377825-155377847 CTATCAGAAGAATAGCAAGGGGG - Intergenic
1200347871 X:155462867-155462889 CTATCAGAAGAATAGCAAGGGGG + Intergenic
1200467402 Y:3536315-3536337 GTGTGTGCAGTACAGCAATGGGG - Intergenic
1201982309 Y:19921108-19921130 CTATCACAAGAACAGCAAGGGGG - Intergenic