ID: 905974779

View in Genome Browser
Species Human (GRCh38)
Location 1:42166206-42166228
Sequence TTGGCTACACACACCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974779_905974783 8 Left 905974779 1:42166206-42166228 CCCTGATGGGTGTGTGTAGCCAA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 905974783 1:42166237-42166259 TGTATGTGTGCTTGTGCTGAAGG 0: 1
1: 0
2: 4
3: 57
4: 610
905974779_905974784 24 Left 905974779 1:42166206-42166228 CCCTGATGGGTGTGTGTAGCCAA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 905974784 1:42166253-42166275 CTGAAGGTGTGTGTGTGCTGAGG 0: 1
1: 4
2: 17
3: 89
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974779 Original CRISPR TTGGCTACACACACCCATCA GGG (reversed) Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909357212 1:74723596-74723618 TTGGCTACTCATAACCATGAGGG - Intronic
910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG + Intergenic
918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG + Intronic
920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG + Intergenic
922383066 1:225052895-225052917 TTGGCTTCACGAAGCCATCAGGG + Intronic
1069705476 10:70456671-70456693 TTGGCTGCACTTTCCCATCAAGG - Intergenic
1071832978 10:89390669-89390691 TGGGCTAAACAAACCCATGAGGG - Intronic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1076022756 10:127087801-127087823 TTGGCTACAAATACACATCTTGG + Intronic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1082855150 11:57799336-57799358 CTGGCCACCCACACCCATCTGGG - Intronic
1093116438 12:15217486-15217508 TTGTCTACCAACACCCATCATGG - Exonic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1094775765 12:33725503-33725525 TTGGCTAGATTCACCCATCCTGG - Intergenic
1097971733 12:65640148-65640170 TTGGCTTTAAACACCCATAAGGG - Intergenic
1098030272 12:66246520-66246542 TTGGCTCCACACAACTCTCACGG - Intronic
1098073534 12:66701141-66701163 TTTTCTACACACATCCATTATGG + Intronic
1098312095 12:69158631-69158653 TTGGATAGACACACCTTTCAAGG - Intergenic
1099948951 12:89278564-89278586 TTGGCTACAGACAATCATCTGGG - Intergenic
1103223381 12:119265770-119265792 TTGGGTACACACAGACATAAAGG + Intergenic
1105407742 13:20145751-20145773 TTGCCTACACAGTCCCCTCAGGG + Intronic
1116672001 14:47854685-47854707 TTGGCTGCATTCACCAATCAAGG - Intergenic
1119870961 14:78016690-78016712 TTGGCTAAACTCACACATCAGGG - Intergenic
1120453062 14:84695621-84695643 TCTGCTGCACATACCCATCAGGG - Intergenic
1120595527 14:86430568-86430590 TTGGAAACACATACCCAGCAGGG - Intergenic
1121709763 14:96028900-96028922 TTGTCCATGCACACCCATCAGGG - Intergenic
1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG + Intergenic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1128412110 15:67410126-67410148 CTGGCTTAAAACACCCATCATGG + Intronic
1129723512 15:77890349-77890371 TGGGCTACCCAGGCCCATCAGGG - Intergenic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1133301975 16:4787982-4788004 CTGGCTGCAAACACCCATCCTGG - Intronic
1133402105 16:5495822-5495844 TTGGCTAAAGAAACCCATTAAGG + Intergenic
1134029788 16:10982599-10982621 TTGGCTTCACCCAGCCATGAGGG + Intronic
1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG + Intronic
1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG + Intronic
1137411720 16:48234125-48234147 TGGTGTAAACACACCCATCATGG + Intronic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1150951919 17:69812570-69812592 TTGGTTAAACAAACCCATAAAGG + Intergenic
1159609121 18:70507142-70507164 TTGGCTACCTACAGCCACCATGG - Intergenic
1159969322 18:74629779-74629801 TTGGCTGAACATTCCCATCATGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163287602 19:16358174-16358196 TTGGAAACACAGACCCGTCAAGG - Intronic
1165369669 19:35396899-35396921 TTGGCTAAACGCAGGCATCAGGG - Intergenic
