ID: 905974784

View in Genome Browser
Species Human (GRCh38)
Location 1:42166253-42166275
Sequence CTGAAGGTGTGTGTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 4, 2: 17, 3: 89, 4: 786}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974779_905974784 24 Left 905974779 1:42166206-42166228 CCCTGATGGGTGTGTGTAGCCAA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 905974784 1:42166253-42166275 CTGAAGGTGTGTGTGTGCTGAGG 0: 1
1: 4
2: 17
3: 89
4: 786
905974780_905974784 23 Left 905974780 1:42166207-42166229 CCTGATGGGTGTGTGTAGCCAAG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 905974784 1:42166253-42166275 CTGAAGGTGTGTGTGTGCTGAGG 0: 1
1: 4
2: 17
3: 89
4: 786
905974782_905974784 5 Left 905974782 1:42166225-42166247 CCAAGGTGTGTTTGTATGTGTGC 0: 1
1: 0
2: 13
3: 186
4: 1874
Right 905974784 1:42166253-42166275 CTGAAGGTGTGTGTGTGCTGAGG 0: 1
1: 4
2: 17
3: 89
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974784 Original CRISPR CTGAAGGTGTGTGTGTGCTG AGG Intergenic
900194804 1:1370852-1370874 CTTCAGATGTGTGTGTGTTGGGG - Intergenic
900249769 1:1662086-1662108 CTGAAGGTTTCTGTGCTCTGAGG + Exonic
900260809 1:1727993-1728015 CTGAAGGTTTCTGTGCTCTGAGG + Intronic
900300583 1:1974818-1974840 TTGGAGGAGTGCGTGTGCTGTGG + Intronic
900305602 1:2005416-2005438 CGGAAGGTGGGTGAGTGCAGAGG - Intergenic
900316895 1:2061445-2061467 CTGAAGGGGAGTGTGTCATGGGG + Intronic
900432377 1:2608418-2608440 GTGGATGTGTGTGTGTGGTGTGG - Intronic
900435869 1:2630442-2630464 GTGAACGTGTGTGTGCGCTCTGG + Intronic
900502296 1:3012411-3012433 CAGAATGAGTGTGTGTGCAGGGG - Intergenic
900515625 1:3080924-3080946 CTGAGAGTGTGTGTGTGTAGAGG + Intronic
900581078 1:3409732-3409754 GTGTGGGTGTGTGTGTGGTGTGG + Intronic
901409141 1:9070836-9070858 CTGTGTGTGTGTGTGTGTTGGGG + Intronic
901607055 1:10467393-10467415 CAAGAGGTCTGTGTGTGCTGGGG - Intronic
902323483 1:15684032-15684054 CTGAAGGAATCTGTGGGCTGAGG + Intergenic
903302727 1:22390713-22390735 ATGCACGTGTGTGTGTGTTGGGG - Intergenic
903332237 1:22602048-22602070 GTGCATGTGTGTGTGTGGTGGGG + Exonic
903668068 1:25019874-25019896 GTGCAGGTGTGTGTGTGCACAGG - Intergenic
904038094 1:27569475-27569497 CTGCAGTTGTGTGTGTGGTGGGG - Intronic
904199919 1:28812796-28812818 GTGTATGTGTGTGTGTGGTGCGG + Intronic
905199219 1:36305379-36305401 CTGAGTGTGTGTGTGTGTTGAGG + Intergenic
905202953 1:36326144-36326166 CAGATGGTGTGTGGGTGCAGGGG + Intronic
905303103 1:36999004-36999026 GTGTATGTGTGTGTGTGTTGGGG + Intronic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
905974784 1:42166253-42166275 CTGAAGGTGTGTGTGTGCTGAGG + Intergenic
905974787 1:42166317-42166339 GTGTATGTGTGTGTATGCTGAGG + Intergenic
906041278 1:42789499-42789521 CTGGAGGGATGTCTGTGCTGTGG + Intronic
906581349 1:46937491-46937513 CTGAAGGTCAGTGTGGGCTCAGG + Intronic
906677729 1:47705400-47705422 CTGAGGATTTGTCTGTGCTGTGG + Intergenic
906929574 1:50155970-50155992 GGGGATGTGTGTGTGTGCTGGGG - Intronic
907046349 1:51302458-51302480 CTGTGGGTGTTTGTGGGCTGGGG + Intronic
907312605 1:53547560-53547582 CTGGAGGGGTAGGTGTGCTGGGG - Intronic
907313956 1:53555826-53555848 CTGCAGGTGTGTGTGTGTGCAGG + Intronic
907313968 1:53555977-53555999 CTGCAGGTGTGTGTGTGTGCAGG + Intronic
907313970 1:53556004-53556026 CTGCAGGTGTGTGTGTGTGCAGG + Intronic
907313987 1:53556264-53556286 CTGCAGGTGTGTGTGTGTGCAGG + Intronic
907314006 1:53556533-53556555 CTGCAGGTGTGTGTGTGTGCAGG + Intronic
907525894 1:55053821-55053843 CTGAAGGTCAGTGTGTGGAGGGG + Intronic
907749788 1:57251910-57251932 TTTATGGGGTGTGTGTGCTGGGG - Intronic
907924696 1:58944496-58944518 ATGACAGTGTGTGTGTACTGGGG - Intergenic
908213984 1:61932176-61932198 CTGGGGCTGTGTGTGTGTTGGGG - Intronic
908512546 1:64860964-64860986 GTGTATGTGTGTGTGTGTTGGGG + Intronic
908634657 1:66149568-66149590 CTTAAGGTTTGGGGGTGCTGGGG + Intronic
909199057 1:72665876-72665898 CTGAATGTGTATCTGTGGTGTGG - Intergenic
910338547 1:86159429-86159451 CTGAAGGTATGTGTGCTCTTTGG - Intergenic
911035513 1:93541602-93541624 GGGAAGGTGTGTGTGTGTTTGGG + Intronic
911118225 1:94268404-94268426 GCCAATGTGTGTGTGTGCTGGGG - Intronic
911209971 1:95128749-95128771 TTGTATGTGTGTGTGTGGTGGGG + Intronic
912568544 1:110606143-110606165 CTGAAGGAGTGTGTGTGCTGGGG - Intronic
913533827 1:119752594-119752616 CCGAAAGTGTGTGTCTCCTGAGG - Exonic
913570705 1:120117222-120117244 CTGTAAGTGTGTGTATGTTGTGG + Intergenic
913639272 1:120795453-120795475 CTGATGGTGTGTGTGTGTGTGGG + Intergenic
914279178 1:146154505-146154527 CTGATGGTGTGTGTGTGTGTGGG - Intronic
914291512 1:146278198-146278220 CTGTAAGTGTGTGTATGTTGTGG + Intergenic
914340828 1:146758858-146758880 CTGCAGGTGTGTTTGTGTAGGGG - Intergenic
914464371 1:147913011-147913033 CTGAAGGTCTGTGTGACCTGGGG + Intergenic
914540222 1:148605435-148605457 CTGATGGTGTGTGTGTGTGTGGG - Intronic
914552556 1:148728981-148729003 CTGTAAGTGTGTGTATGTTGTGG + Intergenic
914626423 1:149465779-149465801 CTGATGGTGTGTGTGTGTGTGGG + Intergenic
915472387 1:156133760-156133782 ATGAAGGCATGTGTGTTCTGGGG - Intronic
915590746 1:156868825-156868847 CTGAGGGTGTGTGCGTGCCCTGG - Intronic
915733554 1:158070690-158070712 CTTATGGGGTGTGTGTGGTGAGG + Intronic
915807849 1:158873277-158873299 CTGTAAGTGTGTGTGTGGTGGGG - Intergenic
915832212 1:159141684-159141706 CTGATGCTGTGTGTGTGGTGAGG - Intronic
916056514 1:161072401-161072423 CTGACTGTGTGTGTGTGGAGGGG - Exonic
916211864 1:162366230-162366252 CTCAGAGTGTGTGTGGGCTGTGG + Intronic
916747196 1:167693640-167693662 CTGAACGTGTGGGGTTGCTGTGG + Intronic
918146166 1:181757998-181758020 TGGAAGGTGTGTCTGTTCTGCGG - Exonic
918422877 1:184381892-184381914 CTTTACTTGTGTGTGTGCTGTGG + Intergenic
919182381 1:194103369-194103391 CTGCAGGTGGGTGTCAGCTGTGG + Intergenic
919348126 1:196412642-196412664 CTGTACATTTGTGTGTGCTGGGG - Intronic
919463295 1:197903200-197903222 GTGTATGTGTGTGTGTGTTGCGG + Intronic
919928278 1:202204339-202204361 GTGGAGGTGTGTGTGTGTGGAGG - Intronic
919928280 1:202204355-202204377 GTGGAGGTGTGTGTGTGTGGAGG - Intronic
919928291 1:202204444-202204466 GTGGAGGTGTGTGTGTGTGGAGG - Intronic
920445249 1:206011384-206011406 GTGAGAGTGTGGGTGTGCTGGGG + Intronic
920824684 1:209414292-209414314 CTAAAAGTGTGTTTGTGCTGTGG - Intergenic
920868243 1:209771016-209771038 GTGGATGTGTGTGTGTGCTCAGG + Intronic
920868295 1:209771549-209771571 GTGGAGGTGTATGTGTGCAGTGG + Intronic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
921790239 1:219281598-219281620 CTGTGTGTGTGTGTGTGTTGGGG - Intergenic
922334238 1:224606040-224606062 ATGTAGGTGAGTGGGTGCTGGGG + Intronic
922412560 1:225390483-225390505 CTTTTTGTGTGTGTGTGCTGGGG - Intronic
922770917 1:228182575-228182597 GGGACGGGGTGTGTGTGCTGGGG + Intergenic
922880627 1:228977844-228977866 GGGAAGGTGTGTGTGTGCTGTGG + Intergenic
923210313 1:231797934-231797956 ACGAATGTGTGTGTGTGTTGTGG + Intronic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923536782 1:234858553-234858575 CTAAAGGTGTTAGGGTGCTGGGG + Intergenic
923540289 1:234883933-234883955 GTGTATGTGTGTGTGTGTTGGGG - Intergenic
923625262 1:235608456-235608478 CTGAAGGTGTGGACGTGCTTTGG - Intronic
924218011 1:241845387-241845409 GTGCATGTGTGTGTGTGGTGGGG + Intergenic
1062794865 10:337130-337152 CTGTGTGTGTGTGTGTGTTGTGG + Intronic
1062794914 10:337546-337568 AGGAAGCTGTGTGTGTGCTGTGG + Intronic
1062794961 10:337993-338015 AGGAAGCTGTGTGTGTGCTGTGG + Intronic
1063447754 10:6130333-6130355 GTGAGTGTGTGTGTGTGGTGCGG + Intergenic
1064027841 10:11862986-11863008 CTGAAGATGTGTGTCTGCTTGGG - Intronic
1064274117 10:13891394-13891416 AAGTAGGTGTGTGTGTGCCGAGG + Intronic
1064801762 10:19083140-19083162 ATGAATGTGTGTGTGTGCAGGGG + Intronic
1064860395 10:19818515-19818537 TTGAAGGGGTGTGTGTGTTGGGG + Intronic
1065773941 10:29102185-29102207 CTGAGTGTGTGTGTGTGGGGCGG - Intergenic
1065861751 10:29877825-29877847 GTACAGGTGTGTGTGTGGTGGGG - Intergenic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1068906650 10:62333619-62333641 CTGTGTGTGTGTGTGTGTTGAGG + Intergenic
