ID: 905975709

View in Genome Browser
Species Human (GRCh38)
Location 1:42172230-42172252
Sequence TAGGGGAATTTGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905975709_905975715 -10 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data
905975709_905975718 -6 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975709_905975723 22 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975723 1:42172275-42172297 CTATCAAGTCATCAAATTTGAGG No data
905975709_905975716 -7 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975716 1:42172246-42172268 TCCCCTATCCTAGTGGGAGGAGG No data
905975709_905975721 -1 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905975709 Original CRISPR TAGGGGAATTTGCAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr