ID: 905971393

View in Genome Browser
Species Human (GRCh38)
Location 1:42144990-42145012
Sequence CTGGATTCCCACCACCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905971386_905971393 7 Left 905971386 1:42144960-42144982 CCCACTTCCTGGCTGGAGATGGT No data
Right 905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG No data
905971387_905971393 6 Left 905971387 1:42144961-42144983 CCACTTCCTGGCTGGAGATGGTG No data
Right 905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG No data
905971388_905971393 0 Left 905971388 1:42144967-42144989 CCTGGCTGGAGATGGTGCCCCTT No data
Right 905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG No data
905971384_905971393 8 Left 905971384 1:42144959-42144981 CCCCACTTCCTGGCTGGAGATGG No data
Right 905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG No data
905971383_905971393 9 Left 905971383 1:42144958-42144980 CCCCCACTTCCTGGCTGGAGATG No data
Right 905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905971393 Original CRISPR CTGGATTCCCACCACCTCCT CGG Intergenic
No off target data available for this crispr