ID: 905959954

View in Genome Browser
Species Human (GRCh38)
Location 1:42035527-42035549
Sequence AACCTCCGGTCCTGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905959954_905959969 1 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959969 1:42035551-42035573 TGTAATCGGCCCGGGAAGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 67
905959954_905959964 -7 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959964 1:42035543-42035565 GGAGGTTGTGTAATCGGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 82
905959954_905959966 -2 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959966 1:42035548-42035570 TTGTGTAATCGGCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
905959954_905959971 7 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959971 1:42035557-42035579 CGGCCCGGGAAGGGGGGCTCGGG 0: 1
1: 0
2: 4
3: 30
4: 383
905959954_905959968 0 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959968 1:42035550-42035572 GTGTAATCGGCCCGGGAAGGGGG 0: 1
1: 0
2: 4
3: 10
4: 96
905959954_905959963 -8 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959963 1:42035542-42035564 CGGAGGTTGTGTAATCGGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 21
905959954_905959965 -3 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959965 1:42035547-42035569 GTTGTGTAATCGGCCCGGGAAGG 0: 1
1: 0
2: 0
3: 1
4: 31
905959954_905959974 24 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959974 1:42035574-42035596 CTCGGGACAGCTCCCTGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 125
905959954_905959967 -1 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959967 1:42035549-42035571 TGTGTAATCGGCCCGGGAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 32
905959954_905959970 6 Left 905959954 1:42035527-42035549 CCCCCGCCCCAGGACCGGAGGTT 0: 1
1: 0
2: 1
3: 7
4: 159
Right 905959970 1:42035556-42035578 TCGGCCCGGGAAGGGGGGCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905959954 Original CRISPR AACCTCCGGTCCTGGGGCGG GGG (reversed) Intronic