1166227546 19:41406025-41406047 TTGGCCACCCACTCCCATTATGG + Intronic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
925333185 2:3074553-3074575 TTGGTAACACACACCCATGTGGG - Intergenic
926228603 2:10986046-10986068 CTGGCTCCCCTCACCCATCATGG - Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933638648 2:84735092-84735114 TTGGGTACACACAGACATAAAGG - Intronic
934716293 2:96546597-96546619 TAGGCTACTCACAGCCATCCTGG - Intronic
935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG + Exonic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
939224986 2:139353697-139353719 TAGGCTGCACACACACAGCACGG - Intergenic
939583043 2:143973854-143973876 TTGGCTACAGCCACATATCAAGG + Intronic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
943537903 2:189175465-189175487 TTGGCTCCACAAAGTCATCAGGG - Intronic
947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG + Intergenic
947577126 2:231284696-231284718 TTGGTTACACAGACCCACCCTGG + Intronic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1170094432 20:12630237-12630259 TTGTTTACACAGACTCATCACGG - Intergenic
1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG + Intergenic
1174127349 20:48316679-48316701 TTGGCAAGACAAACCCTTCAAGG + Intergenic
1175663287 20:60836210-60836232 TTAGCTACACAGACTCCTCAGGG + Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG + Intronic
949264823 3:2144498-2144520 TTGGCTGGACACACAGATCAAGG + Intronic
951260136 3:20497432-20497454 TTGGGTACACACAAACATGAAGG - Intergenic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
953847967 3:46443876-46443898 TCTGCTGCACACAGCCATCACGG - Intronic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG + Intergenic
965470559 3:169085153-169085175 TTTGCCAAACACACCCATGAAGG - Intronic
966749503 3:183308687-183308709 TTGGAGACACACACCCCTAAAGG - Intronic
967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG + Intergenic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG + Intronic
980163978 4:129201916-129201938 TTGCCTACACAATCCTATCAAGG + Intergenic
984308457 4:178025247-178025269 TTGGATACTCACATCCATAAAGG + Intergenic
989118224 5:37977490-37977512 CTGGCTGCACACACACATCCTGG - Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
992167950 5:74073527-74073549 TTGGCTACACCCACCCAGAGTGG + Intergenic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
998575610 5:143312258-143312280 TTGGCCACACAGACCAATCTTGG - Intronic
999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG + Intergenic
1005567585 6:27112442-27112464 TAGGCTACCCAAACCCATAATGG - Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1006172934 6:32105662-32105684 TTGGTTAGACACAGCCACCAGGG + Intronic
1007723263 6:43898742-43898764 TTGACTCTACATACCCATCACGG + Intergenic
1010016100 6:71106214-71106236 CTGGCTTCACACACCTCTCATGG - Intergenic
1012278379 6:97300204-97300226 TTGGCTTCCCACACACAACATGG - Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014147271 6:118012501-118012523 TTGGGTCCACACACCAAGCATGG - Intronic
1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG + Intronic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1026352121 7:69526501-69526523 TTGGCTGCACCCACCCAGGATGG + Intergenic
1033911786 7:146272703-146272725 TTGTCCACACACACACATGAGGG - Intronic
1033999513 7:147394649-147394671 TTGGATAGAAACACCCATTATGG - Intronic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1047965145 8:130041031-130041053 TTGGCTATAGGCACCCAGCAAGG + Intergenic
1052120006 9:24702880-24702902 TTGGCTGCACCCACCCAGGATGG - Intergenic
1055181573 9:73394035-73394057 TTGGCTAAAGAAACCCATAAAGG + Intergenic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1062153209 9:135032091-135032113 TTGGATACAAACACCCTTTAAGG - Intergenic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1198431004 X:136566022-136566044 TTGGCTACACACAGACACAAAGG - Intergenic