ID: 905974783

View in Genome Browser
Species Human (GRCh38)
Location 1:42166237-42166259
Sequence TGTATGTGTGCTTGTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 610}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974779_905974783 8 Left 905974779 1:42166206-42166228 CCCTGATGGGTGTGTGTAGCCAA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 905974783 1:42166237-42166259 TGTATGTGTGCTTGTGCTGAAGG 0: 1
1: 0
2: 4
3: 57
4: 610
905974776_905974783 26 Left 905974776 1:42166188-42166210 CCAAGGTGTCTGTATATACCCTG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 905974783 1:42166237-42166259 TGTATGTGTGCTTGTGCTGAAGG 0: 1
1: 0
2: 4
3: 57
4: 610
905974780_905974783 7 Left 905974780 1:42166207-42166229 CCTGATGGGTGTGTGTAGCCAAG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 905974783 1:42166237-42166259 TGTATGTGTGCTTGTGCTGAAGG 0: 1
1: 0
2: 4
3: 57
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974783 Original CRISPR TGTATGTGTGCTTGTGCTGA AGG Intergenic
900187864 1:1340861-1340883 TGCATGTGTGCCTGTGCGCAGGG - Intronic
900575655 1:3381134-3381156 TGTATGTGTGCTTGTCCTGGGGG - Intronic
900896811 1:5488405-5488427 TGTATGTATGCATGTGTGGATGG - Intergenic
900924651 1:5696854-5696876 AGTATGTGCCCTTGAGCTGATGG + Intergenic
900942724 1:5811416-5811438 GGTAGGCGTGCTGGTGCTGATGG - Intergenic
902320618 1:15662129-15662151 TGACTGTGTGTCTGTGCTGATGG + Exonic
902709949 1:18231946-18231968 TGTGTGTGTGTGTGTGGTGAGGG + Intronic
903325150 1:22564956-22564978 TGTGTGTGTGCTTGTGTGTAGGG - Intronic
903631554 1:24777081-24777103 TGTGTGTGTGCATGTGTGGATGG + Intronic
904012938 1:27400188-27400210 TGTATATGTGGCTGTGCTAATGG - Intergenic
904199920 1:28812797-28812819 TGTATGTGTGTGTGTGGTGCGGG + Intronic
905303104 1:36999005-36999027 TGTATGTGTGTGTGTGTTGGGGG + Intronic
905410638 1:37765664-37765686 TGTGTGTGTGTGTGTGATGAGGG - Intergenic
905466926 1:38161943-38161965 GGTATGTGTGGTTGTGTTGGAGG + Intergenic
905974783 1:42166237-42166259 TGTATGTGTGCTTGTGCTGAAGG + Intergenic
905974788 1:42166318-42166340 TGTATGTGTGTGTATGCTGAGGG + Intergenic
906062393 1:42957706-42957728 TGTAAGTGGGCTTGTCCTGCAGG - Intronic
906271377 1:44481778-44481800 TGCATGTGTGTGTGTGCTGGTGG + Intronic
907355731 1:53872015-53872037 TGTGTGTGTGTGTGTGCTTAAGG + Intronic
907952289 1:59195426-59195448 TGTATGTGTGCTTATGCACTTGG - Intergenic
908381133 1:63597785-63597807 TGAATGTGTGCATGTTTTGAAGG + Intronic
908512547 1:64860965-64860987 TGTATGTGTGTGTGTGTTGGGGG + Intronic
908805727 1:67929638-67929660 TGTGTGTGTGTGTGTGGTGATGG - Intergenic
908835957 1:68230598-68230620 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
909309471 1:74128725-74128747 TGTATGTGTGCTTCTTGGGAAGG + Intronic
909418595 1:75435847-75435869 TGTGTGTGTGGTGGTGGTGATGG - Intronic
909521430 1:76573100-76573122 TTTATTTGTATTTGTGCTGAAGG + Intronic
909895120 1:81059031-81059053 TGTGTGTGTGTTTGTGTTTAGGG - Intergenic
910154206 1:84194755-84194777 TGTATGTGTGTGTGTGTGGAGGG - Intronic
910395769 1:86792385-86792407 TGTGTGTGTGCTGGTGGTGTGGG - Intergenic
911209972 1:95128750-95128772 TGTATGTGTGTGTGTGGTGGGGG + Intronic
911628284 1:100152409-100152431 TGTATGTGTGCATAAACTGAAGG + Exonic
912013177 1:104997399-104997421 TATATGTGTGCTTGTTTTTATGG + Intergenic
913248593 1:116892342-116892364 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
913450554 1:118989824-118989846 TGGAAGTGTTCTGGTGCTGAAGG + Intergenic
913656179 1:120962355-120962377 TGTGTGTGTGTTTGTGTAGATGG - Intergenic
913982798 1:143538004-143538026 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
914446672 1:147756691-147756713 TGTGTGTGTGTGGGTGCTGATGG - Exonic
914520737 1:148413585-148413607 TGTGTGTGTGTTTGTGTAGATGG - Intergenic
915866268 1:159502777-159502799 TGGATCTCTGCATGTGCTGAAGG + Intergenic
916128114 1:161589226-161589248 TGTCTGTGTGTCTGTGCTGGTGG + Intronic
916138031 1:161671056-161671078 TGTCTGTGTGTCTGTGCTGGTGG + Intronic
916274520 1:162979130-162979152 TGTGTGTGTGTGTGTGATGAGGG - Intergenic
916592659 1:166207333-166207355 TATATATGTGCTTGTCATGAGGG + Intergenic
917442525 1:175079969-175079991 TGTGTGTGTGTGTGTGGTGAGGG + Intronic
917479014 1:175394572-175394594 TGGAAGTGTGCTTGTCCTAATGG + Intronic
918109304 1:181441766-181441788 TGTAAGTGTGTTTGGGCTGGAGG + Intronic
919014059 1:192006320-192006342 TGTAAGTGAGCTTATACTGAAGG - Intergenic
919222613 1:194649517-194649539 TGTGTGTGTGCACGTGCTCATGG + Intergenic
919403337 1:197146886-197146908 TATATTTTTGGTTGTGCTGAAGG + Intergenic
919976033 1:202613414-202613436 TGCATGTGTGTGTGTGCTGGTGG + Intronic
921076151 1:211701616-211701638 AGTACATGTGCTTGTGCTCAGGG - Intergenic
922258524 1:223914839-223914861 TGTGTGTGTGCATGTGGTGGTGG + Intergenic
922456237 1:225775851-225775873 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
922961143 1:229646571-229646593 TGTATGTGTGTGTGTGTTTAAGG + Intronic
923301934 1:232649393-232649415 TGTGTGTGTGTGTGTGCTGGGGG - Intergenic
923540288 1:234883932-234883954 TGTATGTGTGTGTGTGTTGGGGG - Intergenic
924300307 1:242631460-242631482 TGTAGGTGTCCTTGTCCTCATGG + Intergenic
1063205682 10:3828567-3828589 TGTGTGTGTGCATGGGGTGAGGG + Intergenic
1064172954 10:13050224-13050246 TGTGTGTGTGTCTGTGCTGATGG + Intronic
1064720345 10:18222507-18222529 TGTTTGTTTGCTTGTGATAATGG + Intronic
1064979429 10:21151436-21151458 TGTGTGTGCGCTTGTGCTAAAGG - Intronic
1066245344 10:33577981-33578003 TGTGTGTGTGTGTGTGTTGATGG + Intergenic
1066254150 10:33662439-33662461 TGTGTGTGTGTGTGTGTTGAAGG + Intergenic
1066482918 10:35814457-35814479 TGTGTGTGTGTGTGTGCTGTTGG + Intergenic
1066949921 10:42107115-42107137 TGTGTGTGTGTGTGTGCAGATGG + Intergenic
1067241427 10:44497963-44497985 TGTGTGTGTGGTAGTGCTGGGGG + Intergenic
1067284240 10:44895829-44895851 TCTTTGTGTGCTTCTGCTGCTGG + Intergenic
1068010800 10:51448057-51448079 TGTATGTGTGTGTGTGGAGATGG - Intronic
1068788260 10:61001083-61001105 TGTGTGTGTGTGTGTGCTGGGGG + Intronic
1068866007 10:61896675-61896697 TGTATTTGTGATTGGGGTGAGGG + Intergenic
1069201459 10:65622495-65622517 TGTGTGTGTGCGTGTGTGGAAGG - Intergenic