1069461110 10:68595586-68595608 CTGTGTGTGTGTGTGTGTTGTGG - Intronic
1069601073 10:69708506-69708528 CTGAAGGGTGGTGTGTGCAGAGG - Intergenic
1069617173 10:69813647-69813669 CTGCAGGGGCCTGTGTGCTGGGG - Intronic
1070396956 10:76019777-76019799 CTGAAGATGTGTTTGAGTTGAGG + Intronic
1070572521 10:77650813-77650835 CTGTCTGTGTGTGTGTGTTGGGG - Intergenic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1071275608 10:84051738-84051760 ATGCATGTGTGTGTGTGTTGAGG - Intergenic
1071447443 10:85761818-85761840 TTGAAAGTGTGTGTGTGTTTTGG - Intronic
1071957286 10:90772605-90772627 CTAAGTGTGTGTGTGTGGTGAGG + Intronic
1072499419 10:95998183-95998205 AGGGAGCTGTGTGTGTGCTGTGG - Intronic
1072923389 10:99595638-99595660 GTAGAGGTGTGTGTGTGTTGAGG - Intergenic
1073224342 10:101904327-101904349 GGGAATGTGTGTGTGTTCTGGGG - Intronic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1073595974 10:104800558-104800580 GGGAGGGTGTGTGTGTGTTGGGG + Intronic
1074115642 10:110455841-110455863 CGGAAGATGTGTGTGGCCTGGGG + Intergenic
1074845547 10:117394160-117394182 AGGAAGGTGTGTATGTGCTAGGG - Intergenic
1074990480 10:118701809-118701831 GTGAAATTGAGTGTGTGCTGGGG - Intronic
1075067074 10:119296288-119296310 CTGATGGAGGGTGTCTGCTGGGG - Intronic
1075241523 10:120783351-120783373 GTGTATGTGTGTGTGTGTTGGGG + Intergenic
1075262971 10:120978858-120978880 CTGAGGGTATGTGTGCGGTGGGG + Intergenic
1075944626 10:126421760-126421782 CTGACGGTGTGTGAGAGCTCTGG - Intergenic
1076124513 10:127963231-127963253 CTGCTGGTCTGTGTGTGGTGTGG - Intronic
1076761190 10:132606469-132606491 CTTCGCGTGTGTGTGTGCTGGGG + Intronic
1076777029 10:132703623-132703645 ATGAAGGTGCGCGTGTGTTGGGG - Intronic
1076777036 10:132703655-132703677 CTGCACGTGTGTGTGTGTGGGGG - Intronic
1076830424 10:132991688-132991710 CAGGAAATGTGTGTGTGCTGGGG + Intergenic
1076890396 10:133280553-133280575 CTGCGGCTGTGTGTGTCCTGTGG - Intronic
1077210568 11:1369324-1369346 GGGCATGTGTGTGTGTGCTGCGG + Intergenic
1077216989 11:1399060-1399082 CTGGAGGTGCCCGTGTGCTGTGG - Intronic
1077224473 11:1434150-1434172 CTGACCGTGTGGGTGTGCTCTGG - Intronic
1077372142 11:2187767-2187789 ATGTAGGTGTGTGTGTTGTGTGG - Intergenic
1077489541 11:2854265-2854287 GTGAAGGTGTGTGTGTGTGCAGG - Intergenic
1077718126 11:4601273-4601295 CTCAAGCTGTTTGTGTGCAGAGG + Intronic
1078702412 11:13699112-13699134 CAGAATGTGTGTGTGTGTTAGGG - Intronic
1079488709 11:20963338-20963360 CTAGAAGTGTGTGTGTGGTGAGG - Intronic
1079703284 11:23577374-23577396 CTGATGGTGTGTATTTCCTGAGG - Intergenic
1080640807 11:34157313-34157335 GGGAAGGCATGTGTGTGCTGTGG + Intronic
1080823082 11:35825549-35825571 CTGAGACTGTGTGTGTGCAGTGG - Intergenic
1081089709 11:38848267-38848289 GTTAATGTGTGTGTATGCTGAGG + Intergenic
1081602428 11:44504586-44504608 CAGAGGGTGTGTGTGTGTGGAGG - Intergenic
1081663650 11:44903763-44903785 AGGATGGTGTGTGTGTGATGGGG - Intronic
1081689666 11:45069305-45069327 CTGTATTTGTGTGTGTGATGTGG + Intergenic
1082834036 11:57639279-57639301 CTCGAGGTGTGTGTGTTCGGGGG + Intergenic
1082950138 11:58805901-58805923 CTGTAGGTGTGTGTGTGGGGGGG - Intergenic
1082950246 11:58807130-58807152 CTGAAAGTGTGTGTGGGATGGGG + Intergenic
1083020135 11:59498245-59498267 CTGCATGTGTGTGTGTGCCTGGG + Intergenic
1083188653 11:61033878-61033900 CTGCAGGTGAGTGAGCGCTGGGG + Intergenic
1083268502 11:61558551-61558573 ATGAGGGTGTGTGTTTGTTGGGG + Intronic
1083536242 11:63469025-63469047 CTGGTGGTGTGGGTGTGCAGAGG - Intronic
1083645470 11:64170002-64170024 TGGAAGGTGTGTATGTGTTGGGG + Intergenic
1084178480 11:67435289-67435311 ATGAAAGTGTGTGTCTGCTGGGG + Exonic
1084404685 11:68964485-68964507 CAGACTGTGTGTGTCTGCTGAGG + Intergenic
1085335342 11:75689047-75689069 ATGTGGGTGTGTGTGTGTTGGGG - Intergenic
1085376696 11:76069290-76069312 CTAAAGGTGTGTGTGTGTGCTGG + Intronic
1085481095 11:76823661-76823683 CTGTGTGTGTGTGCGTGCTGGGG - Intergenic
1085734304 11:79025862-79025884 GTGAATCTGTGTGTGTGCTACGG + Intronic
1085944360 11:81248890-81248912 GTGCAGGTGTGTGTCTGGTGAGG + Intergenic
1086590880 11:88512159-88512181 CTCTAGGTGAGTGTGTGATGAGG + Intronic
1086996960 11:93368988-93369010 CCGAGTGTGTGTGTGTGTTGGGG - Intronic
1087158389 11:94926231-94926253 AAGAAGGTGGGTGTGTGCAGGGG + Intergenic
1087327530 11:96741988-96742010 GAGTGGGTGTGTGTGTGCTGAGG - Intergenic
1087529198 11:99357488-99357510 CTTAGAGTGTGTGTGTGGTGGGG - Intronic
1088751652 11:112847166-112847188 GTGTATGTGTGTGTGTGTTGGGG + Intergenic
1088969364 11:114759043-114759065 GCGCACGTGTGTGTGTGCTGTGG - Intergenic
1089020913 11:115213729-115213751 TTGAATGTGTGTGTGTGAAGGGG - Intronic
1089043622 11:115479442-115479464 CTGAAGCTCTATGTGTGATGGGG - Intronic
1089318702 11:117610345-117610367 CTGGAGGTGTGAGTGTAATGTGG - Intronic
1090334513 11:125953703-125953725 TTGAATGCGTGTGTGTGGTGAGG + Intergenic
1090344607 11:126059524-126059546 GTGTATGTGTGTGTGTGCAGAGG - Intronic
1090456898 11:126857842-126857864 CTGCAGGTGGCTGTGTGCAGTGG + Intronic
1090918840 11:131190729-131190751 CTGAGGGTGGGAGTGGGCTGGGG + Intergenic
1090934975 11:131333217-131333239 CTGAAGTTGTGGCTGTGATGTGG - Intergenic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1091258285 11:134211159-134211181 GTTAAGGTGTGTTTGTTCTGAGG - Intronic
1091372446 11:135072404-135072426 CTGGGGGCTTGTGTGTGCTGAGG - Intergenic
1091615595 12:2048776-2048798 CAAGAGGTGTGTGTGTGCTAAGG + Intronic
1091763224 12:3101522-3101544 CTGGATGTGTGTGTAGGCTGGGG - Intronic
1091794789 12:3291891-3291913 CTGAGAGTGTGTGTGTACCGAGG - Intergenic
1092156691 12:6287093-6287115 CTCATGGTGTGTGTGTGGGGTGG - Intergenic
1092257306 12:6934360-6934382 CTGAGGGTGTGTGTGTGTTGTGG + Intronic
1095127981 12:38504556-38504578 CTGAAGTTCTGTGTGTGCCAGGG - Intergenic
1095248519 12:39950696-39950718 CCAAAGCTGTATGTGTGCTGAGG - Intronic
1095477190 12:42597333-42597355 CAGAAGTTGGGTATGTGCTGTGG - Intergenic
1095787143 12:46122278-46122300 CTGTGGGTGTGTGTATGGTGTGG + Intergenic
1095947086 12:47759416-47759438 CTCCCGGTGTGTGTGTGCTGGGG - Intronic
1096071580 12:48778307-48778329 GTGAATGTGTGTGTGTGTTTAGG - Intronic
1096135397 12:49195961-49195983 ATGCATTTGTGTGTGTGCTGGGG + Intronic
1096322133 12:50624285-50624307 CTTGAGGTGTGTGTTTGGTGAGG - Intronic
1096820359 12:54229025-54229047 CTGAATGTGAGTGTGTGCAGAGG - Intergenic
1098336786 12:69412790-69412812 CTGAAGATGGCTGTGTGATGAGG + Intergenic
1098808398 12:75051129-75051151 TAGAAGGAGTGTGTGTGGTGTGG - Exonic
1099348611 12:81535624-81535646 GTGTATGTGTGTGTTTGCTGTGG - Intronic
1099444839 12:82740491-82740513 GGGAAGGTCTGTGTGTGTTGTGG + Intronic
1101240704 12:102836000-102836022 GTGTATGTGTGTGTGTGTTGAGG + Intergenic
1102316115 12:111889036-111889058 CTGTGAGTGTGTGTGTGCAGGGG + Intronic
1102669410 12:114604663-114604685 CTGGAGGTGTGTGGTGGCTGTGG - Intergenic
1104066487 12:125311105-125311127 CAAAAGGTGGGTGTGTACTGGGG + Intronic
1104118041 12:125769230-125769252 GCGAAGGTGTGTGTTTTCTGGGG - Intergenic
1104360564 12:128129155-128129177 CTGAGTGTGTGTGTGTGGGGGGG - Intergenic
1104557806 12:129817731-129817753 TGTAAGGTGTGTGTGTGGTGTGG + Intronic
1104610738 12:130225667-130225689 GAGTGGGTGTGTGTGTGCTGGGG - Intergenic
1104854557 12:131895688-131895710 CTGAAGGTGAGCCAGTGCTGGGG + Exonic
1105968250 13:25404276-25404298 CTGGAGATGTGTGAGAGCTGGGG + Intronic
1106619424 13:31359132-31359154 CCTAAGGTGTGTGTGGGCGGTGG - Intergenic
1107356253 13:39570779-39570801 GTGAATGTGTGTGTGTGCATGGG + Intronic
1107386682 13:39917506-39917528 CTGTATGTGTGTGTGACCTGAGG + Intergenic
1107491005 13:40879854-40879876 CTAGTGGTGTGTGTGTCCTGTGG + Intergenic
1108038830 13:46320666-46320688 CTGCAGGGGTGTGTGTGGAGAGG - Intergenic
1108592179 13:51921920-51921942 GTGTATGTGTGTGTGTGTTGGGG + Intergenic
1108607091 13:52050588-52050610 ATGAAGGTGTGTGTGTGCTTTGG - Intronic
1108614546 13:52118814-52118836 GTGTTTGTGTGTGTGTGCTGGGG - Intronic
