ID: 905971289

View in Genome Browser
Species Human (GRCh38)
Location 1:42144461-42144483
Sequence CATCAATCCCATGAATGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905971285_905971289 21 Left 905971285 1:42144417-42144439 CCTAACTGCAAATTTGAAAACAC No data
Right 905971289 1:42144461-42144483 CATCAATCCCATGAATGCGGTGG No data
905971284_905971289 22 Left 905971284 1:42144416-42144438 CCCTAACTGCAAATTTGAAAACA No data
Right 905971289 1:42144461-42144483 CATCAATCCCATGAATGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905971289 Original CRISPR CATCAATCCCATGAATGCGG TGG Intergenic
No off target data available for this crispr