1070389609 10:75957996-75958018 TGTTTATGGGCTTGTGCAGAGGG + Intronic
1070637203 10:78139254-78139276 TGTGTGTGTGCGTGTGCAGGCGG + Intergenic
1071275607 10:84051737-84051759 TGCATGTGTGTGTGTGTTGAGGG - Intergenic
1071856836 10:89634440-89634462 TGTACATGTGCTGGTGCTGAAGG + Intronic
1071928879 10:90442633-90442655 TGTTTGTGTGTTTGTGCTACTGG - Intergenic
1071929207 10:90447207-90447229 TGTATGTTTCCTTTTGGTGAGGG - Intergenic
1071946644 10:90653342-90653364 TGTGTGTGTGTGTGTGTTGATGG - Intergenic
1073094357 10:100970539-100970561 TGTGTGTGTGTGTGTGGTGATGG - Intronic
1073207605 10:101776848-101776870 TGTGTGTGTGTGTGTGGTGAGGG - Intronic
1073337140 10:102718286-102718308 TGTGTGTATGTGTGTGCTGAGGG + Intronic
1073403786 10:103278897-103278919 TGTGTGTGTGTGTGTGCTGGTGG - Intronic
1073560674 10:104493918-104493940 TATATACTTGCTTGTGCTGATGG + Intergenic
1073660283 10:105468245-105468267 TGTGTGTGTGGTTTTGTTGATGG + Intergenic
1073843978 10:107531211-107531233 TGCATGTGTGCTTGTGCATGTGG - Intergenic
1074052242 10:109890468-109890490 TGTTTGTGTGCTTCTGTTAATGG - Intronic
1074465581 10:113679044-113679066 TGTGTGTGTGCGTATGCTGTGGG + Intergenic
1074509088 10:114096901-114096923 TGTGTGTGTGCATGTGTTGGGGG + Intergenic
1075619038 10:123912281-123912303 TGTGTGTGTGAGTGTGCAGATGG + Intronic
1076184902 10:128438614-128438636 TGTGTGTGTGCATGTGGTGTAGG + Intergenic
1078204263 11:9214456-9214478 TGTATGTGTGCCTGTATTTAAGG - Intronic
1078250978 11:9616200-9616222 TGTATGTGTGGTAGTGGTGGTGG + Intergenic
1078391182 11:10936901-10936923 TGTGTGTGTGCTTGTGCATAGGG + Intergenic
1078791409 11:14546322-14546344 TGTATGGGTGCTGGTGTTGTTGG - Intronic
1079282756 11:19102613-19102635 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1079449032 11:20583353-20583375 TATATGTGTGCTTGTAGGGAAGG + Intergenic
1079732682 11:23955141-23955163 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1080185977 11:29487037-29487059 TGTGTGTGTGCCTGTGCACACGG - Intergenic
1080318540 11:30978774-30978796 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1080491865 11:32773608-32773630 TGTGTGTGTGTTTGTGAAGATGG - Intronic
1080885133 11:36360786-36360808 TGTATGTGTGTTTGAGCTGCTGG - Intronic
1081310851 11:41570055-41570077 TGTGTGTGTGCGTGTGCTGGTGG + Intergenic
1082219075 11:49610791-49610813 TGTATGTGTGCATATGATAATGG + Intergenic
1083094079 11:60232279-60232301 TGTGTGTGTGTGTGTGTTGATGG - Intronic
1083835824 11:65266642-65266664 TTTATGTGTGCTGGTGCAGAAGG - Exonic
1084303939 11:68269592-68269614 GGCATGTGTGCATGTGCAGATGG - Intronic
1084725348 11:70938228-70938250 TGTATGTGTGGGTGTGGTGGAGG + Intronic
1085385196 11:76153560-76153582 TGTTTGTTTGCTTGTTTTGATGG + Intergenic
1085922273 11:80971603-80971625 TGTGTGTGTGTTTGTGTGGAGGG - Intergenic
1086403854 11:86483508-86483530 TGTGTGTGTGATTATGGTGAGGG + Intronic
1086407323 11:86509392-86509414 TGTGTGTGTGTGTGTGATGATGG - Intronic
1086630577 11:89014082-89014104 TGTATGTGTGCATATGATAATGG - Intronic
1087343913 11:96944847-96944869 TGTGTGTGTGTGTGTGCTTAAGG - Intergenic
1087876067 11:103359472-103359494 TGTATGTGTGCTGGCAGTGAGGG - Intronic
1089155497 11:116398948-116398970 GGAAGGTGTGGTTGTGCTGAAGG - Intergenic
1089624389 11:119742022-119742044 TATATGTGTGCTTGTGCTTCTGG - Intergenic
1090249666 11:125242475-125242497 TGTGTGTCTGCATGTGCTGGGGG + Intronic
1090344606 11:126059523-126059545 TGTATGTGTGTGTGTGCAGAGGG - Intronic
1090484225 11:127098127-127098149 TGTGTGTGTGTGTGTGCTTAAGG + Intergenic
1090521742 11:127487033-127487055 TGTGTGTGTGTGTGTGCTGGTGG - Intergenic
1091061756 11:132469956-132469978 TGTATGTGTGTTTGTGGTGGGGG + Intronic
1091072314 11:132579402-132579424 TGTGTGTGTGTGTGTGATGAGGG + Intronic
1091616884 12:2056222-2056244 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
1091888712 12:4035451-4035473 TGTAGGTATGCTTGCCCTGAAGG - Intergenic
1092303075 12:7271077-7271099 TGTATGTGTGTTTGGGGTGGGGG - Intergenic
1092632566 12:10398350-10398372 TGTGTGTGTGTGTGTGGTGAAGG - Intronic
1093702322 12:22235886-22235908 TGTGTGTGTGTGTGTGGTGAAGG - Intronic
1096198600 12:49665039-49665061 CGTATGTGTGCTTATGCAAAAGG - Intronic
1096516022 12:52155731-52155753 TATGTGTGTGCCTGTGCTGGGGG + Intergenic
1096804652 12:54133205-54133227 TGCATGTGTGAGTGAGCTGAAGG + Intergenic
1096867594 12:54574242-54574264 TGTGTGTGTGTGTGTCCTGAAGG + Intronic
1097235307 12:57535455-57535477 TGTGTGTGTGTGTGTGTTGATGG - Intronic
1097392908 12:59037647-59037669 TGTTTGGGTGCTTGTGGTGGTGG - Intergenic
1098035150 12:66294164-66294186 TGTGTGTGTGTGTGTGGTGATGG + Intergenic
1098359153 12:69638349-69638371 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1099348610 12:81535623-81535645 TGTATGTGTGTGTTTGCTGTGGG - Intronic
1100921043 12:99487085-99487107 TGGAACTGTGCTTCTGCTGAAGG + Intronic
1101240705 12:102836001-102836023 TGTATGTGTGTGTGTGTTGAGGG + Intergenic
1101451102 12:104780049-104780071 TGTGTGTGTGTTTGTGTTTAGGG - Intergenic
1102212066 12:111134639-111134661 TGTGTGTGTGTTTCTGCTGCTGG + Intronic
1102310283 12:111839327-111839349 TGTATGTGTGTGTGTTATGAGGG + Intergenic
1103150002 12:118629228-118629250 TGTGGGTGTGGGTGTGCTGAAGG + Intergenic
1103364498 12:120371302-120371324 GGTTTGTGTGCTGGTGCTGCTGG + Intergenic
1103470466 12:121176223-121176245 TGTGTGTGTGTGTGTGTTGAAGG - Intronic
1103649990 12:122424397-122424419 TGTATATTTGCTTGTTCTCATGG + Intergenic
1104151313 12:126086408-126086430 TCTCTGTGTGCATGTGCTTATGG + Intergenic
1104169369 12:126265256-126265278 TGGCTGTTTTCTTGTGCTGAAGG + Intergenic
1104222944 12:126803451-126803473 TGGCTGTTTCCTTGTGCTGAAGG + Intergenic
1104980530 12:132571410-132571432 GGTGTGTGTGCTGGTGCTGATGG - Exonic
1106086534 13:26547388-26547410 TGTGTGTGTGTGTGTGTTGATGG - Intergenic
1106140015 13:27004259-27004281 TGTGTGTGTGCATGTGTTGCAGG - Intergenic
1106754855 13:32812290-32812312 TGTATGTGTGTGTTTGCTGAAGG + Intergenic
1107470738 13:40688881-40688903 TGTATCTCTACCTGTGCTGAGGG + Intergenic
1108091097 13:46850696-46850718 TTTATCTGTGCTTGTGTTGCAGG + Intronic
1108433904 13:50382778-50382800 TGTGTGTGTGTTTGTGTTGTTGG + Intronic
1108614545 13:52118813-52118835 TGTTTGTGTGTGTGTGCTGGGGG - Intronic