1109284966 13:60397966-60397988 CAGAAGTTGTGTGTGTGCCGCGG - Intronic
1110114012 13:71788585-71788607 AAGAAGGTGTGTGTGTGGGGGGG - Intronic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1112836693 13:103523525-103523547 CTGAAAGTTTGGGTGGGCTGTGG - Intergenic
1113327235 13:109293956-109293978 GTGTAGGTGTGTGTGTGTAGGGG - Intergenic
1113440901 13:110327167-110327189 ATGTAAGAGTGTGTGTGCTGGGG - Intronic
1113888493 13:113724427-113724449 CTGATGGGGTTTGTGTGCGGTGG + Intronic
1113947064 13:114050291-114050313 CAGAAGGTGTCTGAGTGCAGCGG - Intronic
1114044471 14:18711011-18711033 CTGAAGGTGTGTGTGTGGGGGGG - Intergenic
1114048756 14:18901462-18901484 CTGAAGGTGTGTGTGTGGGGGGG - Intergenic
1114113758 14:19500184-19500206 CTGAAGGTGTGTGTGTGGGGGGG + Intergenic
1114495502 14:23128801-23128823 CAGAAGGGATGTGTGTGGTGGGG + Intronic
1114542755 14:23474574-23474596 GTGAAAGTGTGTGTGTGTAGGGG - Intronic
1114730375 14:24986643-24986665 CTGGTGGTGTTTTTGTGCTGCGG - Intronic
1115473701 14:33794391-33794413 GTGTGAGTGTGTGTGTGCTGGGG - Intronic
1115850434 14:37585749-37585771 TTAAAAGTGTGTGTGTGTTGGGG + Intergenic
1115996632 14:39202165-39202187 CTAAGGGTGTGTGTGTGGTAAGG - Intergenic
1116681847 14:47981879-47981901 ATTTAGGTGTGTGTGTGTTGGGG + Intergenic
1116720542 14:48490165-48490187 TTGCAGGTGTGTGTGCTCTGTGG + Intergenic
1116860862 14:49994615-49994637 GTGTGCGTGTGTGTGTGCTGGGG + Intronic
1116961593 14:50973203-50973225 CCCCAGGTGTGTGTGTGCTTGGG + Intergenic
1117615632 14:57531171-57531193 CTACATGTGTGTGTGTGATGGGG + Intergenic
1117955438 14:61120043-61120065 CTAGGGGTGTGTGTGTCCTGTGG + Intergenic
1118620385 14:67609537-67609559 CTGAAGATGTGTGTGTGTTGGGG + Intergenic
1119676951 14:76562898-76562920 GTGAAGGTGTGTCTGTCCTCGGG - Intergenic
1120097758 14:80408295-80408317 CTCAAAGTGTGTGTGTGGGGTGG + Intergenic
1120269518 14:82293920-82293942 GTTAAGGGGTGTGTGTGTTGGGG + Intergenic
1121157283 14:91698113-91698135 CTAGGGGTGTGTGTGTGGTGGGG + Intronic
1121626185 14:95387074-95387096 CAGAGGGTGTGTGTGTGCAGTGG - Intergenic
1121626190 14:95387101-95387123 CAGAGGGTGTGTGTGTGCAGAGG - Intergenic
1121626195 14:95387128-95387150 CAGAGGGGGTGTGTGTGCAGAGG - Intergenic
1121626202 14:95387155-95387177 CAGAGGGTGTGTGTGTGCAGAGG - Intergenic
1122003999 14:98687357-98687379 ATAAATGTGTGTGTGTGTTGGGG - Intergenic
1122209892 14:100167246-100167268 TTGGGGGTGTGTGTGTGTTGGGG - Intergenic
1122209915 14:100167335-100167357 TTGGGGGTGTGTGTGTGTTGGGG - Intergenic
1122210039 14:100167847-100167869 GGGCAGGTGTGTGTGTGTTGGGG - Intergenic
1122210047 14:100167882-100167904 GTGAGTGTGTGTGTGTGTTGGGG - Intergenic
1122210050 14:100167904-100167926 GGGCAGGTGTGTGTGTGTTGGGG - Intergenic
1122291193 14:100681301-100681323 CTGAAGGAGTGCGTGGGTTGTGG + Intergenic
1122825919 14:104370396-104370418 TTGAAGGTGTGTGTTTGCTGTGG - Intergenic
1123054812 14:105564318-105564340 GTGAGGGTGTGTGTGGGGTGTGG + Intergenic
1123079250 14:105683864-105683886 GTGAGGGTGTGTGTGGGGTGTGG + Intergenic
1123093262 14:105751494-105751516 GGGAGTGTGTGTGTGTGCTGGGG + Intergenic
1123486857 15:20748416-20748438 CTGGAGGTGTGTGTGTGTGCAGG - Intergenic
1123783955 15:23650143-23650165 CAGAAGCTTTTTGTGTGCTGTGG - Intergenic
1123934485 15:25187500-25187522 CTGGATGGGTGTGTGTGGTGGGG + Intergenic
1124203205 15:27696196-27696218 GTGTATGTGTGTGTGTGGTGTGG - Intergenic
1124250778 15:28105366-28105388 GTGTGGGTGTGTGTGTGGTGTGG + Intergenic
1124250828 15:28105636-28105658 CTGTGGGGGTGTGTGTGGTGTGG + Intergenic
1124357697 15:29008954-29008976 CAGAGGGTGTGTATGTGCAGGGG + Intronic
1124371248 15:29106029-29106051 CTGAATGATTGTGTCTGCTGTGG + Intronic
1124469690 15:29972368-29972390 CTGAGAGGCTGTGTGTGCTGGGG - Intergenic
1124493404 15:30172009-30172031 CGGAAAGTGTGTGTGTGTGGGGG + Intergenic
1124750130 15:32366316-32366338 CGGAAAGTGTGTGTGTGTGGGGG - Intergenic
1125083785 15:35706066-35706088 CTGGAGGTGTGTGGGTGGAGAGG + Intergenic
1125287166 15:38105965-38105987 GTAAAGGTGTGTGTGCGGTGGGG - Intergenic
1125435381 15:39638838-39638860 GTGCATGTGTGTGTGTGGTGGGG + Intronic
1125894887 15:43293791-43293813 GTGCGGGTGTGTGTGTGCGGGGG + Intronic
1126740009 15:51768127-51768149 CAGAATGTGCGTGTGAGCTGAGG - Intronic
1127454860 15:59147790-59147812 CCAAGGGTGTGTGTGTGTTGGGG + Intronic
1127735255 15:61833471-61833493 CTGAAGGAGTGTGTGAGCCATGG - Intergenic
1127927894 15:63565226-63565248 TTGAGGGTGTGTGTGTTTTGGGG - Intronic
1128230315 15:66030123-66030145 CTGAATCTCTGTGTGTGCTCAGG - Intronic
1128678790 15:69631293-69631315 GTGCATGTGTGTGTGTGGTGGGG + Intergenic
1129184559 15:73897966-73897988 GAGAATGTGTGTGTGTGCTGGGG - Intergenic
1129936205 15:79452044-79452066 GTGAATGTGTGTGTGTGCAGAGG + Intronic
1130769819 15:86913182-86913204 GTGTATGTGTGTGTGTGGTGGGG - Intronic
1131806026 15:96123644-96123666 CTCACAGTGTGTGTGTGGTGGGG + Intergenic
1132296383 15:100737761-100737783 CTGTTGGTGTGTGTGTGTAGTGG - Intergenic
1202951665 15_KI270727v1_random:44599-44621 CTGGAGGTGTGTGTGTGTGCAGG - Intergenic
1132500188 16:281550-281572 CTGAAGGTCTGGGTGCGGTGCGG + Intronic
1132636881 16:954168-954190 CTGAAGATGGGTGGCTGCTGTGG + Intronic
1132806273 16:1776512-1776534 CCGAGTGTGTGTGTGTGTTGGGG - Intronic
1133569515 16:7027013-7027035 ATGGAGGAGTGTGTGGGCTGTGG - Intronic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134570636 16:15287917-15287939 CTGAAGATGTGTCTGTGGTTGGG - Intergenic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134731746 16:16468155-16468177 CTGAAGATGTGTCTGTGGTTGGG + Intergenic
1134872192 16:17662048-17662070 ATAAAGGTGTTTCTGTGCTGTGG - Intergenic
1134872524 16:17664866-17664888 ATAAAGGTGTTTCTGTGCTGTGG + Intergenic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135281797 16:21158997-21159019 GTGTATGTGTGTGTGTGTTGGGG - Intronic
1135620638 16:23952433-23952455 GTGTATGTGTGTGGGTGCTGGGG + Intronic
1135727618 16:24869264-24869286 AGTGAGGTGTGTGTGTGCTGGGG - Intronic
1135875687 16:26197980-26198002 ATGAAGGCGAGAGTGTGCTGTGG - Intergenic
1135918153 16:26624512-26624534 GTGTCTGTGTGTGTGTGCTGGGG - Intergenic
1136779462 16:32887218-32887240 CTCAAGGGGTGTGTGTGGTTGGG + Intergenic
1136876574 16:33863052-33863074 CTGCATGTGTGTGTGTGTGGGGG - Intergenic
1136891154 16:33974300-33974322 CTCAAGGGGTGTGTGTGGTTGGG - Intergenic
1137271868 16:46907551-46907573 CTGAAGGTCACTGTGTGCAGAGG + Intronic
1137365262 16:47854383-47854405 TTGGAGGTGTGTGTGTGTTGGGG - Intergenic
1137365270 16:47854455-47854477 TTGGAGGTGTGTGTGTGTTGGGG - Intergenic
1137704229 16:50522974-50522996 CAGACAGTGTGTGTGTGCTCAGG - Intergenic
1138595866 16:58028631-58028653 CTGAGGCTGTGTGGATGCTGGGG - Intronic
1139187158 16:64820401-64820423 CTGCAAGTGTGTGTGTGTTGGGG + Intergenic
1139748572 16:69094336-69094358 GTGAAGGTGTGTGTGTGTGGTGG - Intergenic
1139993455 16:70958548-70958570 CTGCAGGTGTGTTTGTGTAGGGG + Intronic
1140043559 16:71425183-71425205 GAGCAGGTGTGTGTGTGTTGGGG + Intergenic
1140328685 16:74030728-74030750 TGGAGGGTGTGTGTGTGTTGGGG - Intergenic
1141172885 16:81702252-81702274 CTGAAGGGGTGAGGGAGCTGGGG - Intronic
1141432636 16:83978578-83978600 GTGGGGGTGTGTGTGGGCTGTGG + Intronic
1141649045 16:85383319-85383341 GTCACGGTGTGTGTGTGCTGAGG - Intergenic
1141862301 16:86726126-86726148 AGGTAGGGGTGTGTGTGCTGGGG + Intergenic
1141941566 16:87279320-87279342 GTGACAGTGTGTGTGTGCTGGGG + Intronic
1203081878 16_KI270728v1_random:1149306-1149328 CTCAAGGGGTGTGTGTGGTTGGG + Intergenic
1142518379 17:448082-448104 CATAAGGTGTGTGTGTGTTGGGG + Intergenic
1142518384 17:448108-448130 CATAAGGTATGTGTGTGTTGGGG + Intergenic
1142518408 17:489088-489110 CATAAGGTGTGTGTGTGTTGGGG + Intergenic
1142617657 17:1145855-1145877 CTGCAGGTGTATGTGTGAAGGGG - Intronic
1142743249 17:1942477-1942499 CTGGAGGTGTGTGTGGGAAGTGG + Intronic
1142744085 17:1946564-1946586 GTGAATGTGTGTGTGTGCACGGG + Intronic
1142871437 17:2823635-2823657 CTGGATGTGTGTGTGAGCTGTGG - Intronic
