ID: 905982447

View in Genome Browser
Species Human (GRCh38)
Location 1:42241735-42241757
Sequence GTGGTGTGTCCTCATTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905982447_905982454 28 Left 905982447 1:42241735-42241757 CCAGGGGAATGAGGACACACCAC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 905982454 1:42241786-42241808 CAACCAGCCAAGCTGCCTTGAGG 0: 1
1: 0
2: 1
3: 11
4: 164
905982447_905982450 5 Left 905982447 1:42241735-42241757 CCAGGGGAATGAGGACACACCAC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 905982450 1:42241763-42241785 CAGCCCACTGCTGCCACTGTCGG 0: 1
1: 2
2: 14
3: 70
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905982447 Original CRISPR GTGGTGTGTCCTCATTCCCC TGG (reversed) Intronic
900307080 1:2015810-2015832 GGGGTGTGTGCTCCTTACCCAGG - Intergenic
900506623 1:3032568-3032590 TTGGTGTGTCTCCCTTCCCCCGG - Intergenic
902935783 1:19763620-19763642 GAGGTGTGTCCTCAGACCCAGGG - Intronic
903264462 1:22149227-22149249 GTGGTGTGTGCCGATTCCCATGG - Intergenic
903687232 1:25140614-25140636 GTGGTGTGTCCTCCTATCCAGGG + Intergenic
904277375 1:29393325-29393347 GTTGAGTGTCCTTGTTCCCCTGG + Intergenic
904517824 1:31070569-31070591 GTGGCGTGACCTCAGCCCCCTGG + Intergenic
905386131 1:37605577-37605599 GTGTGGTTTCCTCATGCCCCAGG + Intergenic
905982447 1:42241735-42241757 GTGGTGTGTCCTCATTCCCCTGG - Intronic
908434400 1:64091207-64091229 GTGGTGTTTCCTCCATACCCCGG + Intronic
912456025 1:109797982-109798004 GTGTTCTGTCCAAATTCCCCCGG - Intergenic
916075157 1:161196383-161196405 GTGCTGGGTCCTCAGTGCCCAGG - Intronic
916194482 1:162210680-162210702 GTGGTGACTCCTCCTTCTCCTGG + Intronic
919609282 1:199725317-199725339 CAAGTGTGTCCTCATTCCCAGGG - Intergenic
923502370 1:234576266-234576288 GTGGTGGGTGGTCACTCCCCTGG + Intergenic
1062802342 10:389433-389455 GTGATGTGTTTTCCTTCCCCCGG - Intronic
1065368073 10:24953605-24953627 TGGGTGTGTCTTCATTCCCCAGG + Intergenic
1067849172 10:49744158-49744180 GTGGTGGGTTCTGATCCCCCTGG + Intronic
1068777736 10:60886234-60886256 GTTGTGTTTCCTCAATCCCTTGG - Intronic
1070111755 10:73494043-73494065 GTGTTGTGTGTTCATTTCCCTGG - Intronic
1070459629 10:76651264-76651286 ATGGTATGTCCACATTTCCCTGG + Intergenic
1071888663 10:89978565-89978587 GTAGTGGGTCATCATTACCCTGG + Intergenic
1075174253 10:120144594-120144616 GTGGGGTGTCCCCATCCCACAGG + Intergenic
1075244708 10:120810791-120810813 GTGGAGTGTGCTGACTCCCCAGG - Intergenic
1081006818 11:37754765-37754787 CTGGTCTGTCCACATTGCCCTGG - Intergenic
1083134797 11:60662165-60662187 GTGGATTCTCCTCTTTCCCCAGG + Intergenic
1083770543 11:64864517-64864539 CTAGTGTGGCCTCATCCCCCGGG - Intronic
1088581591 11:111321567-111321589 GTGATGAGACCTGATTCCCCGGG - Intergenic
1090466562 11:126939851-126939873 GAGGTGTGTCTTCTTTCCCAAGG + Intronic
1090835697 11:130451839-130451861 GTGGTGTGTGCTCAACCCCCCGG + Intronic
1091159696 11:133408752-133408774 GTGGTGTTTGCACATTCTCCTGG - Intronic
1091590107 12:1837697-1837719 CTGGGGTGTCCGCCTTCCCCAGG + Intronic
1091981580 12:4868453-4868475 GTGGAGAGTCCTGCTTCCCCAGG - Intergenic