1108685134 13:52812996-52813018 TGTGTGTGTGCGTGTACTGAGGG - Intergenic
1108809618 13:54205467-54205489 TGTGTGTGTGCCTGTGCAAATGG + Intergenic
1109061574 13:57628858-57628880 TGTATGTGTGCTTGTGTATGTGG + Intergenic
1109539340 13:63752271-63752293 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1109544504 13:63827563-63827585 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1109577604 13:64282540-64282562 TGTGTGTGTGTGTGTGGTGATGG - Intergenic
1109583209 13:64367394-64367416 TGGATGTGGGCTTATGCTCATGG + Intergenic
1109989016 13:70029126-70029148 TGTATGTGTGTTTGTGGTTGGGG + Intronic
1110087354 13:71397836-71397858 TGTGTGTGTGGTAGTGGTGAGGG - Intergenic
1110441217 13:75527995-75528017 TGTGTGTGTGTGTGTGCTGAGGG - Intronic
1110897149 13:80768458-80768480 TGTATGTGTGGTTGTGGTAATGG + Intergenic
1111116991 13:83792426-83792448 TGTATATGAGCTTGTCCTGGAGG + Intergenic
1111971787 13:94924297-94924319 TGTATGTGTGGCAGGGCTGAGGG + Intergenic
1112450717 13:99506751-99506773 TGTCTGTGTGTTTGTGTTGGGGG - Intronic
1113161757 13:107389674-107389696 TGTATGTGTGTTTGTGTGGGTGG - Intronic
1113824157 13:113237395-113237417 AGCATGTGTTCTAGTGCTGACGG + Intronic
1113881650 13:113630149-113630171 TGTGTGTGTGTGTGTGCTGCTGG - Intronic
1114734893 14:25034127-25034149 TGTATGTTTGCTTTTGATAAAGG + Intronic
1115274246 14:31589662-31589684 TGTGTGTGTGCTTGTGGAGGAGG - Intronic
1115952089 14:38732801-38732823 TGTTTGTGTGGTTGAGCAGAGGG + Intergenic
1116255183 14:42545653-42545675 TGTATGTGTGTTTATTCTCAAGG + Intergenic
1117025284 14:51613312-51613334 TGCATGTGTGGGTGTGGTGAGGG + Intronic
1117747360 14:58883892-58883914 TGTGTGTGTGTGTGTGTTGAAGG + Intergenic
1118851521 14:69587335-69587357 TGTATGTGTCCTTGAGTAGAAGG - Intergenic
1119031686 14:71197525-71197547 TGTCTGTTGGCTTGTGCTGGAGG + Intergenic
1119449123 14:74693040-74693062 TGGGTATGTGGTTGTGCTGAAGG - Intronic
1120364110 14:83543103-83543125 TGTATGTGTGTTCTAGCTGATGG - Intergenic
1120888037 14:89467204-89467226 TGGATGTGGGCTTGTCCTGCCGG - Intronic
1121387886 14:93545923-93545945 TGGATGTTTGCTGCTGCTGATGG + Intronic
1121860862 14:97316751-97316773 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1124203204 15:27696195-27696217 TGTATGTGTGTGTGTGGTGTGGG - Intergenic
1124377627 15:29138710-29138732 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
1124622349 15:31280900-31280922 TGTGTGTGTGCATGTGCAAAAGG + Intergenic
1125853053 15:42922528-42922550 TGTGTGTGTGTGTGTGCAGAAGG - Intergenic
1126407889 15:48340487-48340509 ATTATCTGTGCTTGTGCTTATGG + Intronic
1126762518 15:51982036-51982058 TGTCTCTGTGTTTGTGCTGTTGG - Intronic
1126783218 15:52155986-52156008 TGAATGAGTGATTGTGATGATGG + Intronic
1127340130 15:58032784-58032806 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1127403043 15:58611043-58611065 TGTACGTGTGCCAGTTCTGATGG - Exonic
1128187305 15:65653357-65653379 TGTATGTGTATTTGGGGTGAGGG + Intronic
1128605094 15:69031172-69031194 TGTATGTGGGTTAGCGCTGAGGG - Intronic
1128752971 15:70162186-70162208 TGTGTGTGTGGTGGTGGTGATGG + Intergenic
1129359610 15:75016562-75016584 TCTATGTGTGCATGTGCTCCTGG + Intronic
1129692733 15:77723007-77723029 TGCAAGTGTGCTGGTCCTGAGGG - Intronic
1130223934 15:82044290-82044312 TGTACGTGTGCGTCTGCTGCTGG + Exonic
1130261432 15:82356980-82357002 TGTGTGTGTGATTGTGGGGAAGG + Intergenic
1130279804 15:82512031-82512053 TGTGTGTGTGATTGTGGGGAAGG - Intergenic
1130371061 15:83285241-83285263 TGTGTGTGTGCGTGTGCGGTGGG - Intergenic
1130471178 15:84228217-84228239 TGTGTGTGTGATTGTGGGGAAGG - Intergenic
1130478672 15:84342787-84342809 TGTGTGTGTGATTGTGGGGAAGG - Intergenic
1130493098 15:84445344-84445366 TGTGTGTGTGATTGTGGGGAAGG + Intergenic
1130593472 15:85232854-85232876 TGTGTGTGTGATTGTGGGGAAGG - Intergenic
1130613594 15:85382483-85382505 TGTGTGTGTGATTGTGGGGAAGG + Intronic
1130702474 15:86198693-86198715 TGTATGTGTGCATGTGTTGAGGG + Intronic
1130852114 15:87805004-87805026 TGTATGTGTGTGTGTGTTCATGG + Intergenic
1130862149 15:87900716-87900738 TGTGTGTGTGTGTGTGCTGTAGG + Intronic
1130879025 15:88039113-88039135 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1130887476 15:88106042-88106064 TGTATGTGTGCGTATGTTCAAGG + Intronic
1131288956 15:91088149-91088171 TGTAGGTTTGCTTGTGCACAAGG - Intergenic
1131558039 15:93416001-93416023 TGTATGTGTCCTGGTGAGGAGGG + Intergenic
1131679024 15:94702258-94702280 TGTAGGTTTCCTTCTGCTGAAGG + Intergenic
1132569631 16:638459-638481 TGTGTGAGTGATTGCGCTGAAGG + Intronic
1133825924 16:9278255-9278277 TGTATGTGTGTGTCTGTTGACGG + Intergenic
1133888001 16:9849961-9849983 TGTCTTTGTGTTTGTGCTGCAGG - Exonic
1135281796 16:21158996-21159018 TGTATGTGTGTGTGTGTTGGGGG - Intronic
1135620639 16:23952434-23952456 TGTATGTGTGTGGGTGCTGGGGG + Intronic
1135727615 16:24869257-24869279 TGTGTGTGTGCTGGGGGTGAGGG - Intronic
1135918152 16:26624511-26624533 TGTCTGTGTGTGTGTGCTGGGGG - Intergenic
1136499945 16:30665085-30665107 TGTGTGTGTGCGTGTGCGTATGG + Intronic
1136605150 16:31328981-31329003 TGCATGTGTGTATGTGCTCATGG + Intronic
1136938143 16:34495261-34495283 TGTGTGTGTGTGTGTGCAGAGGG + Intergenic
1136949223 16:34694929-34694951 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
1136961671 16:34853296-34853318 TGTGTGTGTGTGTGTGCAGAGGG - Intergenic
1137743740 16:50805660-50805682 TGTAGGTGTGTTTGAGATGATGG - Intergenic
1137769851 16:51007386-51007408 TGTTTGTGTGGTTGCTCTGAAGG - Intergenic
1138815594 16:60199687-60199709 TGTATGTGTGTTTGTGTGGCAGG + Intergenic
1138959767 16:62015007-62015029 TGTGTGTGTGTTTGTGGTGGGGG - Intronic
1139401879 16:66688522-66688544 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1140500734 16:75431736-75431758 TGTGTGTGTGTTTGGGATGAGGG + Intronic
1140997499 16:80275630-80275652 TGTGTGTGTGTGTGTGCTGGAGG + Intergenic
1141496288 16:84412567-84412589 TGTATGTGTGTGTGTGGAGATGG + Intronic
1142518372 17:448052-448074 TGTGTGTGTGTTTGTGTTGGGGG + Intergenic
1143428722 17:6862923-6862945 TATATGCGTGCTTGTGCTGGTGG + Intergenic
1144205382 17:12976221-12976243 TGTTTGTGTGCTGGTGGTGATGG - Intronic
1146309812 17:31759065-31759087 TGTGTGTGTGTGTGTGCAGAAGG + Intergenic
