ID: 905976768

View in Genome Browser
Species Human (GRCh38)
Location 1:42181195-42181217
Sequence TGGCCACTCACTAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905976764_905976768 4 Left 905976764 1:42181168-42181190 CCAGACACTGGGGCTTGAGTCTT 0: 1
1: 0
2: 1
3: 10
4: 153
Right 905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905976768 Original CRISPR TGGCCACTCACTAAACTGGG TGG Intronic
903220120 1:21864828-21864850 TGGCCACACACTCACCTGGCAGG + Exonic
904001803 1:27343029-27343051 CGGCCACTGACTCAGCTGGGAGG + Intronic
904158270 1:28502907-28502929 TGGCCTCTCACTATACTGCCCGG - Intergenic
905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG + Intronic
909005663 1:70273360-70273382 AGGCTCCTCACTAAAGTGGGAGG - Intronic
911896882 1:103447133-103447155 TGGCCGCTGACTAATCAGGGTGG + Intergenic
912381745 1:109251266-109251288 GCGCTTCTCACTAAACTGGGGGG - Exonic
912437367 1:109671207-109671229 GGGCCATGCACAAAACTGGGAGG + Intronic
912519635 1:110236376-110236398 TAGCCACTCTCTGAACTGAGTGG + Intronic
919887221 1:201943568-201943590 GGGCCACTCATTAAACTGACAGG + Intronic
1065816203 10:29485037-29485059 TGGCCACTTAGGACACTGGGAGG - Intronic
1065956698 10:30699860-30699882 TGGCCACTTAGGACACTGGGAGG + Intergenic
1067407207 10:46033847-46033869 TGGCCACTTCCTGAACAGGGAGG - Intronic
1067459734 10:46449035-46449057 TGGCCTCCCACTAAACTCGAAGG + Intergenic
1067627453 10:47935578-47935600 TGGCCTCCCACTAAACTCGAAGG - Intergenic
1067755600 10:49001985-49002007 TTGACATTCACTGAACTGGGAGG + Intergenic
1077562531 11:3272851-3272873 GGGCCAGTGACTAAACTGGGGGG + Intergenic
1079307316 11:19334604-19334626 TGACCCCTCACGAAACTTGGAGG + Intergenic
1083716092 11:64577898-64577920 TGGCCACACTCTAACCTGGGAGG - Intergenic
1083891300 11:65596953-65596975 TGGCAAGTCACCATACTGGGAGG + Intronic
1088558815 11:111091490-111091512 TGGCCACTCACTTGTCAGGGTGG - Intergenic
1088751630 11:112846919-112846941 TGTGCACTCACTGACCTGGGTGG - Intergenic
1091616855 12:2055951-2055973 TGGCTAATCACTAAAGGGGGCGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092503824 12:9074545-9074567 TGGCAAATCACCAACCTGGGTGG + Exonic
1096656850 12:53097553-53097575 GGGGCATTCCCTAAACTGGGTGG - Exonic
1096685623 12:53286550-53286572 TGGGCCCTCACAAAACTAGGTGG + Exonic
1096705883 12:53421782-53421804 AGGCCACTAACTAAAAAGGGAGG - Intergenic
1104490193 12:129187292-129187314 AGGCCACACACAAAATTGGGAGG + Intronic
1105282954 13:18979974-18979996 TGGCCACTCACTATGCTGCCTGG + Intergenic
1115379005 14:32712344-32712366 TGGCTACCGACTAATCTGGGTGG + Intronic
1117906425 14:60593315-60593337 TGCACACTCACTAAAATGGTTGG + Intergenic
1119595491 14:75929007-75929029 TGGCCACGAAATAAACTGTGGGG - Intronic
1124901795 15:33830270-33830292 TGGCTACTGACTAAACAGGGTGG - Intronic
1129499194 15:76019422-76019444 TGGGCAGACACCAAACTGGGTGG - Intronic
1130921377 15:88347886-88347908 TGGACACTCAGTAAAATAGGTGG + Intergenic
1137549255 16:49425779-49425801 TGGCCACACACTGACCTGGGAGG + Intergenic
1138975948 16:62207983-62208005 TGGCCAAACACTAAACTAAGTGG - Intergenic
1141015145 16:80441812-80441834 TGACCACTCTCTGAAATGGGTGG + Intergenic
1141075850 16:81006460-81006482 CCGCCACTCACTCAACTGGCTGG - Intronic
1143338676 17:6192358-6192380 TGGCCACTCAATAAGCAGGTGGG + Intergenic
1143408089 17:6691265-6691287 AGTCCATTCACCAAACTGGGAGG - Intronic
1143753277 17:9047160-9047182 TGGCTACTGACTAATCAGGGTGG + Intronic
1144137712 17:12314398-12314420 TGGCCACCCACTCTATTGGGTGG + Intergenic
1144354833 17:14435335-14435357 TGTCCACTCACTTACCTGGATGG - Intergenic
1145713816 17:27000287-27000309 TGGCTACTTACTGATCTGGGTGG + Intergenic
1147372592 17:40003535-40003557 TGACCACTCACTGATCAGGGTGG - Intergenic
