ID: 905960699

View in Genome Browser
Species Human (GRCh38)
Location 1:42040258-42040280
Sequence GCTGCTGGAGTGCCAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905960692_905960699 20 Left 905960692 1:42040215-42040237 CCATTTTTCATAGATAAAAGTAA No data
Right 905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG No data
905960691_905960699 23 Left 905960691 1:42040212-42040234 CCTCCATTTTTCATAGATAAAAG No data
Right 905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905960699 Original CRISPR GCTGCTGGAGTGCCAGGAGG AGG Intergenic
No off target data available for this crispr