1148173350 17:45543013-45543035 TGTGTGTGTGTTTGTGGTGGTGG - Intergenic
1148275918 17:46302438-46302460 TGTGTGTGTGTTTGTGGTGGTGG + Intronic
1148298032 17:46520012-46520034 TGTGTGTGTGTTTGTGGTGGTGG + Intronic
1148362572 17:47024480-47024502 TGTGTGTGTGTTTGTGGTGGTGG + Intronic
1149165415 17:53745706-53745728 TGTGTGTGTGTGTGTGTTGAAGG + Intergenic
1149435736 17:56631790-56631812 TGCATGTGTGTGTGTGGTGATGG - Intergenic
1150005204 17:61464778-61464800 TGTGTGTGCGTATGTGCTGAGGG + Intronic
1150404557 17:64889930-64889952 TGTGTGTGTGTTTGTGGTGGTGG - Intronic
1150550961 17:66209836-66209858 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
1150928418 17:69558408-69558430 TGTATGTGTGTTTGTGTTTTAGG - Intergenic
1152184288 17:78844420-78844442 TGTATGTGTGTGTGTGTTGGGGG - Intergenic
1152284069 17:79402465-79402487 AGTTTGTTTGCTTGTGCTAACGG + Intronic
1152470085 17:80486277-80486299 TGTGTGTGTGCATGTGCAGGGGG + Intergenic
1152877117 17:82793232-82793254 TGAATGTGTGGTGGTCCTGAGGG + Intronic
1152888256 17:82865215-82865237 GCTGTGTGTGCTGGTGCTGAAGG + Intronic
1152888267 17:82865267-82865289 GCTGTGTGTGCTGGTGCTGAAGG + Intronic
1152961939 18:85246-85268 TGTATGTGTGAGTGTGCACATGG - Intergenic
1153511443 18:5858116-5858138 TGTGTGTGTGGTTCTGTTGATGG - Intergenic
1153622706 18:6994608-6994630 TGTATGTGTGCATGTGTTGATGG + Intronic
1154191580 18:12234906-12234928 TGGATGTGGGCTTGTGCTCCAGG + Intergenic
1154515545 18:15161188-15161210 TGTGTGTGTGTGTGTGCAGATGG + Intergenic
1156170377 18:34476405-34476427 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1156454259 18:37284123-37284145 TGTATGTGTATCTGTGTTGAGGG - Intronic
1156590054 18:38477150-38477172 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1156845427 18:41660308-41660330 TGTGTGTGTGCTGGTTGTGATGG - Intergenic
1157044262 18:44080012-44080034 TATATGTGTGCATGTGCATATGG - Intergenic
1157535742 18:48456092-48456114 TGTGTGTGTGTGTGTGCTGGAGG + Intergenic
1157699079 18:49748546-49748568 TGTGTGTGTGTTTGTGTAGAAGG - Intergenic
1158038849 18:53068802-53068824 TGTATGTGTGTGTGTGTTGCTGG + Intronic
1159283346 18:66316072-66316094 TGTGTGTGTGTGTGTGATGATGG + Intergenic
1159408797 18:68042382-68042404 TATGGGTGTGCTTGTGCTGGGGG + Intergenic
1159690039 18:71476499-71476521 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1160798489 19:956508-956530 TGTGTGCGTGCCTGTGCTCATGG + Intronic
1161282060 19:3451273-3451295 TGTATGGGTGCTGGGGCTGGGGG + Intronic
1161449284 19:4335563-4335585 TGTATCTGTGCTTGTGTCTACGG - Intronic
1161992485 19:7692488-7692510 TGTGAATGTGCTCGTGCTGATGG - Intronic
1162153856 19:8663773-8663795 TGTATGTGTGTTTGTTGTGGGGG + Intergenic
1162776758 19:12984568-12984590 TGTATGTGTGTCTGTGATGGTGG + Intergenic
1162950795 19:14071253-14071275 TGTATGTGTGCGCGTGCGTAAGG + Intergenic
1164504315 19:28846422-28846444 TGTATGTGTGTATGTGTTTACGG + Intergenic
1164840957 19:31391683-31391705 TGTGTGTGTGTGTGTGCTGGGGG - Intergenic
1165355988 19:35304387-35304409 TGTATGTGAGTTGGTGCTGCAGG - Intronic
1166484506 19:43201826-43201848 TGTGTGTGTGTGTGTGCAGAAGG + Intronic
1166585972 19:43949287-43949309 TGTATGTGTAGTAGTGCTGGTGG + Intergenic
1166644518 19:44521583-44521605 TGTATATGTGTATGTGCTGTGGG + Intronic
1167381646 19:49141944-49141966 TGTGTGTGTATGTGTGCTGATGG + Intronic
1167887893 19:52516922-52516944 TGTATGTGTGGTTGTGTTCCAGG + Intergenic
925088924 2:1137290-1137312 TGTGTGTGTGCAGGTGCAGATGG - Intronic
925154434 2:1638915-1638937 TGCATCTGAGCGTGTGCTGAAGG + Exonic
925470500 2:4156136-4156158 TGTATATGTGCATGTGTTGGTGG + Intergenic
925531055 2:4862929-4862951 TGGATGTGTGCATGTGCAGAAGG + Intergenic
926236461 2:11048876-11048898 TGTGTGTGTGCTGGTGGCGAGGG + Intergenic
926366695 2:12139939-12139961 TGTATGTGTGTGTGTAGTGAGGG + Intergenic
927118653 2:19930579-19930601 TGTGTGTGCGTTTGTGCTGACGG - Intronic
927249743 2:20986967-20986989 TGTATGTGTGCATGTGGACATGG + Intergenic
927848227 2:26482882-26482904 TGCATGTGTGCGTGTGTTAATGG + Intronic
928035033 2:27815031-27815053 TGCATGTGTGTTTGTGTTGTAGG - Intronic
928171345 2:29006494-29006516 AGTGTGTGTGCGTGTGCTCAGGG + Intronic
928281080 2:29946947-29946969 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
929162750 2:38849412-38849434 TGTCAGTCTGATTGTGCTGACGG + Intronic
929681457 2:43996692-43996714 TGTATATGTGCATTTACTGAAGG - Intergenic
930003505 2:46878274-46878296 TGTATGTGTGTGTGTGGTGTTGG - Intergenic
930869282 2:56153716-56153738 AGTAAGTGTGCTAGTTCTGAAGG - Intergenic
930985841 2:57587145-57587167 TGTCAGTGTGCTTCTGCTGGGGG - Intergenic
931713199 2:65007279-65007301 TGTGTGTGTGTCTGTGGTGATGG + Intronic
931785696 2:65617650-65617672 TGTATGTGTGTTGGGGCAGATGG - Intergenic
932187314 2:69709482-69709504 CGTGTCTGTGCTTCTGCTGATGG - Intronic
932242621 2:70169241-70169263 TGTGTGTGTGTGTGTGGTGAGGG - Intronic
932408709 2:71531873-71531895 TTTATGTGTGCTTCTGTTGAAGG - Intronic
932722218 2:74146641-74146663 TTCATGGGTGCTGGTGCTGAAGG + Intronic
933208371 2:79536592-79536614 TGTGTGTGTGTTTGTGTTGAGGG + Intronic
933338605 2:80992962-80992984 TGTATGTGTGTGTGTGGTGGGGG + Intergenic
933795767 2:85918306-85918328 TATGTGTGTGCTTGGGTTGAGGG + Intergenic
934119281 2:88824709-88824731 TGTATATGTGCATTTGTTGAAGG + Intergenic
934332163 2:92078995-92079017 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
935717181 2:105949660-105949682 TGGATGTGTGGTTGTGGTCAGGG - Intergenic
935902001 2:107802861-107802883 TGTGTGTGTGTGTGTGTTGATGG - Intergenic
936378977 2:111967620-111967642 TGTATGTGTGCATGTGTAGGGGG - Intronic
936526123 2:113242619-113242641 TGTATATGTGGGTATGCTGAAGG + Intronic
936628992 2:114179932-114179954 TGTGTGTGTGCATGTGTTGCGGG - Intergenic
937501974 2:122489098-122489120 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
938119641 2:128624528-128624550 TGTATGTGTGCGTGTGGTGTGGG - Intergenic
938119644 2:128624556-128624578 TGTATGTGTGCGTGTGGTGTGGG - Intergenic
938449856 2:131408213-131408235 TGTATGTCTGCTTGAACTGTGGG + Intergenic
938515807 2:132005974-132005996 TGTGTGTGTGTGTGTGCAGATGG + Intergenic
938641436 2:133284864-133284886 TGAATGTTTGCCTGTGTTGATGG - Intronic
