ID: 905975718

View in Genome Browser
Species Human (GRCh38)
Location 1:42172247-42172269
Sequence CCCCTATCCTAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905975711_905975718 -10 Left 905975711 1:42172234-42172256 CCTCCTGCAAATTCCCCTATCCT No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975704_905975718 28 Left 905975704 1:42172196-42172218 CCTGTGAACCCAGCTACAATCCA No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975706_905975718 20 Left 905975706 1:42172204-42172226 CCCAGCTACAATCCAGGCAAGCG No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975708_905975718 8 Left 905975708 1:42172216-42172238 CCAGGCAAGCGTCTCCCTCCTCC No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975710_905975718 -7 Left 905975710 1:42172231-42172253 CCTCCTCCTGCAAATTCCCCTAT No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975709_905975718 -6 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data
905975707_905975718 19 Left 905975707 1:42172205-42172227 CCAGCTACAATCCAGGCAAGCGT No data
Right 905975718 1:42172247-42172269 CCCCTATCCTAGTGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905975718 Original CRISPR CCCCTATCCTAGTGGGAGGA GGG Intergenic
No off target data available for this crispr