1142954365 17:3511163-3511185 CTGAGGGTGTGTGTGTGCATGGG + Intronic
1142964753 17:3573534-3573556 CTGCAGGTGGGTGGGTGGTGGGG - Intronic
1143301895 17:5916648-5916670 CTGCAGGTGTGTGTCAGCTTAGG + Intronic
1143500676 17:7336835-7336857 GGAAAGGTGTGTGTGTGCTGGGG - Intronic
1144621584 17:16821888-16821910 CTTAAGGTGTCAGTGTCCTGGGG + Intergenic
1144884834 17:18450826-18450848 CTTAAGGTGTCAGTGTCCTGGGG - Intergenic
1145147390 17:20493551-20493573 CTTAAGGTGTCAGTGTCCTGGGG + Intergenic
1145249672 17:21290199-21290221 CAGGAGGTGTGTGGGGGCTGGGG + Intronic
1145275447 17:21426568-21426590 CTGGAGTAGGGTGTGTGCTGGGG + Intergenic
1145313300 17:21712462-21712484 CTGGAGTAGGGTGTGTGCTGGGG + Intergenic
1145365921 17:22266782-22266804 CTGCCGGTCTGTGTGTTCTGTGG + Intergenic
1145711749 17:26984417-26984439 CTGGAGTAGGGTGTGTGCTGGGG + Intergenic
1145714607 17:27008176-27008198 CTGAAGCTGCCTGTGTGCTGGGG + Intergenic
1145900015 17:28484571-28484593 ATGAGTGTGTGTGTGTGCTGGGG + Intronic
1146106433 17:30041761-30041783 CTGAAGGTGGGTGTGTGCTGTGG - Intronic
1146157925 17:30539548-30539570 CTGAATGTGTGTGTGTGTGGTGG - Intergenic
1146158515 17:30545500-30545522 CTGAAGGTGGGTGTGTGCTGTGG - Intergenic
1147157184 17:38549872-38549894 CTGAAGGTGTGTGTGTGGCATGG - Intronic
1147170201 17:38614029-38614051 GTGTGGGTGTGTGTGTGTTGTGG - Intergenic
1147326438 17:39671982-39672004 TTCAAAGTGTGTGTGTGCAGGGG - Exonic
1147588276 17:41665475-41665497 GTGTGGGTGTGTGTGTGTTGGGG - Intergenic
1147877484 17:43631963-43631985 CTGTAGGTGTGTGCGTTGTGTGG - Intergenic
1147976071 17:44248795-44248817 CTCAACATGTGTGTGTGGTGGGG - Exonic
1148217184 17:45839686-45839708 CTGCAGGTGTTGGTGAGCTGAGG - Intergenic
1149238524 17:54620889-54620911 CTGAAGGTATTTGTGTGGCGTGG + Intergenic
1149868493 17:60163316-60163338 CTGAGCTTGTGTGTGTGTTGGGG + Intronic
1150229964 17:63544404-63544426 ATGAACAGGTGTGTGTGCTGTGG + Exonic
1150354761 17:64473527-64473549 CTGGTGGTGGGTGTGTGCTGCGG - Intergenic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1151019867 17:70602533-70602555 CGGAAGTTCTCTGTGTGCTGTGG - Intergenic
1151534914 17:74733658-74733680 CTGAGGCTGTGTATGCGCTGTGG - Intronic
1152184289 17:78844421-78844443 ATGTATGTGTGTGTGTGTTGGGG - Intergenic
1152191898 17:78893241-78893263 GTGTAGGAGTGTGTGTGCAGGGG + Intronic
1152191917 17:78893343-78893365 GTGCAGGGGTGTGTGTGCAGGGG + Intronic
1152191921 17:78893367-78893389 GTGTAGGAGTGTGTGTGCAGGGG + Intronic
1152495806 17:80670671-80670693 CTGAATGCGTGTGTGGACTGCGG - Intronic
1152554820 17:81047764-81047786 CTGGGCCTGTGTGTGTGCTGTGG - Intronic
1152853274 17:82649465-82649487 CTGGCGGTCTGTGTGTCCTGGGG - Intergenic
1152924760 17:83081690-83081712 CTGCAGGTGTGTGTGTGTTGGGG - Intronic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1154345508 18:13540531-13540553 CTGGAGATGTGTTTATGCTGGGG + Intronic
1154466522 18:14647972-14647994 CAAAATGTGTGTGTGTGTTGGGG - Intergenic
1154946974 18:21171566-21171588 GTGCACGTGTGTGTGTGGTGGGG - Intergenic
1155156615 18:23163070-23163092 CTGAAGGTGGCTGTGTTGTGGGG + Intronic
1155325874 18:24664468-24664490 GTGAAGGTTTGTCTATGCTGTGG + Intergenic
1155453335 18:25985623-25985645 GTGGATGTGTGTGTGTGCAGTGG - Intergenic
1156088430 18:33437542-33437564 CTGAATGTGTGTGTGAACAGAGG - Intronic
1156261054 18:35445327-35445349 CTGTAGGGGTGTGTGTATTGTGG + Intronic
1156566752 18:38200050-38200072 CTGAATGAGAGTGTGTGCTTGGG + Intergenic
1156765003 18:40642081-40642103 GTGTAGGTGTGTGTGTGCTTGGG - Intergenic
1156993919 18:43443596-43443618 GTGTAGGTGTGTGTGTGCCTGGG + Intergenic
1157532216 18:48430531-48430553 TAGGATGTGTGTGTGTGCTGCGG - Intergenic
1157720635 18:49921303-49921325 CGAAAAGTGTGTGTGTGGTGGGG - Intronic
1158106576 18:53891440-53891462 CTAAGGGTGTATTTGTGCTGAGG - Intergenic
1158323360 18:56287826-56287848 GTGTATGTGTGTGTGTGGTGTGG - Intergenic
1158672494 18:59489320-59489342 CTGAGTGTCTGTGTCTGCTGAGG - Intronic
1158830483 18:61272115-61272137 ATGTATGTGTGTGTGTGTTGAGG - Intergenic
1159518338 18:69487227-69487249 CTGTGTGTGTGTGTGTGTTGGGG + Intronic
1159571537 18:70119656-70119678 GTAGAGGTGCGTGTGTGCTGAGG - Intronic
1159778370 18:72630544-72630566 CTGCATGTGTGTGTGTGTGGGGG - Intronic
1160433919 18:78831828-78831850 GTGTAGGTGTGTGTGTGTGGGGG - Intergenic
1160462819 18:79052277-79052299 CAGCAGGTGGGTGCGTGCTGCGG + Intergenic
1160843489 19:1156695-1156717 CTCAAGGTGCGTCTGCGCTGTGG - Intronic
1161160464 19:2758828-2758850 CTCAAGGTGCATGTGTGCTGGGG - Intronic
1161847010 19:6717932-6717954 CTGTATGTGTGTGTGTTGTGTGG + Intronic
1162320939 19:9970332-9970354 CTGTGGGTGAGTGTGTTCTGTGG + Intronic
1162819143 19:13212293-13212315 CTGCAGGTGTGTGTGTGTGGGGG + Intronic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1163466561 19:17471261-17471283 CTGAAGGTGTGAGTTTCCTCGGG + Intronic
1163637137 19:18442220-18442242 TTGAGGGTGGGTGTGTGTTGGGG - Intergenic
1163697971 19:18773540-18773562 CTGAAGCTGGGTCTGTCCTGGGG - Intronic
1163767137 19:19170068-19170090 CTAAAGGGGTGTGTGTCGTGGGG - Intronic
1163916517 19:20245164-20245186 CTAGGGGTGTGTGTGTCCTGTGG - Intergenic
1164614291 19:29657096-29657118 TTCCAGATGTGTGTGTGCTGTGG - Intergenic
1164694268 19:30231822-30231844 CTGTCTGTCTGTGTGTGCTGGGG + Intronic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1164944845 19:32284782-32284804 CATAAGATGTGTGTGTCCTGTGG - Intergenic
1165924796 19:39320473-39320495 GTGCAGGTGTGTGTGTGCGTGGG - Intergenic
1166053231 19:40273686-40273708 GGGAAGGTGTGTGTGTGGGGTGG - Intronic
1166551207 19:43667548-43667570 CTGGAGGGGTGTGTGGGTTGGGG + Intronic
1166678603 19:44754334-44754356 CTTGAGGTGTGTGTGTGTAGGGG - Intronic
1166766254 19:45253186-45253208 CTGATGGTGTGTGTGTGTGGGGG - Intronic
1167033505 19:46978965-46978987 TGGAAAGTGTGTGTGTGGTGGGG + Intronic
1167135182 19:47611389-47611411 CTGAAGGTGTGTGAGGAGTGGGG + Intronic
1167719126 19:51166761-51166783 CAGACAGTGTGTGTGTGCTAAGG + Intergenic
1167727125 19:51223897-51223919 CAGCATGTGTGTGTGTGGTGAGG + Intergenic
1168351727 19:55679929-55679951 CTGGAGGGGTGGGTGTGCAGAGG + Intronic
1168431313 19:56283206-56283228 GTGTACGTGTGTGTGTGCAGTGG - Intronic
1168504011 19:56917564-56917586 CTGAAGTTCAGTGTGTTCTGAGG - Intergenic
925145475 2:1580674-1580696 CTGGAGGTGGGACTGTGCTGCGG + Intergenic
925180124 2:1812092-1812114 CTGCAGGTGTGTCTGCGCTTTGG + Intronic
925817518 2:7767979-7768001 TTGGGGGTGTGTGTGTGTTGTGG - Intergenic
926209128 2:10856122-10856144 CTGCAGGTGTGTGTGTTGGGGGG + Intergenic
926453115 2:13030816-13030838 CTGCAGCTGGGTGTGTACTGGGG + Intergenic
926541816 2:14190106-14190128 AGGAAGATGTGTGTGTGTTGGGG - Intergenic
926790906 2:16570770-16570792 TTGTTGGTGTGTGTGTGGTGGGG - Intronic
927102346 2:19797882-19797904 AAGTAGGTGTGTGTGTGGTGGGG - Intergenic
927467145 2:23345858-23345880 ATGAAGGTGAGAGGGTGCTGAGG - Intergenic
927813533 2:26194206-26194228 CTGGAGAGGTCTGTGTGCTGTGG + Intronic
927895111 2:26776477-26776499 CTGAGGGTGTGTGTGGGCACAGG + Exonic
928220095 2:29396311-29396333 CTGAAGGTGGATGTGTCCTTGGG - Intronic
928245803 2:29626078-29626100 CTGATGGTGTGTGTGTGCTATGG + Intronic
928372160 2:30748072-30748094 CAGAAGTTGCGTGTGTGCCGGGG + Intronic
928397734 2:30955833-30955855 GTGATGGTGTGTGTGTGTTGGGG - Intronic
928791676 2:34964171-34964193 GTGCATGTGTGTGTGTGTTGAGG + Intergenic
928869492 2:35960081-35960103 CTGAAGGTGAATGTGGACTGTGG - Intergenic
929090843 2:38215804-38215826 CTGGGGCTGTGTGTGGGCTGGGG - Intergenic
929368227 2:41187984-41188006 TTAAAGATGTGTGTGTGCTGGGG - Intergenic
929752424 2:44729650-44729672 GAGAAGTTGTGTGTGTGCTAAGG + Intronic
930162426 2:48171681-48171703 CTAGACTTGTGTGTGTGCTGTGG + Intergenic
930429615 2:51257546-51257568 ATGTAAGTGTGTGTGTGGTGGGG + Intergenic
930552347 2:52851902-52851924 CTGGAGATGTGTTTGTGTTGCGG + Intergenic
932030772 2:68182083-68182105 CTGGTCGTGTGTGTGTGGTGGGG - Intronic
932110727 2:68997219-68997241 GTGTATGTGTGTGTGTGATGTGG + Intergenic
932413269 2:71559593-71559615 CTGTAGGGGTGGGGGTGCTGAGG - Intronic
932463864 2:71900851-71900873 CTGAAGGTTTGAGGGTCCTGGGG - Intergenic
932481444 2:72041884-72041906 GTGCAGGTGTGTGTGTGTTGGGG - Intergenic
932590645 2:73064725-73064747 CTGGGGGTATGAGTGTGCTGGGG - Intronic
932740998 2:74291035-74291057 CTGGAGGGGAGTGTTTGCTGTGG + Intronic
933006245 2:76999081-76999103 CTGTTGTTGTGTGTGTGTTGGGG + Intronic
933278383 2:80305702-80305724 CACAAGGTGTGTGTGTGGGGAGG - Intronic
933338604 2:80992961-80992983 GTGTATGTGTGTGTGTGGTGGGG + Intergenic
933861257 2:86471026-86471048 CAGAAGGTGTGTGTGTTTTAAGG + Intronic
933980741 2:87548836-87548858 CTGAATGTGTGTGTGTGTGTCGG + Intergenic
934054578 2:88241121-88241143 CTGAGTGTGTGTGTGTGGTCTGG + Intergenic
934656466 2:96118988-96119010 CTGAAGGTGTGTGTGTGCGGGGG - Intergenic
934713376 2:96529629-96529651 CTGGAGCTGTGTGTGTGCATGGG - Intergenic
934718675 2:96558067-96558089 CTGCAGGGGTTTGGGTGCTGTGG - Intergenic
934921488 2:98347853-98347875 ATGAAAGTGTGTATGTGTTGGGG - Intronic
936152852 2:110031113-110031135 CTGCAGGGGTGTGTGAGCTGGGG - Intergenic
936191828 2:110340299-110340321 CTGCAGGGGTGTGTGAGCTGGGG + Intergenic
936596240 2:113851037-113851059 CTATGGGTGTGTGTGTGTTGGGG + Intergenic
937287280 2:120761531-120761553 CAGAGGGGGTGTGTGTGCAGAGG + Intronic
937386391 2:121437481-121437503 CTGATTTTGTTTGTGTGCTGTGG + Intronic
937681967 2:124653920-124653942 CTGATTGTGTGTGTGTGGCGGGG - Intronic
938119642 2:128624529-128624551 CTGTATGTGTGCGTGTGGTGTGG - Intergenic
938119645 2:128624557-128624579 CTGTATGTGTGCGTGTGGTGTGG - Intergenic
938379115 2:130826804-130826826 GTGAACGTGTGTGGGGGCTGCGG - Intergenic
938743103 2:134251499-134251521 GAGAAGGTGTGTGTGTGGGGAGG + Intronic
939127520 2:138195075-138195097 GTGCATGTGTGTGTGTGTTGGGG - Intergenic
939500311 2:142975604-142975626 ATGCAGGCGAGTGTGTGCTGGGG - Intronic
939614489 2:144347259-144347281 CTGAAGGTATATATGTGCTGCGG - Intergenic
939997633 2:148934936-148934958 CTGCAGGTGTGTGTACGCAGGGG - Intronic
940678015 2:156748758-156748780 CTGAAGGAGTCATTGTGCTGGGG + Intergenic
940743103 2:157534840-157534862 CTGAAACTTTCTGTGTGCTGTGG - Intronic
941321552 2:164061952-164061974 GTGCATGTGTGTGTGTGCTAGGG - Intergenic
941657307 2:168157775-168157797 TTTTAGGTGTGTGTGTGCTGTGG - Intronic
941727993 2:168885267-168885289 CTGAAGGTGAGAGTATGCTGTGG - Intronic
941774805 2:169381409-169381431 CTAACAGTGTGTGTGTGTTGGGG - Intergenic
941901065 2:170678649-170678671 GAGAATGAGTGTGTGTGCTGTGG - Intergenic
941968823 2:171328099-171328121 CTGCAGGTGGGAGTGGGCTGGGG + Intronic
942223441 2:173793387-173793409 CTCCAGGTATGTGTGTGCTCTGG - Intergenic
943598332 2:189884540-189884562 CTGAATGTGTGTGTGTGGCTGGG - Intronic
943708713 2:191064751-191064773 CTGAAGTTTTGTGTTTCCTGTGG + Intronic
943751686 2:191515822-191515844 ATGAAGGTGTGTGGGTGGAGGGG + Intergenic
945824320 2:214701484-214701506 CTGAAGGTGTTTGGGTCATGTGG - Intergenic
946033163 2:216721201-216721223 GTGATGGTGTGTGTCTTCTGAGG + Intergenic
946404667 2:219485975-219485997 CTTTAGATGTGTGTGTGCTTGGG + Intronic
947791121 2:232870036-232870058 TGGGAGGTGTGTGTGTGTTGCGG + Intronic
947821669 2:233075760-233075782 CTGATGGGGTGTGTGTGGGGTGG + Intronic
948030693 2:234815061-234815083 GGGAATGTGTGTGTGTGTTGGGG - Intergenic
948121935 2:235537226-235537248 GTGAATGTGTGTGGGTGCAGGGG + Intronic
948230557 2:236346060-236346082 CTGAATGTCCGTGTGTGTTGGGG - Intronic
948271443 2:236676924-236676946 CTTAGGGTGTGTGTGTGCGGAGG + Intergenic
948290968 2:236824133-236824155 CTGGAGGTGGGTGTGTGCTGGGG + Intergenic
948316563 2:237031877-237031899 CTGGCGGTGTGTGTGTGAGGGGG - Intergenic
948494362 2:238337327-238337349 ATGCAGGTGTGTGAGTGGTGAGG + Intronic
948742964 2:240060252-240060274 CAGAGGGTGTGTGTGTGGGGGGG + Intergenic
948932982 2:241144076-241144098 CTGCAGGTGTGTGTGTGTGTGGG + Intronic
948985106 2:241516852-241516874 TTGGGGGTGTGTGTGTGTTGGGG - Intergenic
949043919 2:241861948-241861970 GAGATTGTGTGTGTGTGCTGGGG - Intergenic
949050876 2:241896653-241896675 GTGAAGGGGTGTGGGTGTTGGGG + Intronic
949050886 2:241896681-241896703 GTGAAGGGGTGTGGGTGTTGGGG + Intronic
949050905 2:241896738-241896760 GTGAAGGGGTGTGGGTGTTGGGG + Intronic
1168868496 20:1109071-1109093 GTGAGTGTGTGTGTGTGGTGGGG - Intergenic
1169632360 20:7647608-7647630 CTGAAGGTGGGTCTTTCCTGGGG + Intergenic
1169810355 20:9603500-9603522 CAGAAGCTGTATGTGAGCTGGGG - Intronic
1170076715 20:12427701-12427723 CTGAGGGTTTGTGATTGCTGTGG - Intergenic
1170112449 20:12820481-12820503 GTGTATGTGTGTGTGTGGTGGGG - Intergenic
1170346257 20:15390103-15390125 CTGAAGGAGTTTGTGGGCTGGGG - Intronic
1170428777 20:16259190-16259212 GGGAAGGTGTGTGTGTGTTTGGG - Intergenic
1170996318 20:21363103-21363125 CTAAAGCTATGTGTGTACTGCGG - Intronic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1171351724 20:24507644-24507666 CTGAAGGTCTGTGGGTGTGGGGG + Intronic
1171373198 20:24674839-24674861 CAGAAGGTGCGTGTGTGGAGTGG - Intergenic
1172105086 20:32512048-32512070 ATAAACGTGTGTGTGTGTTGTGG - Intronic
1172579409 20:36035002-36035024 ATGTGTGTGTGTGTGTGCTGGGG - Intergenic
1172937005 20:38627613-38627635 GTGTTGGTGTGTGTGTGTTGGGG + Intronic
1173145503 20:40520837-40520859 CAGAAGGTGTGTGTCTGTTTTGG - Intergenic
1173170736 20:40721598-40721620 CAGGAGGTGTATGTGTCCTGGGG + Intergenic
1173405946 20:42764913-42764935 CTGAGGCTGTGAGTGTTCTGGGG - Intronic
1173590142 20:44218471-44218493 AGGAAGCTGTGTGTGCGCTGAGG + Intergenic
1173726304 20:45300765-45300787 GTGAATGTCTGTGTGTGTTGTGG - Intronic
1174568378 20:51483610-51483632 CTGTGTGTGTGTGTGTGGTGGGG - Intronic
1174745325 20:53056651-53056673 CTGCAGCTGAGTGTGTGCTGGGG - Intronic
1175172563 20:57090803-57090825 GTGAAGGTGTGTGTGTGTGCGGG - Intergenic
1175172587 20:57090912-57090934 GTGGAGGTGTGTGTGGGCGGAGG - Intergenic
1175363897 20:58437665-58437687 GTACAGGTGTGTGTGTGCAGAGG + Intronic
1175494034 20:59400785-59400807 GTGAGTGTGTGTGTGTGCAGGGG - Intergenic
1175522242 20:59609356-59609378 TTGACGGTGTGTGGGTGATGAGG - Intronic
1175582388 20:60110775-60110797 CTGCAGGAGAGTTTGTGCTGTGG + Intergenic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175787130 20:61718766-61718788 GTGAGAGTGTGTGTGTGCAGGGG - Exonic
1175947264 20:62564723-62564745 CTGAGTGTGTGTGTGTGTTGGGG + Intronic
1176240656 20:64074433-64074455 CGGCTGGTGTGTGCGTGCTGGGG - Intronic
1176808071 21:13510622-13510644 CAAAATGTGTGTGTGTGTTGGGG + Intergenic
1177310621 21:19387466-19387488 TTTTAGGTGTGTGTGTGGTGCGG + Intergenic
1178032063 21:28539173-28539195 CTGAAGAAGTGTGTCTGATGTGG + Intergenic
1178663037 21:34522710-34522732 GTGTATGTGTGTGTGTGGTGGGG + Intronic
1178823169 21:35993326-35993348 GTGAGGGTGTGTGTGAGTTGGGG - Intronic
1179117160 21:38504024-38504046 ATGAGGGTGTGTGTGTGGGGGGG + Intronic
1179629981 21:42671210-42671232 TTGAAGCTGTGGGTGTGCAGCGG + Intronic
1179707138 21:43188005-43188027 CTCAGGGAGTGTGTGGGCTGGGG + Intergenic
1179769762 21:43605908-43605930 CTGGATGTGTGTGTGTGGTGTGG - Intronic
1179950907 21:44708397-44708419 CTAAGGGAGTGTGAGTGCTGGGG - Intronic
1180071330 21:45437353-45437375 CTGAGTGTGTGTGTGTGCGCAGG - Intronic
1180108513 21:45636314-45636336 GTGGTGGTGTGTGTGTGGTGTGG + Intergenic
1180467291 22:15624122-15624144 CTGAAGGTGTGTGTGTGGGGGGG - Intergenic
1180834946 22:18925246-18925268 CTATTGGTGTGTGGGTGCTGGGG - Intronic
1180950570 22:19718813-19718835 CTCAAGGTGCGTGTGTGGAGAGG + Intronic
1181024967 22:20122910-20122932 CTGAAGGTGTGTGGTGTCTGGGG + Intronic
1181025039 22:20123183-20123205 CTGAAGGTGTGTGGTGTCTGGGG + Intronic
1181068085 22:20316022-20316044 CTGAAGGGGTGTGGGGGCTCAGG - Intronic
1181082044 22:20422645-20422667 CTGCAGGCCTCTGTGTGCTGTGG + Intergenic
1181471212 22:23141367-23141389 CTGAAAGTGTGTGTGTGTGTCGG - Intronic
1181477404 22:23177274-23177296 GCAAAGGTGTGTGTGTCCTGTGG - Intergenic
1182272799 22:29166049-29166071 CATATGGTGTGTGTGTGGTGAGG - Intronic