938719937 2:134057975-134057997 TGTGTGTGTGTGTGTGGTGAGGG - Intergenic
939348809 2:141004732-141004754 TGTTGGTGTTATTGTGCTGAAGG + Intronic
939478400 2:142716139-142716161 TGTATGTGTACTTGTTTTAATGG - Intergenic
939478943 2:142723910-142723932 TGTGTGTGTGTGTGTGGTGATGG - Intergenic
941516614 2:166488041-166488063 TGTATCTTTGCTTATGCCGATGG - Intronic
941574404 2:167212907-167212929 TGTGTGTGTGTGTGTGCAGAGGG - Intronic
941581735 2:167305078-167305100 TCTAGGTGTGCCTGTGCAGATGG - Intergenic
942118469 2:172752101-172752123 TGTTTGTGTGCTTTTGATCATGG + Intronic
942382317 2:175404629-175404651 TGTGTGGGTGGTTGTTCTGAGGG + Intergenic
942568116 2:177286625-177286647 TGTCTCTGGGCTTCTGCTGAAGG + Intronic
942934155 2:181533760-181533782 TTCATGTGTGCATTTGCTGAGGG - Intronic
943034990 2:182732337-182732359 TGTATGTGTGTGTGTGTAGAAGG + Intronic
943901080 2:193437462-193437484 TGTATATTAGCTTGTTCTGATGG - Intergenic
944654732 2:201866037-201866059 TGTGTGTGTGTTTGGGGTGAGGG + Intronic
945117861 2:206426868-206426890 TGTATGTGTGTGTGTGTTGGAGG - Intergenic
945359653 2:208881642-208881664 TGTGTGTGTGTTTGTGGTAAAGG - Intergenic
945359924 2:208884917-208884939 TGTATGTGTGACTGTGGTGGTGG - Intergenic
946028290 2:216685714-216685736 TGTGTGTGTGCATTTGCAGAAGG + Intronic
946529347 2:220554934-220554956 TGTGTGTGTGCTTGTGTTTTAGG - Intergenic
946541147 2:220685949-220685971 TGTGTGTGTGCGTGTGCACATGG - Intergenic
946641080 2:221784053-221784075 TGTGTGTGTGTGTGTGCTCAGGG + Intergenic
947336745 2:229093581-229093603 TGTATGTGTGCATCGGCTGAGGG + Intronic
947390796 2:229637150-229637172 AGTATGTGTGTGTGTGTTGAGGG - Intronic
947614711 2:231548415-231548437 TGCATGTGTGCATGTCCTGTTGG + Intergenic
948185196 2:236015625-236015647 CTTATGTGCGCTTGGGCTGATGG - Intronic
948287914 2:236801344-236801366 TGTATGTGTCCCTTTGCTGTGGG - Intergenic
948318952 2:237053669-237053691 TGTATGTGTGTGTGTGTTTAAGG - Intergenic
948563193 2:238867365-238867387 TGTGTGTGTGTGTGTGTTGAAGG - Intronic
948775475 2:240286551-240286573 TGTGTTTGTGCCTGTGCTTAGGG + Intergenic
948882715 2:240868694-240868716 CTTATCTGTGCTTGTGCTGCGGG - Exonic
1169175621 20:3509940-3509962 TGTATGTGTGCTTATGTGGAGGG - Intronic
1169740489 20:8888501-8888523 TGTCTGTGTGCGTGTACTGGGGG - Intronic
1170112448 20:12820480-12820502 TGTATGTGTGTGTGTGGTGGGGG - Intergenic
1170322293 20:15113785-15113807 TGTGTGTGTGTGTGTGCTGGAGG + Intronic
1170422450 20:16206488-16206510 TGTGTGTGTGTGTGTGATGATGG - Intergenic
1171234507 20:23513095-23513117 TATATGTGGGCTGTTGCTGATGG - Intergenic
1171305741 20:24104424-24104446 TGTATGTGTAGATGTGCTCATGG + Intergenic
1172195321 20:33087712-33087734 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1172425309 20:34851809-34851831 ACTATGTGAGCTTGAGCTGATGG - Intronic
1172556320 20:35844537-35844559 TGTGTGTGTGTGTGTGGTGATGG - Intronic
1172842754 20:37911915-37911937 TGTATGTGTGCGGGTGAGGATGG + Intronic
1173103188 20:40106691-40106713 TGTATGAATGCCTGTGCTGAGGG + Intergenic
1173181740 20:40811471-40811493 TGTACGTGTGCTTGTGTAGATGG + Intergenic
1173539629 20:43841687-43841709 TGCATGTATGCGTGTGTTGAGGG - Intergenic
1173976298 20:47189167-47189189 TGTCTGTGTGGTTTTGCTGAAGG - Intergenic
1174981127 20:55396477-55396499 TGTGTGTGTGTGTGTGCTGTTGG + Intergenic
1175239991 20:57540032-57540054 TCGAGGTGTCCTTGTGCTGAGGG + Intergenic
1175441024 20:58991377-58991399 TGTATTTGTGCTTGTGGTCCTGG - Exonic
1178258147 21:31074215-31074237 TGTGTGTGTGTTTGTGGTGGGGG - Intergenic
1178663038 21:34522711-34522733 TGTATGTGTGTGTGTGGTGGGGG + Intronic
1179135109 21:38672849-38672871 TGAATGTGTGCTTGTGTCGGTGG - Intergenic
1179279211 21:39919869-39919891 TGTATGAGTGCGTGTGGTGAGGG + Intronic
1179449468 21:41458626-41458648 TGTAGGTGTCCTTGTCCTGCAGG - Exonic
1179944160 21:44659307-44659329 TGTATCAGTGCTTGTGCTTAGGG - Intronic
1179944162 21:44659330-44659352 TGTATCAGTGCTTGTGCTTAGGG - Intronic
1179944164 21:44659353-44659375 TGTATCAGTGCTTGTGCTTAGGG - Intronic
1180576036 22:16775360-16775382 TGTATGTGTTCTTGGGGGGAGGG + Intergenic
1180801055 22:18632174-18632196 TGCATGTGTGCATGTGTTGGGGG - Intergenic
1180852287 22:19027731-19027753 TGCATGTGTGCATGTGTTGGGGG - Intergenic
1181220664 22:21363087-21363109 TGCATGTGTGCATGTGTTGGGGG + Intergenic
1182084580 22:27552532-27552554 TGTGTGTGTGCGTGCGCAGAAGG - Intergenic
1182881095 22:33734148-33734170 TGACTGTGTCCTTGTGCAGAGGG - Intronic
1183136464 22:35893707-35893729 TGTATGTGTGTATGTTCGGAGGG - Intronic
1183695691 22:39420808-39420830 TGTGTGTGTGTTTGTCCTGGGGG + Intronic
1183695707 22:39420917-39420939 TGTGTGTGTGTTTGTCCTGGGGG + Intronic
1184540336 22:45119071-45119093 TGTATGTGTGTGTGTGTTGTGGG - Intergenic
1184820614 22:46906798-46906820 TGTATGTGTGTGTGTGCTCTAGG + Intronic
1184961807 22:47934931-47934953 TGTGTGTGTGCGTGTGGAGATGG - Intergenic
949315128 3:2744932-2744954 TGTTTGTGTGCCGGTGGTGAAGG + Intronic
949729615 3:7093330-7093352 TGTCTGTGTGTGTGTGCTGGAGG + Intronic
952100209 3:30002385-30002407 TGTATGTGTGTGTGTGTTGGGGG - Intronic
952155811 3:30642283-30642305 TGTATATGTGTTTGTGGTGGTGG + Intronic
952202491 3:31145922-31145944 TGTATGTTTGTTTGTGCAAAGGG - Intergenic
952520937 3:34156917-34156939 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
952890753 3:38038834-38038856 TATGTGTGTGTTTGTGATGATGG - Intergenic
953346042 3:42176546-42176568 TGTGTATGAGCATGTGCTGAGGG - Intronic
953370576 3:42384784-42384806 TGTGTGTGTGTGTGTGATGAGGG + Intergenic
953566057 3:44032981-44033003 TGTATGTGTGTTTGTGGTGGGGG + Intergenic
953748863 3:45594773-45594795 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
954941131 3:54374287-54374309 TGTATGTGGGCATGTGCAGATGG - Intronic
955327423 3:58020080-58020102 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
955530818 3:59871450-59871472 TGTATGTGTGCGTGTGTGGGGGG - Intronic
955564144 3:60225943-60225965 TCTGTGGGTGCCTGTGCTGAAGG + Intronic
956225771 3:66956585-66956607 TGTGTGTGTGTGTGTGGTGACGG + Intergenic
956371849 3:68571427-68571449 TGTCTGTGTGTTCATGCTGATGG - Intergenic
956378775 3:68644369-68644391 TGTCTGTGTGCATATGCTGGTGG + Intergenic
957036581 3:75298864-75298886 TGCATGTGTGTATGTGTTGAGGG + Intergenic
