ID: 905975715

View in Genome Browser
Species Human (GRCh38)
Location 1:42172243-42172265
Sequence AATTCCCCTATCCTAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905975706_905975715 16 Left 905975706 1:42172204-42172226 CCCAGCTACAATCCAGGCAAGCG No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data
905975704_905975715 24 Left 905975704 1:42172196-42172218 CCTGTGAACCCAGCTACAATCCA No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data
905975708_905975715 4 Left 905975708 1:42172216-42172238 CCAGGCAAGCGTCTCCCTCCTCC No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data
905975709_905975715 -10 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data
905975707_905975715 15 Left 905975707 1:42172205-42172227 CCAGCTACAATCCAGGCAAGCGT No data
Right 905975715 1:42172243-42172265 AATTCCCCTATCCTAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905975715 Original CRISPR AATTCCCCTATCCTAGTGGG AGG Intergenic
No off target data available for this crispr