1182711852 22:32328137-32328159 CAGTTGGTGTGTGTGTGCTGGGG - Intergenic
1182766067 22:32759638-32759660 CTGGGGGTGGGTGAGTGCTGGGG - Intronic
1183062184 22:35342998-35343020 GTGTAGATGTGTGTGTGGTGTGG - Intronic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1183731996 22:39623446-39623468 ATGAAAGTGTGTGTGTTGTGAGG + Intronic
1183774227 22:39952573-39952595 ATGTGGGTATGTGTGTGCTGAGG - Intronic
1184035778 22:41917433-41917455 AGGAAGGTGTGTGTGTGGTGGGG - Intergenic
1184264627 22:43340369-43340391 CTGAAAGTGTATATGTGTTGGGG - Intronic
1184540337 22:45119072-45119094 GTGTATGTGTGTGTGTGTTGTGG - Intergenic
1184755782 22:46515042-46515064 CTGAAGCTGAGGGGGTGCTGGGG - Intronic
1184946872 22:47809938-47809960 GTGTATGTATGTGTGTGCTGTGG + Intergenic
1203285035 22_KI270734v1_random:150545-150567 CTATTGGTGTGTGGGTGCTGGGG - Intergenic
949161151 3:883945-883967 GTGTGGGTGTGTGTGTGCAGGGG + Intergenic
949518317 3:4826875-4826897 CTGAAGGAGCTTGTGTGCTAAGG + Intronic
950181356 3:10915662-10915684 TTGAAGGGGTGGGTGTTCTGAGG + Intronic
951112264 3:18818469-18818491 CTGAAGGTGTGCGGGTGTGGCGG - Intergenic
951632286 3:24735168-24735190 GTGTATGTGTGTGTGCGCTGGGG - Intergenic
952005347 3:28836698-28836720 CTGTGTGTGTGTGTGTGTTGTGG + Intergenic
952100210 3:30002386-30002408 GTGTATGTGTGTGTGTGTTGGGG - Intronic
952179186 3:30900034-30900056 CTAAGTGTGTGTGTGTGTTGAGG + Intergenic
952236606 3:31486836-31486858 GTGAAGGGGTATGTGTGCAGGGG + Intergenic
952650558 3:35721845-35721867 CTGAATGTGTTTATGTCCTGTGG + Intronic
953879769 3:46685609-46685631 CTGAAGGAGTCTGTGAGCAGGGG + Exonic
954279150 3:49563593-49563615 CTGCAGCTGTGTGGGTTCTGTGG + Intronic
954411613 3:50373613-50373635 CTGAAGGGGGGGGGGTGCTGGGG + Intronic
954418155 3:50404204-50404226 GTGAAGGTGTGAGTGGGGTGAGG + Intronic
954424096 3:50434296-50434318 CTGAAGGTAGGTGTGTGTTTTGG - Exonic
954428296 3:50455179-50455201 CTTGGGGTGTGTGTGTGCAGGGG - Intronic
954850024 3:53592334-53592356 CTGAGAGTGTGTGTGTGTGGGGG + Intronic
954924496 3:54220600-54220622 CAGCAGGTGTGGGGGTGCTGAGG - Intronic
954994923 3:54872394-54872416 CTAAGAGTGTGTCTGTGCTGAGG + Intronic
956371786 3:68571077-68571099 TTGATGGTGAGTGTGTGCAGAGG + Intergenic
957612525 3:82486651-82486673 AAGAATGTGTGTGTGTGTTGGGG - Intergenic
958900745 3:99883508-99883530 GTGAATGTGTGTGTTGGCTGGGG + Intronic
959459180 3:106604020-106604042 CTAATGGTGTGTGTTTGCTGGGG + Intergenic
960446533 3:117756395-117756417 CTTTTGGTGTGTGTGTGTTGTGG - Intergenic
960524221 3:118691318-118691340 CAGAAGGGGTATGTGTGCTCCGG + Intergenic
961208943 3:125110395-125110417 GTGCAGGTGGGTGGGTGCTGGGG - Intronic
961402671 3:126658122-126658144 CTGAGGGTATATGAGTGCTGAGG + Intergenic
961809970 3:129516016-129516038 CTGTATGTGTGTGTGTGCAGGGG - Intronic
961810061 3:129516836-129516858 CTGTGTGTGTGTGTGTGCAGGGG - Intronic
961810079 3:129516984-129517006 CTGTGTGTGTGTGTGTGCAGGGG - Intronic
961810103 3:129517213-129517235 CTGTGTGTGTGTGTGTGCAGGGG - Intronic
963275837 3:143329239-143329261 GTGAAGGTGTGTATGTGTTTGGG + Intronic
963504775 3:146170342-146170364 ATGTATGTGTGTGTGTGTTGGGG - Intergenic
964382791 3:156114591-156114613 CTGAAGGTGTGTGTGAGAGGTGG + Intronic
964483584 3:157164765-157164787 AAAAAGGTGTGTGTGTGTTGGGG - Intergenic
964726059 3:159815501-159815523 CCGAAGGTGTGTCTGGGCTGTGG + Intronic
965664940 3:171083136-171083158 CTCAATGTGTGTGTGTGTTGAGG - Intronic
966351363 3:179035511-179035533 ATGATGGAGTGTGTGTGGTGTGG - Intronic
966591110 3:181683815-181683837 CTGGAAGAGTGTGTGTGGTGGGG - Intergenic
966761949 3:183427129-183427151 CTGAATGTGTGTCTTTACTGAGG + Intronic
966806000 3:183808099-183808121 CTGAAGGTGGGTGCCTGCAGGGG + Exonic
966917982 3:184595121-184595143 CAACAGGTGTGTGTGTGGTGGGG + Intronic
967089916 3:186126553-186126575 GTGATGGTGTTTGTGTGGTGCGG + Intronic
967295786 3:187963351-187963373 CTGCAAGTGTGTGTGCGCTCAGG - Intergenic
967889176 3:194352838-194352860 CAGTAGGTGTGAGTGTGTTGGGG + Intergenic
968490117 4:885566-885588 CCACAGGTGTGTGTGTGCTAGGG + Intronic
968518745 4:1026121-1026143 CTGCACGTGTGTGAGTGTTGAGG - Exonic
968889861 4:3362847-3362869 GTGAGGGTGTGTGTGTGCGAGGG + Intronic
968911399 4:3478540-3478562 CTGCAGGTTTGTGGGTTCTGTGG - Intronic
969061033 4:4435063-4435085 GTGCATGTGTGTGTGTGATGGGG + Intronic
969507009 4:7594390-7594412 CTGGCTATGTGTGTGTGCTGAGG - Intronic
969574170 4:8026850-8026872 CTGAGTGTGTGTGTCTGCAGTGG + Intronic
969574173 4:8026881-8026903 CTGAGTGTGTGTGTCTGCAGTGG + Intronic
969574176 4:8026912-8026934 CTGAGTGTGTGTGTCTGCAGTGG + Intronic
969574179 4:8026943-8026965 CTGAGTGTGTGTGTCTGCAGTGG + Intronic
970035404 4:11729315-11729337 ATGAAGGTGTGTGATTGATGTGG - Intergenic
970124526 4:12793891-12793913 CTGATGGAGGGTGGGTGCTGAGG - Intergenic
970553185 4:17204831-17204853 GTGAAGGGGTGTATGTGGTGGGG - Intergenic
972963602 4:44483967-44483989 TTGAATGTGTGTGTGTGTGGGGG + Intergenic
974489328 4:62544582-62544604 CTTGTGGTTTGTGTGTGCTGTGG + Intergenic
975666271 4:76738376-76738398 CTGAAACTGTGTGTCTACTGGGG - Intronic
978347710 4:107788843-107788865 CTGCATGTGTGTGTGTGCTCGGG - Intergenic
978865643 4:113506896-113506918 GTGTAGGTGTGTGTGTGTGGGGG - Intronic
978911680 4:114070846-114070868 CTGAAGGTGAATGTGTACTGGGG + Intergenic
979872856 4:125848001-125848023 GTGAATATGTGTGTGTCCTGTGG + Intergenic
979929983 4:126617845-126617867 CTGAAGGTGAGGGTGAGCTGGGG + Intergenic
981615136 4:146637999-146638021 GTGTATGTGTGTGTGTGTTGTGG + Intergenic
981772410 4:148325152-148325174 CAGAGTGTGTGTGTGTGGTGTGG + Intronic
981793053 4:148562092-148562114 CTGAAGGTGAGTCTGTGCCTGGG + Intergenic
982204579 4:152988328-152988350 CTCAGGGTGTGTGTGTGTTGAGG + Intergenic
983010277 4:162537945-162537967 CTGAAGTGGCGAGTGTGCTGAGG + Intergenic
983518228 4:168679052-168679074 GTGTAGGTGCGTGTGTGGTGGGG + Intronic
983919582 4:173332033-173332055 TGGAATGTGTGTGTGTGCTCAGG - Exonic
984054587 4:174910946-174910968 TTGAAGGTTTTGGTGTGCTGAGG + Intronic
984233493 4:177129502-177129524 CTGAAGATGTATGTATGCTGTGG + Intergenic
984323258 4:178221578-178221600 TTGAAGGTGTTTCTGTGGTGTGG - Intergenic
984521681 4:180809792-180809814 CAGAGGGTATGTGTGTGGTGGGG - Intergenic
985064440 4:186106299-186106321 GTGTGGGTGTGTGTGTGTTGAGG - Intronic
985140510 4:186834811-186834833 CGGAAGGTGTGTGTGTGCATGGG + Intergenic
985515976 5:344723-344745 GTGAGGCTGTGTGTGTGCGGGGG + Intronic
985589602 5:757705-757727 GTGCCGGTGTGTGTGAGCTGGGG + Intronic
985712783 5:1439305-1439327 CTGAAGATGTGTGTGGGGTGGGG + Intronic
986169662 5:5305309-5305331 GTGGATGTGTGTGTGTGGTGTGG - Intronic
986169679 5:5305431-5305453 GTGGATGTGTGTGTGTGGTGTGG - Intronic
986868721 5:12021099-12021121 CTCAATGTGTGTGTGTGTTTAGG + Intergenic
987105513 5:14634711-14634733 ATAGGGGTGTGTGTGTGCTGTGG - Intergenic
987105563 5:14635095-14635117 ATAGGGGTGTGTGTGTGCTGTGG - Intergenic
987105592 5:14635321-14635343 ACATAGGTGTGTGTGTGCTGTGG - Intergenic
987105610 5:14635489-14635511 CACATGGGGTGTGTGTGCTGTGG - Intergenic
987226132 5:15843309-15843331 GCAAATGTGTGTGTGTGCTGTGG - Intronic
988044390 5:25931291-25931313 CTAGAGATTTGTGTGTGCTGAGG + Intergenic
988052001 5:26042502-26042524 CTGAAGGTGAATGTATACTGGGG + Intergenic
988171086 5:27656969-27656991 CTGTGGGTGTGTGTTTGTTGGGG - Intergenic
988930202 5:36029688-36029710 CTGAAGGTGTTTATCTGCTTTGG + Intergenic
988988130 5:36640972-36640994 GTGTATGTGTGTGTGTGTTGGGG - Intronic
990130784 5:52580558-52580580 CTGAAGTTATGTGTTTACTGTGG - Intergenic
990426427 5:55694488-55694510 CTGTGTGTGTGTGTGTGGTGGGG + Intronic
990645465 5:57838748-57838770 CTGAGTGTGTGTTTGTGCTGAGG + Intergenic
990983235 5:61619984-61620006 CTGAAGCTGGGTGTATGCTGAGG - Intergenic
991224415 5:64252927-64252949 TTTGAGGTGTGTGTGTGCTGGGG - Intronic
991933747 5:71781877-71781899 TCGAATGTGTGTGTGTGGTGGGG - Intergenic
992307237 5:75454177-75454199 GTTAAGGTGTGGGGGTGCTGAGG + Intronic
992389501 5:76317438-76317460 GTGTATGTGTGTGTGTGTTGGGG - Intronic