958166144 3:89880291-89880313 TGTGTGTGTGCGTGTGCTGTGGG + Intergenic
958488830 3:94746206-94746228 TGTCAGTGTGCTCCTGCTGAGGG - Intergenic
958728859 3:97938522-97938544 TGCATGTGTGCATGTGAAGAGGG - Intronic
959041208 3:101424667-101424689 TGTGTGTGTGGTTGTGCTGTTGG - Intronic
959679148 3:109072929-109072951 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
960246483 3:115405535-115405557 TGTGTGTGTGTTTGTGGTGGGGG + Intergenic
960717118 3:120586792-120586814 TGTATGTGTGTATGGGTTGAGGG + Intergenic
961088039 3:124086344-124086366 TGTGTGTGTGTTTTTGCTGGGGG + Intronic
961651565 3:128419176-128419198 TGAGTGAGTGCTTGTGCTCATGG - Intergenic
962001683 3:131305007-131305029 TGTGTGTGTGCTTGTGCTGGTGG + Intronic
962518080 3:136172271-136172293 TGTATGTGTGTATGTGTTGTCGG - Intronic
962590244 3:136882574-136882596 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
962885041 3:139616777-139616799 TGTGTGTGTGTATGTGCTGCAGG + Intronic
963504774 3:146170341-146170363 TGTATGTGTGTGTGTGTTGGGGG - Intergenic
963850846 3:150209066-150209088 TGTCTGTGTCCATCTGCTGAGGG - Intergenic
965635303 3:170774637-170774659 TGTGTGTGTGTGTGAGCTGATGG - Intronic
965718650 3:171635800-171635822 TATATGTTTGCTTGTGCTTTTGG + Intronic
966231504 3:177657460-177657482 CGTGTGTGGGCATGTGCTGAGGG - Intergenic
967005868 3:185381800-185381822 TTTATGTGTGCTTCTGTTTAAGG - Intronic
967561997 3:190926917-190926939 TGCATGTGTGCATGTGTTGGTGG + Intergenic
968005782 3:195241778-195241800 TGTGTGTGTGTTGGTGGTGAGGG - Intronic
970476834 4:16432244-16432266 TGTATATGTGTGTGTGTTGAGGG + Intergenic
970740109 4:19227164-19227186 TGTGTGTGTGTTTGTGTTTATGG - Intergenic
970982786 4:22122006-22122028 TGTATGTGTGTGTGTTTTGAGGG - Intergenic
971161274 4:24136561-24136583 TGTTGCTGTGCTTCTGCTGAAGG - Intergenic
971187363 4:24393007-24393029 TGTGTGTGTGTGTGTGCTGATGG - Intergenic
971351221 4:25857902-25857924 TGTTTGTGTGTTTGTGGTTAAGG - Intronic
972194998 4:36643622-36643644 TGTATGTGTGCTTGTGTGTGGGG - Intergenic
972245441 4:37242432-37242454 TGTATGTGTGTGTGTTTTGAGGG + Intergenic
973285475 4:48411107-48411129 TGTATGTGTGTGTGTGTTTAAGG + Intronic
974124033 4:57673753-57673775 TGTGTGTGTGTTTGGGCTGAGGG + Intergenic
974971941 4:68841704-68841726 TGTATGTGAGGTTTTGATGATGG - Intergenic
975107941 4:70590500-70590522 TGTGTGTGTGTGTGTGCTGGAGG - Intergenic
975495088 4:75028339-75028361 TGTATCTGTGGATGTGCTGGAGG - Intronic
977046572 4:92075676-92075698 TGTGTGTGTGTGTGTGGTGAGGG - Intergenic
977258011 4:94761446-94761468 TGTGTGTGTGTGTGTGTTGAAGG + Intronic
977418291 4:96763800-96763822 TGTATGGGTGCTGGTGGTGGTGG + Intergenic
978937167 4:114391807-114391829 TGTGTGTGTGTTTGTGTTGGGGG - Intergenic
979263139 4:118671004-118671026 TGTGTGTGTGCATGTGGTGGTGG - Intergenic
979384787 4:120052193-120052215 TGTATGTGTGTGTGTGGTGGTGG - Intergenic
979774678 4:124574889-124574911 TGTGTGTGTGCATGTGGAGAGGG - Intergenic
979963150 4:127045660-127045682 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
980102366 4:128554547-128554569 TGTGTGTGTGTGTGTGTTGAAGG + Intergenic
981463908 4:145044069-145044091 TGTATTTGTGCTGGTGCAGGAGG - Intronic
981615137 4:146638000-146638022 TGTATGTGTGTGTGTGTTGTGGG + Intergenic
982315353 4:154025600-154025622 GTTCTGTGTGCTCGTGCTGAGGG + Intergenic
982564082 4:156967416-156967438 TGTATGTGTTCTTTTTCTCAAGG - Intronic
982624298 4:157746203-157746225 TGTATGTGTGTGTGTGGTAAGGG - Intergenic
982679410 4:158410900-158410922 TGCATATGTGAATGTGCTGAAGG + Intronic
982765322 4:159340661-159340683 TGTGTGTGTGTGTGTGGTGATGG - Intronic
982765327 4:159340773-159340795 TGTGTGTGTGTGTGTGGTGATGG - Intronic
983327833 4:166281976-166281998 TGTATGTGGCCTGTTGCTGATGG - Intergenic
984538712 4:181010442-181010464 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
985198650 4:187461176-187461198 TGTGTGTGTGCATGCGTTGATGG + Intergenic
985751976 5:1685867-1685889 TGCATGTGCGCGTGTGCTGAGGG + Intergenic
985863683 5:2494985-2495007 TGTTTGTGTGCTTATGAAGAAGG + Intergenic
987146609 5:14997092-14997114 TTTTTGTGTGATTGTGCTAAGGG - Intergenic
987466669 5:18280112-18280134 TGTGTGTGTGCTTGTGTACATGG + Intergenic
988912735 5:35861141-35861163 TGTATGAGTGTTTTTGGTGAAGG - Intronic
988951401 5:36265361-36265383 TATATGTGTGCGTGTGTTGGGGG - Intronic
989581386 5:43036611-43036633 TGTATGTGTGTGTGTGGAGATGG - Intergenic
989716335 5:44467937-44467959 TATGTGTGTGCTTGTGCTGGTGG + Intergenic
989986795 5:50709866-50709888 TGTGTGTGTGTTTGTGTTGGGGG + Intronic
990254108 5:53947205-53947227 TGTGTGTGTGTGTGTGTTGAGGG + Intronic
990322298 5:54641794-54641816 TGTATGTATGCGTGTGCGGGTGG + Intergenic
990902385 5:60766627-60766649 TTTATTTGTGCTTCTGCAGATGG - Exonic
990917224 5:60921602-60921624 TGTATGTGTGTGTTTGGTGAGGG + Intronic
992160662 5:73997759-73997781 TGCGTGTGTGCTTATGTTGAGGG - Intergenic
992279208 5:75156330-75156352 TGTATGTGTGCATGTCCTTCTGG + Intronic
992389500 5:76317437-76317459 TGTATGTGTGTGTGTGTTGGGGG - Intronic
993807749 5:92433496-92433518 TGTATGTGTGTGTGTGGTGGTGG - Intergenic
994314806 5:98320479-98320501 TGTGTGTGTGCGTGTGGTGTGGG - Intergenic
995241847 5:109893970-109893992 TGTGTGTGTGTGTGTGATGAAGG - Intergenic
995288721 5:110423814-110423836 TGTATGTGTGTATGTGATGTTGG + Intronic
995660346 5:114475704-114475726 TGCACGTGTGCTTGTGCTCATGG + Intronic
995914784 5:117231695-117231717 TGTGTGTGTGCATGTGTTGGGGG + Intergenic
996366699 5:122709129-122709151 TGTTTGTGTGTTTGTGGAGACGG + Intergenic
996579935 5:125020134-125020156 TGTGAGTGTCCGTGTGCTGAAGG + Intergenic
996625328 5:125563766-125563788 TTTACGTGTGCTTGCTCTGAAGG + Intergenic
997364703 5:133318541-133318563 TGGATGTGTGCCTGTGTGGAGGG + Intronic
997869829 5:137497842-137497864 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
998043443 5:138968104-138968126 TTAATGTGTGCTTGGGCTGGAGG + Intronic
999116411 5:149168043-149168065 TGTATGTGTGCGTGTGCTATAGG - Intronic
999442450 5:151612977-151612999 TGTATGTGTGTGTGTGGTGGGGG + Intergenic
1000491357 5:161918399-161918421 TGTGTGTGTGTGTGTGGTGACGG + Intergenic
1000756836 5:165171896-165171918 TGTGTGTGTGCTTGGGGTGATGG - Intergenic
