ID: 905974907

View in Genome Browser
Species Human (GRCh38)
Location 1:42167861-42167883
Sequence CCGCACTCCCGAACTTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974907_905974917 25 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974917 1:42167909-42167931 GGGGCTTGCGGAGACCGGAGCGG No data
905974907_905974911 5 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974911 1:42167889-42167911 CTCCATGCTAGACTGGAGCCGGG No data
905974907_905974909 -2 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974909 1:42167882-42167904 GGCTGAGCTCCATGCTAGACTGG No data
905974907_905974919 27 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974919 1:42167911-42167933 GGCTTGCGGAGACCGGAGCGGGG No data
905974907_905974910 4 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974910 1:42167888-42167910 GCTCCATGCTAGACTGGAGCCGG No data
905974907_905974912 6 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974912 1:42167890-42167912 TCCATGCTAGACTGGAGCCGGGG No data
905974907_905974914 13 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974914 1:42167897-42167919 TAGACTGGAGCCGGGGCTTGCGG No data
905974907_905974915 20 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG No data
905974907_905974918 26 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974918 1:42167910-42167932 GGGCTTGCGGAGACCGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974907 Original CRISPR CCGCACTCCCGAACTTCTCC CGG (reversed) Intergenic
No off target data available for this crispr