ID: 905961711

View in Genome Browser
Species Human (GRCh38)
Location 1:42048410-42048432
Sequence TCAGCTTTTCCCTGATTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905961706_905961711 27 Left 905961706 1:42048360-42048382 CCTATCAACAGAAAGTCCTGACC No data
Right 905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG No data
905961709_905961711 -1 Left 905961709 1:42048388-42048410 CCTCATTCACAAATGAATGCATT No data
Right 905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG No data
905961707_905961711 11 Left 905961707 1:42048376-42048398 CCTGACCTATGTCCTCATTCACA No data
Right 905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG No data
905961708_905961711 6 Left 905961708 1:42048381-42048403 CCTATGTCCTCATTCACAAATGA No data
Right 905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905961711 Original CRISPR TCAGCTTTTCCCTGATTTTA GGG Intergenic
No off target data available for this crispr