ID: 905974913

View in Genome Browser
Species Human (GRCh38)
Location 1:42167891-42167913
Sequence GCCCCGGCTCCAGTCTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974913_905974925 9 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974925 1:42167923-42167945 CCGGAGCGGGGTTGGGATTGGGG No data
905974913_905974923 8 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974923 1:42167922-42167944 ACCGGAGCGGGGTTGGGATTGGG No data
905974913_905974922 7 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974922 1:42167921-42167943 GACCGGAGCGGGGTTGGGATTGG No data
905974913_905974917 -5 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974917 1:42167909-42167931 GGGGCTTGCGGAGACCGGAGCGG No data
905974913_905974927 19 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974927 1:42167933-42167955 GTTGGGATTGGGGTCAATTCGGG No data
905974913_905974919 -3 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974919 1:42167911-42167933 GGCTTGCGGAGACCGGAGCGGGG No data
905974913_905974926 18 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974926 1:42167932-42167954 GGTTGGGATTGGGGTCAATTCGG No data
905974913_905974915 -10 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG No data
905974913_905974918 -4 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974918 1:42167910-42167932 GGGCTTGCGGAGACCGGAGCGGG No data
905974913_905974921 2 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974921 1:42167916-42167938 GCGGAGACCGGAGCGGGGTTGGG No data
905974913_905974920 1 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974920 1:42167915-42167937 TGCGGAGACCGGAGCGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974913 Original CRISPR GCCCCGGCTCCAGTCTAGCA TGG (reversed) Intergenic
No off target data available for this crispr