992906345 5:81349580-81349602 CTGAAGGTGGGGCTGAGCTGTGG - Intronic
994041850 5:95267835-95267857 GGGAAGGTGTGTGTGTGTTGGGG - Intronic
994667590 5:102724997-102725019 GAGAATGTGTGTGTGTGGTGGGG - Intergenic
994682056 5:102900239-102900261 CTTAATGTGTGTGTGTGGGGGGG + Intronic
994722688 5:103399407-103399429 AAGGAGGTGTGTGTGTGGTGGGG + Intergenic
994767601 5:103938641-103938663 CAGATGGTGTGTCTGTGCTCTGG + Intergenic
996148436 5:120004888-120004910 GTGCAGGGGTGTGTGTGGTGGGG + Intergenic
996374421 5:122789424-122789446 GTGTATGTGTGTGTGTGGTGGGG - Intronic
996924736 5:128811171-128811193 CTGTAAGTGTGTGAGTGCCGTGG + Intronic
996928432 5:128857342-128857364 CTGAAAGTGTGTGTGTCTTAGGG - Intronic
998096688 5:139399822-139399844 TGGAAGGTGTGTGTGTCATGGGG - Intronic
998173414 5:139885702-139885724 CTGTGGGTGTGTGTGTGTGGTGG + Intronic
998406183 5:141876111-141876133 CCGAGTGTGTGTGTGTGTTGCGG + Intronic
998413316 5:141927625-141927647 CTGGAGATGTGTGTGTGCTGGGG + Intronic
998768983 5:145520450-145520472 AAGAAGGCTTGTGTGTGCTGTGG - Intronic
998786728 5:145719108-145719130 CTGAAGGTTTGTGTCTCCTGTGG - Intronic
998820959 5:146057360-146057382 CTTATTGTGTGTGTGTGTTGTGG - Intronic
998986853 5:147768064-147768086 CTGAAAGTGTGTGTGTGTGTAGG - Intronic
999320855 5:150614288-150614310 CTGCTGCTGTGTGTGTGGTGGGG - Intronic
999374247 5:151075904-151075926 GTGTAGGTGTGTGGGTGCTGTGG - Intronic
999442449 5:151612976-151612998 GTGTATGTGTGTGTGTGGTGGGG + Intergenic
999630451 5:153565597-153565619 CTGATGGTGGGAGGGTGCTGGGG - Intronic
999692264 5:154158255-154158277 TTGAATGTGTGTGTGTGAGGGGG - Intronic
999999225 5:157121076-157121098 CTGGGGGTGTGTGTCTCCTGGGG - Intronic
1001076214 5:168630008-168630030 CTTAAGGTATGTGTGGGCAGGGG - Intergenic
1001127026 5:169028973-169028995 CTGGAGGTGTGTGATGGCTGTGG + Intronic
1001503383 5:172256295-172256317 CTTAAGGTGTGTGTGTGTTGGGG - Intronic
1001961838 5:175884298-175884320 GAGATGGTGTGTGTGTGCGGGGG - Intergenic
1002103630 5:176869356-176869378 CTGCAGGAGTGTGTGAGCCGCGG + Intronic
1002819081 6:706961-706983 ATGCAGGTGTGTGTATGCAGGGG - Intergenic
1002926179 6:1606912-1606934 CTGTAGGAATGTGTGTGCTGGGG - Intergenic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003471573 6:6440401-6440423 CAGACTGTGTGTGTGTGTTGGGG - Intergenic
1003629946 6:7777757-7777779 ATAAAGGTGTGTTTGTGCAGAGG - Intronic
1004194471 6:13490693-13490715 GTGTATGTGTGTGTGTGTTGGGG - Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1005735864 6:28745382-28745404 GTGTATGTGTGTGTGTGTTGGGG + Intergenic
1006079860 6:31558913-31558935 TTGCAGGTGTGTGGGAGCTGTGG - Intergenic
1006137639 6:31905295-31905317 ATGATGGTGTGTATGTGCTTGGG + Intronic
1006280991 6:33053019-33053041 CTGAAGGGGAGTGTTTGGTGGGG - Intergenic
1006795717 6:36731136-36731158 GTGAATGTGTGTGTGTGTAGGGG - Intronic
1007165423 6:39825510-39825532 CTGCCAGTGTGTGTGTGTTGGGG + Intronic
1007394749 6:41571020-41571042 CTGGAAGTGGGTCTGTGCTGGGG - Intronic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007686856 6:43672173-43672195 ATGTTGGTGTGTGTTTGCTGAGG + Exonic
1007745283 6:44039674-44039696 CTGCCTGTGTGTGTGTGGTGGGG - Intergenic
1007769554 6:44181778-44181800 GTGTATGTGTGTGTGTGGTGTGG - Intronic
1007769558 6:44181856-44181878 GTGTATGTGTGTGTGTGGTGTGG - Intronic
1007769566 6:44182036-44182058 CTGTATGTGTGTGTGTGGTGTGG - Intronic
1007775555 6:44222701-44222723 AGGAAGGTGTGGGCGTGCTGAGG - Intronic
1007990932 6:46255256-46255278 GTGTATGTGTGTGTGTGTTGAGG + Intronic
1008617491 6:53240657-53240679 CTGCAGATGGGTGTGGGCTGGGG + Intergenic
1009530191 6:64803365-64803387 CTGAAGGTGTGTGTGTGGGGGGG + Intronic
1009535334 6:64875225-64875247 TTGTGTGTGTGTGTGTGCTGAGG + Intronic
1010021058 6:71160402-71160424 CTAAATGTGTCTTTGTGCTGGGG + Intergenic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1010388295 6:75307715-75307737 GTGTATGTGTGTGTGTGGTGTGG - Intronic
1010398832 6:75425504-75425526 GTGGAGCTGGGTGTGTGCTGAGG - Intronic
1011203982 6:84871935-84871957 CTGTATGTGTGTGTGTGCGGAGG + Intergenic
1011263551 6:85492353-85492375 ATGAAGGCATGTGTGTGCTCGGG - Intronic
1012632644 6:101491420-101491442 GTGAAGGTTTGTGTTTGCTTCGG - Intronic
1012797557 6:103781861-103781883 CTGGGGGTGTGTATGTTCTGCGG - Intergenic
1012912036 6:105128762-105128784 CTGAATGTTTGTTTGTGCTTAGG + Intronic
1013503343 6:110773828-110773850 GTCATTGTGTGTGTGTGCTGGGG - Intronic
1014452727 6:121599898-121599920 ATGTATGTGTCTGTGTGCTGTGG - Intergenic
1014564584 6:122932057-122932079 GTGTATGTGTGTGTGTGTTGTGG + Intergenic
1015838021 6:137443771-137443793 CTGAAGATGTGTCTATGGTGTGG + Intergenic
1017152920 6:151297198-151297220 GTGTATGTGTGTGTGTGTTGTGG + Intronic
1017182158 6:151564222-151564244 CTGATTGTGGGTGTGTGCAGCGG + Intronic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1018793639 6:167169517-167169539 GTTAAGTTGTGTGTGTCCTGAGG - Intronic
1018793642 6:167169550-167169572 GTTAAGTTGTGTGTGTCCTGAGG - Intronic
1019215301 6:170439181-170439203 CTGGAGGTGGGTGAGTGCTGAGG - Intergenic
1019254827 7:42697-42719 CTGCAGGAGTGTGTGTGCACGGG - Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1019633617 7:2063871-2063893 CTGCAGGATTGTGTGTGCTGAGG - Intronic
1019704338 7:2490347-2490369 CTGAGGCTGGGTGTGGGCTGGGG - Intergenic
1020154494 7:5711381-5711403 CAAAAGGTGTGTGTGTGGGGAGG + Intronic
1020465714 7:8476387-8476409 CAAAAGGCATGTGTGTGCTGGGG - Intronic
1021279815 7:18703871-18703893 CTGAATGTGTGCCTGTGTTGTGG - Intronic
1021434988 7:20603915-20603937 TTGCATGTGTGTGTGTGCTGGGG - Intergenic
1021647601 7:22801932-22801954 TTGAAGGTGTGGTTTTGCTGGGG - Intergenic
1021862719 7:24923039-24923061 CTGATTCTGTGTGTGTGTTGGGG - Intronic
1022752646 7:33246797-33246819 GTGAATATGTGTGTGTGTTGGGG + Intronic
1022818509 7:33936050-33936072 CTGCAGGTGTGTGTGTGTGTGGG - Intronic
1023194612 7:37621432-37621454 CTGTATGTGTATGTGTGCTGGGG + Intergenic
1023259733 7:38346128-38346150 GTAAATGTGTGTGTGTGTTGGGG + Intergenic
1023766064 7:43511884-43511906 CTGGCAGTGTGTGGGTGCTGTGG + Intronic
1023906306 7:44524234-44524256 CTGTTGGTGTTTCTGTGCTGGGG - Intronic
1024045167 7:45580782-45580804 CAGGAGGTGGGAGTGTGCTGGGG + Intronic
1024084648 7:45883282-45883304 CTGTGTGTGTGTGTGTGTTGGGG - Intergenic
1024231377 7:47366551-47366573 CTTCAGGTCTGAGTGTGCTGTGG - Intronic
1024387826 7:48773781-48773803 ATGAAGGTGAATGTGTGATGAGG - Intergenic
1026015047 7:66666060-66666082 GGGAAGGTGGTTGTGTGCTGGGG + Intronic
1026227516 7:68455642-68455664 CTGAATGTGTGTGCGTGTGGTGG - Intergenic
1026582857 7:71632568-71632590 CTGTGGGTCTGTGTGTGTTGGGG + Intronic
1026891450 7:73985207-73985229 GGGAAGGTGGTTGTGTGCTGGGG + Intergenic
1027420265 7:78011735-78011757 CTCCTGGTGTGTGTGTGGTGAGG - Intergenic
1029538776 7:101171167-101171189 GTGGTGGTGTGTGTGTGGTGTGG - Exonic
1029655141 7:101919192-101919214 CAGCAGGTGTGTGTGTGTGGGGG + Intronic
1029728018 7:102420958-102420980 CTGCTGGTGTGTGTGTGGTCTGG - Intronic
1030511092 7:110482734-110482756 AGGAATGTGTGTGTGTGGTGGGG - Intergenic
1032080476 7:128856185-128856207 CTGATGGGCTGTGTGGGCTGGGG - Intronic
1032239824 7:130151920-130151942 CTTGTGGTGTGTGTGTGATGTGG - Intergenic
1032388494 7:131540575-131540597 CTGGAAGTGTGTGTGTGCCTGGG - Intronic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1033030553 7:137821867-137821889 CTGAAGGTGAGGGTGTGAGGAGG + Intronic
1033657958 7:143386000-143386022 GTGAGTGTGTGTGTGTGGTGTGG + Intronic
1033767193 7:144506520-144506542 CTAAAGTTGTGTGTGTGTCGGGG - Intronic
1034068680 7:148161546-148161568 CTGAAGTTGTGTGTGTGTATGGG - Intronic
1034341484 7:150359464-150359486 CGGATTGTGTGTGTGTGGTGGGG - Intergenic
1034348004 7:150398673-150398695 CCCAAGGTGTGTGTGTGGTTGGG + Intronic
1034454845 7:151163238-151163260 CTGACGGTTTGTGTGAGCTCTGG - Intronic
1035137105 7:156714643-156714665 GTGCATGTGTGTGTGTGGTGGGG + Intronic
1035283169 7:157789971-157789993 ATGGTGGTGTGTGTGTGGTGGGG + Intronic