1092099255 12:5869671-5869693 GTGATTTGTCTTCTTTCCCCCGG - Intronic
1093864463 12:24208338-24208360 GTGGTTTGTCCTAACTCCACAGG - Intergenic
1093980149 12:25467109-25467131 GTGCTGTGTCCTCCTCCCCTAGG + Intronic
1099561024 12:84174098-84174120 CTGGTGTGTCAGCATTGCCCAGG + Intergenic
1100524751 12:95408820-95408842 GTAGTCTGTCCTCATTCCCGTGG - Intergenic
1101224616 12:102675714-102675736 GTGGTCAGTCCTCTGTCCCCAGG + Intergenic
1102911341 12:116716613-116716635 CTGGTGTGTCCTGAATCCACAGG - Exonic
1106102487 13:26707043-26707065 CTGGTGTGTCTACATTGCCCCGG + Intergenic
1106953077 13:34906300-34906322 GTGCTGTGTTCTCCTTCCCCAGG + Intergenic
1108578937 13:51812227-51812249 ATGCTGTGTCCTCCTCCCCCAGG + Intergenic
1110308129 13:74014248-74014270 GTGGGGTGTCCTCTATCCACTGG - Intronic
1113350545 13:109525071-109525093 GTGGTGAGTGCTCATTCCTCCGG - Intergenic
1116061665 14:39931810-39931832 GTGGTGTATCCTAACTCCACAGG + Intergenic
1118982496 14:70728087-70728109 GTTCTGTGGCCTCCTTCCCCCGG - Intronic
1119546079 14:75472389-75472411 GTGGTGTGACCTCAGTTGCCAGG + Intronic
1122295899 14:100705584-100705606 GTGGGTTGTCCTCACTTCCCAGG - Intergenic
1123005767 14:105322961-105322983 GTGGTGTGTGCTCCTCCCACAGG + Intronic
1124149716 15:27166703-27166725 GTGGAGTGTCTTCATTTCCTAGG - Intronic
1132721632 16:1319368-1319390 GTGGTGTCTTCGCGTTCCCCAGG + Intronic
1132777246 16:1601755-1601777 GTCCTGTCTCCTCAGTCCCCTGG - Intronic
1133988299 16:10684975-10684997 CTGGTGTGTCCTCACCCCCTTGG - Intronic
1134108441 16:11499833-11499855 GGGGTGTGTCCTCACTTTCCTGG - Intronic
1135621736 16:23961870-23961892 TTGGGGTGCCCTCATTTCCCAGG + Intronic
1135645540 16:24158411-24158433 GCTGTGTGGCCTCAGTCCCCTGG - Intronic
1140259454 16:73364929-73364951 GACGTGTGTCCTCATTCTACAGG - Intergenic
1142235784 16:88921886-88921908 GTGAGGCGTCCCCATTCCCCAGG - Intronic
1143112272 17:4559348-4559370 GTGGTGCATCCTCATGCCACGGG - Exonic
1143381787 17:6501244-6501266 GGGGTGTCACCCCATTCCCCAGG - Intronic
1143763816 17:9124364-9124386 GTGGTGTGCCCTCCTCCCTCCGG + Intronic
1144770962 17:17759194-17759216 GTGGTGTGACCTCAGACCCTGGG + Intronic
1146162325 17:30566601-30566623 CTGCTGTCTCCTCCTTCCCCTGG + Intergenic
1147510704 17:41066510-41066532 TTGATGTGTCATCATTCACCTGG + Intergenic
1147578727 17:41617015-41617037 CCGGTGTCTCCTCCTTCCCCTGG + Intergenic
1151716004 17:75831360-75831382 GTGCTGTGTCCGCATCCCTCCGG - Intronic
1152657466 17:81526727-81526749 GGCCTGTGTCCTCAGTCCCCTGG + Intergenic
1152758281 17:82096218-82096240 GTGCTGTGTCCTCACCACCCAGG - Intronic
1153001213 18:457033-457055 GTGGTTTGTTCACATTCCCGAGG + Intronic
1157579317 18:48764274-48764296 CTGCTGTATCCTCAGTCCCCAGG - Intronic
1161543331 19:4865599-4865621 GAGGTGGGGCCTCATTCCTCTGG - Intronic
1164670734 19:30070652-30070674 GTGGTGTGTCTGCAGCCCCCTGG - Intergenic
1164740558 19:30572499-30572521 ATGCTGTTTCCTCGTTCCCCAGG - Intronic
1165319181 19:35075235-35075257 GTGGTGTCTCCTCCTTACCCAGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1167471746 19:49679557-49679579 GTGGTGGGTGCCAATTCCCCTGG + Intronic