1147570966 17:41570808-41570830 TAGGCACTCACTGAACTGAGTGG + Intronic
1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG + Intronic
1155272240 18:24152110-24152132 TGGCTATTTCCTAAACTGGGTGG - Intronic
1161194410 19:2978090-2978112 TGGAGACTTACCAAACTGGGAGG + Intronic
1161752265 19:6106649-6106671 AGGACACTCACTAAACTGCAGGG - Intronic
1162721281 19:12664491-12664513 TGGCTCCTCCCTAAACCGGGTGG - Intronic
1164803204 19:31094631-31094653 GGGCCTCTAGCTAAACTGGGTGG + Intergenic
1165590528 19:36965677-36965699 TGATCACACACAAAACTGGGGGG - Intronic
937514290 2:122635982-122636004 TGTCCACTCACATAACTTGGTGG - Intergenic
940727780 2:157354583-157354605 TCGCCACTGACTAATCAGGGTGG - Intergenic
944661020 2:201921588-201921610 AGGACACTCACTGAACTGAGAGG - Intergenic
1175025450 20:55897280-55897302 TGGCTGCTGACTAAACAGGGTGG + Intergenic
1175220015 20:57411521-57411543 TGGCCGCTCACTTGGCTGGGCGG + Intergenic
1176408238 21:6433519-6433541 TGGCCAGTCACTAGTCTGGGTGG - Intergenic
1179683729 21:43041845-43041867 TGGCCAGTCACTAGTCTGGGTGG - Intergenic
1184636718 22:45838242-45838264 GGGCCTAACACTAAACTGGGTGG - Intronic
1184750739 22:46484828-46484850 TCGCCATTCACTAAATTGGAGGG - Intronic
949750387 3:7345700-7345722 TGGCCAGTCACTACAATGGGTGG + Intronic
954636159 3:52071906-52071928 TGGGCACTCACTACAGTGGCTGG - Intergenic
959798593 3:110462949-110462971 TGGCCACTCAATTTAGTGGGAGG - Intergenic
966736962 3:183194522-183194544 TGCCCACTCAGTAAAGTAGGAGG + Intronic
970511048 4:16782079-16782101 TGCCCACTTACTTAACTGTGAGG + Intronic
976932685 4:90588120-90588142 TGGCCACTGACTAATCAGCGTGG + Intronic
977517480 4:98039415-98039437 TGGACACTCCCAAAAGTGGGAGG - Intronic
977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG + Intronic
980788730 4:137589995-137590017 TGGACACTTACTAAAATGGTAGG + Intergenic
982260134 4:153487618-153487640 TGGCCACTCACAGCACAGGGTGG + Intronic
983537435 4:168873211-168873233 TGGCCAAACACTAAACATGGTGG - Intronic
984513985 4:180715686-180715708 TGGCCACCCACTCAAGTAGGAGG + Intergenic
987842682 5:23240669-23240691 TGGTCACTTACTACCCTGGGAGG - Intergenic
992725517 5:79603330-79603352 TGCCCACTGAGTAAACTGGAGGG - Intergenic
993787526 5:92161794-92161816 TGGCTACTCACTGATCAGGGTGG - Intergenic
997279185 5:132628049-132628071 TTGCCATTCCCTAAAATGGGTGG + Intronic
1003070709 6:2943483-2943505 TGGCTTCTCAGTAAACTTGGAGG - Intergenic
1009912682 6:69951999-69952021 AGTTCACTCACTAAACTGGCAGG - Intronic
1010212403 6:73372481-73372503 TGGCCTCTCACTGAGCAGGGAGG - Intronic
1010385654 6:75276741-75276763 TAGCTTCTCACTAAACTGAGCGG + Intronic
1013015390 6:106156185-106156207 TGGCTACTCTCTAAAGTGAGAGG - Intergenic
1014437352 6:121435589-121435611 AAGCCACTGACTCAACTGGGAGG - Intergenic
1016946539 6:149539730-149539752 TGGCCGTTGACTAATCTGGGTGG - Intronic
1019279982 7:194735-194757 TGGCCACTCGCTGCTCTGGGCGG - Intronic
1024213878 7:47229930-47229952 TGGCCATTCACTGACCTGTGTGG - Intergenic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1028608432 7:92681308-92681330 GAGCCACTCAGTAAACAGGGGGG + Intronic
1032391155 7:131556249-131556271 CGGCCACTCACCATTCTGGGAGG + Exonic
1045162690 8:99566697-99566719 TGGCCTCTCACTACTTTGGGAGG - Intronic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1051398148 9:16649256-16649278 TGGCCTCTCAAAACACTGGGTGG - Intronic
1052543162 9:29837120-29837142 TGGCTACTGACTAATCAGGGTGG + Intergenic
1053106389 9:35412502-35412524 TGGCCTCCCACTCAAGTGGGTGG - Intergenic
1056039829 9:82652339-82652361 AGGGAACTTACTAAACTGGGTGG + Intergenic
1186591354 X:10933243-10933265 TGGGCCCTGACTAAAATGGGTGG - Intergenic
1186942197 X:14521937-14521959 TGGCTGCTGACTAAACAGGGTGG + Intergenic
1197305892 X:124841754-124841776 TGTCCACTTACTAAACAGGAAGG + Intronic