1001219215 5:169884741-169884763 TGTATGTTTGCTTGGCCTCAGGG + Exonic
1001555948 5:172637311-172637333 TGTATGGGTACTGGTGCTAAAGG + Intergenic
1001567294 5:172707704-172707726 TGTGAGTGTGCGTGAGCTGAGGG + Intergenic
1001864659 5:175093025-175093047 TATATGTGTGTTTGTGGAGATGG - Intergenic
1002057830 5:176609041-176609063 TGTATGTATGCATGGTCTGAGGG - Intronic
1002904517 6:1438029-1438051 TGTGTGTGTGTGTGTGTTGATGG - Intergenic
1002956564 6:1871052-1871074 TGTGTGTGTGTGTGTGCTGGGGG - Intronic
1003044351 6:2719368-2719390 TGTTTGTGTGCATGTGTTGGGGG - Intronic
1003146704 6:3516040-3516062 TGTGTGTGTGTGTGTGGTGAGGG - Intergenic
1003427529 6:6007554-6007576 TGTGTGTGTGCTCGTGCGGGGGG - Intronic
1003629875 6:7777185-7777207 TGGATCTGTGCATGTGGTGAGGG + Intronic
1004227734 6:13802394-13802416 TGAATGTGTGCATTTGCTGTGGG - Intronic
1005434601 6:25795055-25795077 TGTTTGTGTTGCTGTGCTGATGG - Intronic
1005455739 6:26017950-26017972 TGTGTGTTTGCTTGCGTTGAGGG - Intergenic
1005490759 6:26345017-26345039 TGTATTTGTGCTTCTGCTTTTGG - Intergenic
1007323079 6:41041134-41041156 TGTTTGAGGGCTTGTGGTGAGGG - Intronic
1007410035 6:41656180-41656202 TGTGTGTGTGTGTGTGCTGGGGG - Intergenic
1007725231 6:43911969-43911991 AGGGTGTGTGCTTGTGTTGAGGG + Intergenic
1007990933 6:46255257-46255279 TGTATGTGTGTGTGTGTTGAGGG + Intronic
1008138545 6:47805431-47805453 TGTGTGTGTGTGTGTGCTGCAGG + Intronic
1008497328 6:52146289-52146311 TGTATGGGTGGCTGTGCTGCTGG + Intergenic
1008695113 6:54026726-54026748 TGTGTGTGTGTGTGTGTTGATGG + Intronic
1009847562 6:69152542-69152564 TATTTGTGTTCTTGTGATGAGGG - Intronic
1011203983 6:84871936-84871958 TGTATGTGTGTGTGTGCGGAGGG + Intergenic
1011384070 6:86775229-86775251 TGTGTGTGTGTGTGTGGTGATGG - Intergenic
1012658924 6:101861288-101861310 TTTATGAGTGTTTGTGTTGAGGG + Intronic
1012687394 6:102268951-102268973 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1012690017 6:102298711-102298733 TGTGTGTGTGTTTGTGGGGAGGG - Intergenic
1012947740 6:105485911-105485933 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
1013734054 6:113205346-113205368 TGTGTGTGTGTGTGTGGTGAAGG + Intergenic
1014282110 6:119453208-119453230 TGTGTGCGTGCTTGTGTTCATGG + Intergenic
1015190345 6:130465273-130465295 TGTGTGTGTGTGTGTGGTGAGGG + Intergenic
1015872382 6:137790275-137790297 TGTGTGTGTGTGTGTGGTGATGG + Intergenic
1016025753 6:139285252-139285274 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1016066860 6:139692566-139692588 TGTCTGTGTGTGTGTGTTGAAGG - Intergenic
1016495568 6:144657889-144657911 TGTGTGTGTGGTGGTGGTGATGG + Intronic
1016521118 6:144948068-144948090 TGTATGTGTGCTTGTGAAGTTGG + Intergenic
1016688144 6:146904477-146904499 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1016705224 6:147099316-147099338 TGTGTGTGTGTGTGTGCAGAAGG - Intergenic
1017152921 6:151297199-151297221 TGTATGTGTGTGTGTGTTGTGGG + Intronic
1017277434 6:152585911-152585933 TGTATGTGTGCATGTGTTTGGGG + Intronic
1017406955 6:154129846-154129868 TGTGTGTGTGTGTGTGCTGGGGG - Intronic
1017543506 6:155427014-155427036 TGTGTGTGTGTGTGTGCTGGGGG + Intronic
1018240972 6:161774376-161774398 TGTGTGTGTGTGTGTGCTCAGGG - Intronic
1018300436 6:162396742-162396764 TGTGTGTGTGCATGTGCATATGG - Intronic
1019300516 7:301151-301173 TGTGTGCGTGCTTGTGCATACGG - Intergenic
1019487228 7:1294919-1294941 TGTGTGTGTGCCTGTGGTGTGGG + Intergenic
1020517881 7:9147333-9147355 TGTATGTGTGTTTGTGTTTATGG + Intergenic
1020720389 7:11737290-11737312 TTTATGTGTGGTGGTGGTGAGGG + Intronic
1020781175 7:12518552-12518574 TGAGTGTGTGTTTGTGCTGTTGG + Intergenic
1021077123 7:16318719-16318741 CAAATGTGTGCTTGTGCTGTTGG - Intronic
1021117856 7:16763752-16763774 TGTGTGTCTGCTGCTGCTGATGG + Intronic
1021905160 7:25326258-25326280 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1022146955 7:27553987-27554009 TGTATGTTTGTTTGTGTTTATGG + Intronic
1022711998 7:32860180-32860202 TGTGTGTGTGTGTTTGCTGAAGG - Intergenic
1022772820 7:33492845-33492867 TGTGTGTGTGTATGTGTTGAAGG + Intronic
1023081584 7:36531861-36531883 TGTATGTGTGCGTGTGCACAGGG + Intronic
1023194613 7:37621433-37621455 TGTATGTGTATGTGTGCTGGGGG + Intergenic
1023194615 7:37621439-37621461 TGTATGTGTGCTGGGGGTGGAGG + Intergenic
1024682821 7:51711519-51711541 TTTCTGTGTGCTTGTGCTGCAGG + Intergenic
1025321941 7:58104019-58104041 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
1025475082 7:60909346-60909368 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
1025487816 7:61073643-61073665 TGTGTGTGTGTGTGTGCAGATGG + Intergenic
1025511918 7:61580548-61580570 TGTGTGTGTGTGTGTGCAGATGG + Intergenic
1025556474 7:62315616-62315638 GGTATGTGTGTGTGTGCAGATGG + Intergenic
1025566169 7:62436778-62436800 TGTGTGTGTGTGTGTGCAGATGG - Intergenic
1027675430 7:81151960-81151982 TGTGTGTGTGTGTGTGCTTAAGG - Intergenic
1029047015 7:97640458-97640480 ATTGTGTTTGCTTGTGCTGAAGG - Intergenic
1030654166 7:112147968-112147990 AGCATGTGTGCTTGAGCAGAGGG - Intronic
1030855090 7:114545871-114545893 TGTGTGTGTGCTGGTGAGGATGG - Intronic
1031363219 7:120871728-120871750 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
1031925603 7:127635324-127635346 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1033790830 7:144790840-144790862 TGTGTGTGTACGTGTGTTGAAGG + Intronic
1035096009 7:156356101-156356123 TGTGTGTTTCCTTGTTCTGATGG + Intergenic
1035348926 7:158229319-158229341 TGTCTGTGTCCTTGCACTGAAGG - Intronic
1036073254 8:5465707-5465729 TGTTTGTTTGCTTGTGTGGAAGG - Intergenic
1036086565 8:5618909-5618931 TGTGTGTGTGTGTGTGCTGGAGG + Intergenic
1036166064 8:6434907-6434929 AGTATGTGTATTTGTGCTGATGG + Intronic
1036273970 8:7334245-7334267 TGTCTGTGTGTTTGTGTTCATGG + Intergenic
1036274550 8:7338967-7338989 TGTCTGTGTGTTTGTGTTCATGG + Intergenic
1036346800 8:7971379-7971401 TGTCTGTGTGTTTGTGTTCATGG - Intergenic
1036347376 8:7976103-7976125 TGTCTGTGTGTTTGTGTTCATGG - Intergenic
1036842132 8:12132133-12132155 TGTCTGTGTGTTTGTGTTCATGG - Intergenic
1036842686 8:12136888-12136910 TGTCTGTGTGTTTGTGTTCATGG - Intergenic
1036863960 8:12378383-12378405 TGTCTGTGTGTTTGTGTTCATGG - Intergenic