925220261 2:2133780-2133802 GTCATGTGCCCTCCTTCCCCAGG + Intronic
926300981 2:11602189-11602211 ATGGTGTGTCCCCATTGCTCAGG - Intronic
928409955 2:31047317-31047339 GTGGTGTGGCATCATTCCCTGGG + Intronic
929560486 2:42953383-42953405 GGGGTGTGTCCTGTTTCTCCAGG + Intergenic
929598990 2:43193314-43193336 CTGGTGTGTCCACACGCCCCTGG + Intergenic
931693646 2:64856095-64856117 GTGGTGTAGCCTCAAACCCCTGG - Intergenic
933136577 2:78743022-78743044 GTGGGGTGTCCTCATGCCCAGGG + Intergenic
934770001 2:96901521-96901543 CTGGTGTCCCCTCAGTCCCCAGG - Intronic
936836069 2:116710750-116710772 GTGGTGTGTCCTGAGCCCCAAGG + Intergenic
937015494 2:118601694-118601716 GTGGGGGGTTCTCATTCACCAGG + Intergenic
937071701 2:119068428-119068450 GTGGTTTGTCCCCACTCCCGTGG - Intergenic
937241490 2:120465209-120465231 GTGGTGAGACCGCATGCCCCGGG - Intergenic
942541740 2:177022249-177022271 TTGCTGAGTCCTCATTCCTCGGG + Intergenic
945359073 2:208874236-208874258 GTACTCTGTCCTCATTCACCAGG - Intergenic
947534944 2:230934488-230934510 GACCTGTGTCCTCCTTCCCCTGG - Intronic
947910905 2:233800121-233800143 GTGTGGTCTCCTCACTCCCCAGG - Intronic
949023853 2:241755779-241755801 GTGGTGTGCCCCCTGTCCCCGGG + Intronic
1175919347 20:62442776-62442798 GTGGTGTGTATTTATTTCCCAGG - Intergenic
1176869476 21:14073980-14074002 GCGCTCTGTTCTCATTCCCCAGG + Intergenic
1178401886 21:32293513-32293535 GTGGTGGGACCTCATTTTCCAGG - Intronic
1179148838 21:38793384-38793406 TTGCTGTGTCCTCATTCTCCTGG - Intergenic
1180165280 21:46022553-46022575 GTGGTGTGTGCGGACTCCCCAGG - Intergenic
1182313036 22:29422856-29422878 ATTGTGTGTCTTCTTTCCCCTGG + Intronic
1185184911 22:49393215-49393237 GTGATGTGTCCTCATCTCCTAGG - Intergenic
950423952 3:12914681-12914703 GTGGTGTGCCCACACGCCCCAGG - Intronic
950465064 3:13148787-13148809 CTGACGTGTCCTCATTTCCCAGG - Intergenic
952241254 3:31533055-31533077 GTGGAGTGGCCTCATGGCCCTGG + Exonic
952956954 3:38563409-38563431 CTGGCGTGTCTTCCTTCCCCTGG - Intronic
953605813 3:44412486-44412508 TTGCTGTGTCCTCAGTGCCCCGG - Intergenic
953910967 3:46892856-46892878 GTCGTGTTTCCTCAGACCCCTGG - Intronic
962659205 3:137584494-137584516 GTAGTGTGCCCTGATTCCACAGG - Intergenic
963656229 3:148054864-148054886 CTGTAGTGTCCTCATTCCTCGGG - Intergenic
967010099 3:185424624-185424646 GTAGTGTTTGCTCATTTCCCTGG - Intronic
969217865 4:5736424-5736446 GTGCTGTGTGCTCCTCCCCCAGG - Intronic
969549318 4:7853872-7853894 CTGCTGTCTCCTCATTCCCCAGG + Intronic
970667586 4:18354884-18354906 TTGCTGTGTCCTCCTTCCCCCGG + Intergenic
972388758 4:38592821-38592843 GGGGTGCGTCCATATTCCCCAGG + Intergenic
972568810 4:40292494-40292516 CTGGTGTGTCATCATCCCCTAGG + Intergenic
974381700 4:61148794-61148816 GTGGTGTTTGCTCATTTCCGTGG - Intergenic
986007684 5:3681782-3681804 GTGGAGTGTCCTGATTACACTGG - Intergenic
986825195 5:11512728-11512750 GAGGTCTTCCCTCATTCCCCTGG - Intronic
996281366 5:121732955-121732977 GTTTTGTGTCCACATTCCCCAGG + Intergenic
998411582 5:141915308-141915330 CTGCTGTATCCTCAGTCCCCGGG + Intergenic