1035303550 7:157915457-157915479 CTGGATGTGTGTGTGTGTGGCGG - Intronic
1035386423 7:158475735-158475757 CTCCAGGTGTGTGTGTGCCTTGG - Intronic
1036016027 8:4785615-4785637 CTGAGTCTGTGTGTGAGCTGAGG - Intronic
1036227070 8:6968472-6968494 GTTCAGGTGTGTGTGTGATGGGG - Intergenic
1036228213 8:6978094-6978116 GTTCAGGTGTGTGTGTGATGGGG - Intronic
1036230666 8:6997211-6997233 GTTCAGGTGTGTGTGTGATGGGG - Intronic
1036233110 8:7016314-7016336 GTTCAGGTGTGTGTGTGATGGGG - Intronic
1036529402 8:9569272-9569294 CTTATGATGTGTGTGTGCTATGG - Intronic
1036617517 8:10400062-10400084 CTAAAGGTGTGTGTGTGTGAAGG + Intronic
1036706778 8:11052532-11052554 GTGAAGGGATGGGTGTGCTGAGG + Intronic
1036786925 8:11693931-11693953 GTGCATGTGTGTGTGTGTTGAGG + Intronic
1037501863 8:19494304-19494326 CCAAAGATGTGTGTGTGTTGTGG - Intronic
1037509157 8:19563988-19564010 CTGAAGGAGTAGGTGTGGTGTGG - Intronic
1037569816 8:20148723-20148745 CTTAAGGGGTGAGTGTCCTGGGG - Intronic
1037886152 8:22597465-22597487 CTGGAGGGGAGTGTGTGTTGGGG + Intronic
1038270407 8:26070325-26070347 CTTAAGTTGTGTGTGGGTTGTGG + Intergenic
1038271155 8:26077203-26077225 ATATAGGGGTGTGTGTGCTGGGG - Intergenic
1038347827 8:26748286-26748308 GAGAATGTGTGTGTGTGTTGGGG + Exonic
1038368907 8:26968223-26968245 CTTGAGGTGTGTGTGTGCGTGGG - Intergenic
1038473336 8:27843802-27843824 CAGAAGTTGTGGGTGTCCTGGGG - Intergenic
1039232935 8:35468896-35468918 CTGAGGGTGTGGGAGTGCTTGGG + Intronic
1039847273 8:41334414-41334436 CTGAGTATGTGTGTGTGGTGGGG + Intergenic
1039917027 8:41867618-41867640 CTGATGGTGTGTGTGTGGCATGG - Intronic
1040474431 8:47764204-47764226 GTGATGGGGTGTGTGTGGTGTGG + Intergenic
1040967444 8:53098636-53098658 CAGAAGGTTTGTGTGTGGTAAGG + Intergenic
1041330968 8:56724572-56724594 CTGAATGTGTGTGAGTGTTTAGG - Intergenic
1041627658 8:60048978-60049000 CTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1041728323 8:61039418-61039440 CTGAAGGAGCCTGTGTGCTCTGG - Intergenic
1041973268 8:63767828-63767850 CTGAGTGTGTGTGTGTGGTGGGG + Intergenic
1042464685 8:69114793-69114815 CTGCAGGTATGTCTGTGCTTAGG - Intergenic
1042657297 8:71113756-71113778 ATGTATGTGTGTGTGTGTTGGGG + Intergenic
1042953040 8:74220615-74220637 CTGAGGGTATGTGTGTGGTGGGG + Intergenic
1043157319 8:76800064-76800086 GTGAGTGTGTGTGTGTGTTGTGG + Intronic
1044727924 8:95208166-95208188 CCGAGGGTGTGTGTGTGTGGGGG + Intergenic
1044853377 8:96451044-96451066 CCCAAGGTGTGTGTGTGTGGTGG + Intergenic
1045022461 8:98055542-98055564 CAGAAGGTATGTGTGGGTTGCGG - Intergenic
1045038947 8:98202452-98202474 AGGAAGGTGTGTGGGTCCTGAGG + Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1046996326 8:120527986-120528008 GTGTATGTGTGTGTGTGGTGAGG + Intronic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1048047212 8:130784121-130784143 GTGTATGTGTGTGTGTGTTGGGG + Intronic
1048161387 8:132024873-132024895 CTGAAGGTGTGTGGAAGATGGGG - Intronic
1048463369 8:134641244-134641266 CTGAATGTGTGTGTGTGTGCAGG - Intronic
1049130841 8:140839130-140839152 GTGTTAGTGTGTGTGTGCTGGGG - Intronic
1049256666 8:141617769-141617791 CTGCAGGTGTGTGTGTCCCTGGG + Intergenic
1049256686 8:141617851-141617873 CTGTAGGTGTGTGTGTCCCTGGG + Intergenic
1049272241 8:141702211-141702233 TTGTAGGTGTGTGTGTGTTGGGG + Intergenic
1049473811 8:142787797-142787819 CTGAAGGTGAGTGGGAGCCGGGG + Intergenic
1049569314 8:143360997-143361019 CTGCATGTGTGTGCGTGGTGGGG + Intergenic
1049802374 8:144523945-144523967 CTGCGGGAGTGGGTGTGCTGGGG - Exonic
1050072181 9:1826947-1826969 GTGCATGTGTGTGTGTGTTGGGG - Intergenic
1050919119 9:11177759-11177781 CTGAAGGTAAGTTTGTGATGTGG + Intergenic
1051049669 9:12916150-12916172 CTGAAGATTTGTGTGTCCTTAGG + Intergenic
1052846843 9:33344323-33344345 CTGAAGGTGGGTCTGTGATCTGG + Intronic
1053015053 9:34657144-34657166 CTACAGGTGTGTGTGTGATTGGG + Exonic
1053056639 9:34996879-34996901 CAGGCTGTGTGTGTGTGCTGGGG + Intronic
1053261234 9:36666905-36666927 GTGATGGTGTGTGTGTGGGGGGG + Intronic
1053652788 9:40186230-40186252 CTCAAGGTGTCTGTGAGGTGGGG + Intergenic
1053903192 9:42815537-42815559 CTCAAGGTGTCTGTGAGGTGGGG + Intergenic
1054531793 9:66189991-66190013 CTCAAGGTGTCTGTGAGGTGGGG - Intergenic
1056252218 9:84761296-84761318 CTTAAGGGGTGAGGGTGCTGTGG + Intronic
1056688532 9:88786315-88786337 CTGAAGGTGGGAGTGGGCAGAGG + Intergenic
1056823608 9:89861422-89861444 CTGCAGGTGGGTCTGTGCAGAGG - Intergenic
1057698843 9:97348539-97348561 CTGAAGTTGTGGAAGTGCTGTGG - Intronic
1058072102 9:100611703-100611725 CTAAGGGTGTGTGTGTGTTTGGG + Intergenic
1058874738 9:109234171-109234193 CTGGGGGTGTCTGTGAGCTGGGG + Intronic
1059343357 9:113612158-113612180 CTGCAGGTGTGTGTGTGGTGTGG + Intergenic
1059653022 9:116333183-116333205 CTCAAGGTGAGTGAGTGGTGGGG - Intronic
1059838127 9:118180215-118180237 CTGAATGAGTGTGGGTACTGAGG + Intergenic
1059875988 9:118635409-118635431 CTGTGTGTGTGTGTGTGTTGTGG - Intergenic
1060176372 9:121499943-121499965 GTGAGAGTGTGTGTGTGCCGGGG + Intergenic
1060195405 9:121620391-121620413 TTAAAGGTGTGTGTGAGCTCTGG + Intronic
1060937291 9:127522847-127522869 CTGAGGGTGTGTGTGTGTTGGGG - Intronic
1061013240 9:127967599-127967621 CCGAAGCTCTGTGTTTGCTGTGG - Intronic
1061039345 9:128130849-128130871 CTGCAGGTGGGTCTGTGCAGAGG + Intergenic
1061485633 9:130919280-130919302 ATGAATGTGTGTGTGCTCTGAGG + Intronic
1061589053 9:131586725-131586747 CTGCAGGTGTGTGTGTGAGACGG - Intronic
1061589055 9:131586757-131586779 CTGCAGGTGTGTGTGTGAGACGG - Intronic
1062032638 9:134368850-134368872 GTGAAAGTGTGTGAGTGCAGGGG + Intronic
1062267037 9:135691553-135691575 CTGCAGTTGTGTGTGTGCATGGG - Intergenic
1062629218 9:137456192-137456214 CTGACTGTGTGTGTGTGGGGGGG + Intronic
1185650201 X:1642091-1642113 CTGTGTGTGTGTGTGTGATGGGG + Intronic
1185688045 X:1945982-1946004 ATGAAGGGGTGTGTGTGCAGGGG - Intergenic
1186163375 X:6801572-6801594 TGGAAGGTGTGTGTGTGGCGAGG - Intergenic
1186562764 X:10630518-10630540 CTGAGGGTGTATGTGTGCGGGGG + Intronic
1187216297 X:17280385-17280407 ATAGAGGTGTGTGTGTGGTGGGG - Intergenic
1187414910 X:19085102-19085124 TTGCAGCTGTGTGTGTGGTGGGG + Intronic
1188977092 X:36688898-36688920 CTAAAAGTGTGTGTGTGTTGGGG - Intergenic
1189273896 X:39771032-39771054 CTGATGGGGTGTGTGAGGTGAGG - Intergenic
1189373229 X:40446390-40446412 CAGAAGGTGTATTTGAGCTGAGG - Intergenic
1189825959 X:44917387-44917409 CTCAAGGTATGTGTGTGTTGAGG - Intronic
1190265281 X:48824334-48824356 CAGAAGGGGTGTGTGTGTGGGGG - Intronic
1190438673 X:50453967-50453989 CTGAAGGTGTGAGAGAACTGGGG - Intronic
1191108230 X:56785589-56785611 CTGATGGTGTGTGCGGGATGGGG + Intergenic
1192486489 X:71531668-71531690 TAGTAGGTGTGTGTGTGCGGGGG + Intronic
1193216561 X:78871112-78871134 CTGAAGTTGGCTGGGTGCTGTGG - Intergenic
1194221642 X:91200482-91200504 CAGAAGGTTTCTGTGTCCTGAGG - Intergenic
1194488138 X:94512090-94512112 CTTAATGTGTATGTGTGCAGAGG - Intergenic
1195003414 X:100664341-100664363 CTGTACATGTGTGGGTGCTGGGG - Intronic
1195008292 X:100709171-100709193 CTGAGGCAGTGTGTGAGCTGTGG + Intronic
1195293292 X:103449912-103449934 CTGAGGGTGTGGGTGCTCTGTGG + Intergenic
1195860578 X:109378640-109378662 CTGCTTGTGTGTGTATGCTGGGG + Intronic
1196172983 X:112610255-112610277 CTGAATGTGAGTGTGTGCATAGG - Intergenic
1196651367 X:118171674-118171696 GTGTATGTGTGTGTGTGATGGGG - Intergenic
1197274564 X:124463080-124463102 CTGGATTTGTGTGTGTGGTGGGG - Intronic
1197731673 X:129815896-129815918 GTGCATGTGTGTGTGTGGTGAGG - Intronic
1197908523 X:131454077-131454099 TTTAAGATGTGTGTGTGGTGCGG + Intergenic
1198158181 X:133983502-133983524 CTGCAGGAGTGTGTGTGTAGAGG + Intronic
1198480751 X:137037678-137037700 ATGAATGTGTGTGTGTGTGGTGG + Intergenic
1198602073 X:138294895-138294917 TTGATTGTGTGTGTGTGGTGTGG - Intergenic
1198823348 X:140673061-140673083 TTCAAGGTGTGTGTGTGGTTGGG + Intergenic
1200100293 X:153686780-153686802 CTCAAGGGGTGTGTGTGGTTGGG - Intronic
1200558157 Y:4664238-4664260 CAGAAGGTTTCTGTGTCCTGAGG - Intergenic