ID: 905967869

View in Genome Browser
Species Human (GRCh38)
Location 1:42114429-42114451
Sequence CACCCACCCTGCTCCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905967869_905967873 -7 Left 905967869 1:42114429-42114451 CCCACCCTGGAGCAGGGTGGGTG No data
Right 905967873 1:42114445-42114467 GTGGGTGCTTAACACAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905967869 Original CRISPR CACCCACCCTGCTCCAGGGT GGG (reversed) Intergenic
No off target data available for this crispr