998537228 5:142945013-142945035 CTGGGCTGTCCTCATTCACCAGG + Intronic
1000651993 5:163829937-163829959 CTGATTTGTCCTCACTCCCCTGG + Intergenic
1005925813 6:30444572-30444594 GTGGGGTGTCCTCTCTCTCCGGG - Intergenic
1006132453 6:31877656-31877678 CTGGTGGGACCTCAGTCCCCTGG + Intronic
1008450323 6:51643324-51643346 CTGGTTTGTCCTCATTCCTTGGG + Intronic
1009570133 6:65374419-65374441 CTCGTGTGTCTACATTCCCCGGG + Intronic
1012624332 6:101389033-101389055 TTGTTGTGTCTTCATTTCCCTGG + Intergenic
1018044235 6:159951981-159952003 GTGGAGTTTCCCCATTCCCCAGG + Intergenic
1019371925 7:666542-666564 GTGGGGTGTCCTTATCCCCTGGG - Intronic
1019423658 7:963207-963229 GTCGTGTGTCCTGAAGCCCCAGG - Intronic
1021234460 7:18125163-18125185 GGGGGGTACCCTCATTCCCCAGG - Intronic
1021684763 7:23173299-23173321 CTGGTGCGACATCATTCCCCAGG - Intronic
1022647777 7:32247352-32247374 TTGCTGTGTCCTCAATGCCCAGG + Intronic
1029562021 7:101308980-101309002 GTGGACTGTCCTCAGGCCCCCGG - Intergenic
1029601108 7:101563910-101563932 CTGGTGAGTCCCCTTTCCCCAGG - Intergenic
1031987440 7:128172235-128172257 GTGCTGTGTCCTCCTCCCCCAGG - Intergenic
1032628728 7:133623491-133623513 GTACTGTGTGCTTATTCCCCGGG + Intronic
1035392266 7:158512624-158512646 GTGGTGTGTGCTCATTACTGCGG - Intronic
1035783698 8:2247499-2247521 TTGGTGTATCCACCTTCCCCTGG - Intergenic
1037083939 8:14823026-14823048 TTGGTGTGGCTTCATTGCCCAGG - Intronic
1037206071 8:16321194-16321216 GAGGTGGGTCCTCATGCCCTTGG - Intronic
1037817354 8:22119191-22119213 GTGGTGTGTCGGCATGCACCAGG + Exonic
1040276404 8:46016247-46016269 GGGGTGTGTCGTGATGCCCCTGG - Intergenic
1046816572 8:118590620-118590642 GTGGTATCTCCTCTTTTCCCTGG + Intronic
1049242499 8:141545142-141545164 GTGGTGTGGCCTCTTCCCTCTGG + Intergenic
1050934089 9:11371780-11371802 TTGGTCTGTCCTGATTCCCAAGG + Intergenic
1051173072 9:14339018-14339040 ATGGTGTGTCCTCTTTTCCCAGG - Intronic
1051604423 9:18906357-18906379 GTGGTGAGTCCCCGTGCCCCAGG - Intronic
1053173541 9:35907190-35907212 GGCCTGTGTCCTCATTGCCCTGG + Intergenic
1055000614 9:71445841-71445863 GTGGTGTATCCTCCTTCCCCAGG + Intronic
1055901302 9:81241391-81241413 GTTTTGAGTCCTAATTCCCCTGG - Intergenic
1056736848 9:89217154-89217176 GTGCTGTGTCCACTTGCCCCTGG - Intergenic
1057168970 9:92949534-92949556 TTGGGGTGTCGTCATTCTCCAGG + Intronic
1060224477 9:121782802-121782824 GTGGTGTGTCCTTGTCCTCCTGG + Intronic
1060504603 9:124188434-124188456 GGGCTGTGGCCTCATTCCTCAGG + Intergenic
1061377205 9:130233678-130233700 CTGGTGTGTCCTCAGCTCCCAGG + Exonic
1189251993 X:39607937-39607959 GTTGTATGTTCTCATTCCTCAGG - Intergenic
1189846980 X:45147222-45147244 GTTGTGTATTCTCAGTCCCCTGG - Intergenic
1190649348 X:52554214-52554236 TTGCTGTGTCCACATTTCCCTGG - Intergenic
1194631444 X:96290430-96290452 GTGCAGTGTCCCCCTTCCCCAGG - Intergenic
1196587976 X:117452090-117452112 GTGGTCTTTCCTCATACCTCAGG + Intergenic
1197352777 X:125398854-125398876 GTGCAGTGTCCTCCTTCCCTGGG - Intergenic
1199727534 X:150599400-150599422 GTGGTGGGTTGTCATTGCCCAGG + Intronic