ID: 905975721

View in Genome Browser
Species Human (GRCh38)
Location 1:42172252-42172274
Sequence ATCCTAGTGGGAGGAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905975706_905975721 25 Left 905975706 1:42172204-42172226 CCCAGCTACAATCCAGGCAAGCG No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975712_905975721 -8 Left 905975712 1:42172237-42172259 CCTGCAAATTCCCCTATCCTAGT No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975711_905975721 -5 Left 905975711 1:42172234-42172256 CCTCCTGCAAATTCCCCTATCCT No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975709_905975721 -1 Left 905975709 1:42172230-42172252 CCCTCCTCCTGCAAATTCCCCTA No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975708_905975721 13 Left 905975708 1:42172216-42172238 CCAGGCAAGCGTCTCCCTCCTCC No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975707_905975721 24 Left 905975707 1:42172205-42172227 CCAGCTACAATCCAGGCAAGCGT No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data
905975710_905975721 -2 Left 905975710 1:42172231-42172253 CCTCCTCCTGCAAATTCCCCTAT No data
Right 905975721 1:42172252-42172274 ATCCTAGTGGGAGGAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905975721 Original CRISPR ATCCTAGTGGGAGGAGGGAG TGG Intergenic
No off target data available for this crispr