ID: 905974915

View in Genome Browser
Species Human (GRCh38)
Location 1:42167904-42167926
Sequence GAGCCGGGGCTTGCGGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905974913_905974915 -10 Left 905974913 1:42167891-42167913 CCATGCTAGACTGGAGCCGGGGC No data
Right 905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG No data
905974907_905974915 20 Left 905974907 1:42167861-42167883 CCGGGAGAAGTTCGGGAGTGCGG No data
Right 905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905974915 Original CRISPR GAGCCGGGGCTTGCGGAGAC CGG Intergenic
No off target data available for this crispr