1037202587 8:16276058-16276080 TCTAGGTGTGCTTGGTCTGAAGG - Intronic
1037203823 8:16290503-16290525 TGTCTGAGTGCTGTTGCTGAAGG + Intronic
1037619877 8:20554446-20554468 TGTGTGTGTGTGTGTGGTGAGGG + Intergenic
1039223166 8:35357762-35357784 TGTATATATGCTTTGGCTGATGG + Intronic
1040097671 8:43462681-43462703 TGAATTTGTGCTTGTTATGATGG + Intergenic
1040390746 8:46948753-46948775 TGTATGTGTGTATTTGATGAGGG + Intergenic
1040718187 8:50284367-50284389 GGTATGTCTGCTTGAGATGATGG - Intronic
1041171254 8:55144403-55144425 TCTAGGTGGGCTTGTGCTGTTGG - Intronic
1041314012 8:56543277-56543299 TGTGTGTGTGTGTGTGGTGATGG + Intergenic
1041481735 8:58329449-58329471 TGTATGTATGCTTTTGTTGCTGG - Intergenic
1042182640 8:66107182-66107204 TTTATGTGTGTTTCTGTTGAAGG - Intergenic
1043422408 8:80112084-80112106 TTTATTTGTCCTTGTGCTGTGGG - Intronic
1044000675 8:86876202-86876224 TGTGTGTGTGTTTGTGGTGGAGG + Intronic
1044013479 8:87023188-87023210 TGCATGAGTGATTTTGCTGAAGG + Intronic
1044167252 8:89001946-89001968 TGTGTGTGTGTGTGTGTTGATGG + Intergenic
1044355680 8:91220271-91220293 AGTATGTGTGCTTATTTTGAGGG + Intronic
1045052183 8:98337402-98337424 TGTGTGTGTGTGTGTGGTGAGGG - Intergenic
1045096759 8:98805945-98805967 TGTGTGTGTGCTTGTGTGGATGG - Intronic
1045353355 8:101362491-101362513 TGTATGTGTGAGTGTACCGAGGG - Intergenic
1045499871 8:102736964-102736986 TGTGTGTGTGTTTGTGAAGAGGG - Intergenic
1045844863 8:106622447-106622469 TGTGTGTGTGTGTGTGCTGGGGG - Intronic
1045960584 8:107963592-107963614 CGTATGTGTGCGTGTGTTCATGG + Intronic
1046790234 8:118313894-118313916 TGTATGTGTGTGTGTGTAGAGGG + Intronic
1046966043 8:120166913-120166935 TGTGTGTGTGGTGGTGATGATGG + Intronic
1047249433 8:123170597-123170619 TGTATGTGTGTGTGTGGTGCAGG + Intergenic
1047974155 8:130112874-130112896 GGTATTTGCGCTTGTGGTGATGG + Intronic
1048047213 8:130784122-130784144 TGTATGTGTGTGTGTGTTGGGGG + Intronic
1048257660 8:132917403-132917425 TGTGTGTATACCTGTGCTGAGGG + Intronic
1048821935 8:138388097-138388119 TGTGTGTCTTTTTGTGCTGAGGG - Intronic
1049197452 8:141323571-141323593 TGTGTGTGTGCCTGTGCAGTGGG - Intergenic
1050113156 9:2237389-2237411 TGTATGTGTTTATGTGCTGTAGG - Intergenic
1050598619 9:7228508-7228530 TGTGTATGTGCTTATGTTGAGGG - Intergenic
1052227747 9:26109596-26109618 TGGAAGTGGGCTTGTGCTCAAGG + Intronic
1052335208 9:27312262-27312284 TGTTTGTGTGCATGTGTTGGGGG + Intergenic
1052394604 9:27923738-27923760 TGTGTGTGTGCATGTGCTTGTGG + Intergenic
1055206186 9:73733290-73733312 TGTGTGTGTGCATGTGAAGAGGG - Intergenic
1055435648 9:76289463-76289485 TGTGTGTGTGTGTGTGGTGAGGG - Intronic
1055448272 9:76405283-76405305 TGTGTGTGTGTGTGTGTTGAAGG - Intergenic
1057237442 9:93373697-93373719 TGCATGTGTGCATGTGTTAAAGG + Intergenic
1057942323 9:99296164-99296186 TGTGTGTGTGTTTATGTTGAGGG + Intergenic
1057985756 9:99711960-99711982 TGCATGTTTGCTTCGGCTGAAGG - Intergenic
1058301343 9:103377260-103377282 TGCATTTCTGATTGTGCTGATGG + Intergenic
1058385356 9:104429407-104429429 TGGATCTGTGCATGTGCAGAAGG + Intergenic
1059536547 9:115086262-115086284 GGCATGTGTGTTTGTGATGACGG - Exonic
1059741662 9:117156972-117156994 TGTCTGTGTGTATGTGCTGGAGG - Intronic
1061138110 9:128748074-128748096 TGTCTGTGTGTATGTGGTGACGG - Intronic
1061712614 9:132498470-132498492 GGTCTGTGTGTCTGTGCTGAAGG - Intronic
1061866786 9:133495908-133495930 TGTGTGTGTGCATGAGCTTATGG + Intergenic
1061935291 9:133854089-133854111 TATGTGTGTGCATGTGCAGATGG - Intronic
1061935305 9:133854221-133854243 TGTATGTGTGCAGGTGCACATGG - Intronic
1061951265 9:133937545-133937567 TGTGTGTGTGTGTGTTCTGAAGG + Intronic
1062736206 9:138138873-138138895 TGTATGTGTGAGTGTGCACATGG + Intergenic
1187194099 X:17065477-17065499 TGTAAGTGTTCTTGTGCTTTTGG + Intronic
1187223401 X:17352794-17352816 TGTGTGTGTGGTTGTGCGGGTGG - Intergenic
1188825490 X:34827947-34827969 TGTGTGTGTGTGTGCGCTGAGGG - Intergenic
1189090278 X:38074900-38074922 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1189348506 X:40260248-40260270 TGTATGTGCGTGTGTGTTGAGGG + Intergenic
1189922578 X:45917086-45917108 TGTATGTGTGCTTATGCAAATGG + Intergenic
1191012723 X:55777543-55777565 TGTTTGTGTGCATTTGCTAAAGG - Intergenic
1191754479 X:64579726-64579748 TGTGTGTGTGGTTGTGGGGAGGG + Intergenic
1191998112 X:67118386-67118408 TGTGTGTGTGTGTGTGCAGAAGG + Intergenic
1193624035 X:83794672-83794694 TGTATATGTGCCTGTGCTTAGGG + Intergenic
1193761248 X:85468880-85468902 TTTATGTGTTCATCTGCTGATGG - Intergenic
1194277690 X:91907365-91907387 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1194806007 X:98328799-98328821 TGTCTGTGTGTGTGTGTTGAGGG - Intergenic
1195133420 X:101877692-101877714 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1195567794 X:106363134-106363156 GGGGTGTGTGGTTGTGCTGAAGG + Intergenic
1195745655 X:108115138-108115160 TGTGTGTGTGTGTGTACTGAGGG + Intronic
1196060445 X:111402806-111402828 TGTGTGTGTGTGTGTGCGGAGGG + Intronic
1197329819 X:125139818-125139840 TGTGTGTGTGTGTGTGTTGAGGG - Intergenic
1197717155 X:129717978-129718000 TGTGTGTGTGTGTGTGGTGAGGG - Intergenic
1198115055 X:133536726-133536748 TGTATGTGTGCTGGTGGGGAGGG + Intronic
1198185279 X:134248567-134248589 TGTATGTGTGCTTGGGGGCAGGG + Intergenic
1198227712 X:134661060-134661082 TGTATGTGTACCTGTGCTTTGGG + Intronic
1198301971 X:135342495-135342517 TGTGTATGTGCTTGTGTGGAGGG + Exonic
1198497509 X:137207142-137207164 TGTTTGTGTGTGTGTGTTGAAGG + Intergenic
1199030866 X:142998177-142998199 TGTGTGTGTGTGTGTGTTGAGGG + Intergenic
1199318329 X:146407702-146407724 TGTGTGTGTGTTTGTGAAGAAGG - Intergenic
1199374246 X:147088361-147088383 TGTGTGTGTGGTGGTGGTGATGG - Intergenic
1199672554 X:150159192-150159214 TGTATGTGGGCTTCTGCAGCGGG + Intergenic
1199782904 X:151079989-151080011 TGTATGTGTGGATGTGTTGAAGG + Intergenic
1199880615 X:151971898-151971920 TGTGTGTGTGTGTGTGGTGAGGG + Intronic
1199999167 X:153048412-153048434 TGTATGTGTGCATGTGGGCAGGG - Intergenic
1200595032 Y:5129433-5129455 TGTGTGTGTGTGTGTGTTGAGGG - Intronic
1202385201 Y:24319429-24319451 TGTGTGTGTGCATGTGGTGGTGG - Intergenic
1202485584 Y:25350699-25350721 TGTGTGTGTGCATGTGGTGGTGG + Intergenic