ID: 905988022

View in Genome Browser
Species Human (GRCh38)
Location 1:42305560-42305582
Sequence TTTTCAACATGGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 7, 3: 39, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905988022 Original CRISPR TTTTCAACATGGATGGAACT GGG Intronic
900900473 1:5512542-5512564 TTTTCAGCATGGCATGAACTTGG + Intergenic
903279273 1:22241219-22241241 GCTACAACATGGATGAAACTTGG - Intergenic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
906369918 1:45244496-45244518 TTAGCAACATGGATGGAACTTGG + Intronic
908614679 1:65906018-65906040 TTTTCATGATGGATGGAAATGGG + Intronic
908819864 1:68074337-68074359 GTGGCAACATGGATGGAGCTGGG - Intergenic
909203346 1:72722557-72722579 GCAGCAACATGGATGGAACTGGG - Intergenic
909562536 1:77022678-77022700 TTTTCACAATGGATATAACTGGG - Intronic
909844557 1:80375577-80375599 TTTTCACCATGGTTGTTACTGGG + Intergenic
913601298 1:120423908-120423930 ATTTCAACATGGAAAGAGCTAGG - Intergenic
914085746 1:144452687-144452709 ATTTCAACATGGAAAGAGCTAGG + Intronic
914191641 1:145416668-145416690 ATTTCAACATGGAAAGAGCTAGG + Intergenic
914362486 1:146947466-146947488 ATTTCAACATGGAAAGAGCTAGG - Intronic
914489184 1:148139631-148139653 ATTTCAACATGGAAAGAGCTAGG + Intronic
914589568 1:149094670-149094692 ATTTCAACATGGAAAGAGCTAGG + Intronic
915731088 1:158055044-158055066 ATTTTACCATGGATGAAACTGGG + Intronic
917139487 1:171820826-171820848 GTTACAACATGGATGAACCTTGG - Intergenic
917648739 1:177054939-177054961 TTTTCACAAAGGCTGGAACTGGG - Intronic
918126677 1:181590024-181590046 TTTTCAACAGGCATGGAATGAGG - Intronic
918828592 1:189360744-189360766 TATACAACATGAATGTAACTTGG - Intergenic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
919745572 1:201006386-201006408 TGTTCAACAGGCAGGGAACTAGG + Intronic
920286453 1:204883264-204883286 GTTTCAACTTGGATAGAACAAGG + Intronic
922187027 1:223284703-223284725 ATGGCAACGTGGATGGAACTGGG + Intronic
923843563 1:237701821-237701843 GCAGCAACATGGATGGAACTGGG - Intronic
924526125 1:244851107-244851129 TTTCAAAAGTGGATGGAACTTGG - Intronic
1062969759 10:1638051-1638073 TTTTCCACATGGAGGAAACTTGG + Intronic
1063038174 10:2309318-2309340 TCTTCACCATTGATAGAACTGGG - Intergenic
1063442748 10:6086349-6086371 TATGCAGCATGGATGGAACCGGG - Intergenic
1063560940 10:7126898-7126920 TTTTCAAACTGGCTGGAAATTGG + Intergenic
1063725554 10:8633805-8633827 TCTACAACATAGATGGACCTTGG + Intergenic
1063792397 10:9467662-9467684 ACTACAACATGGATGAAACTTGG + Intergenic
1064325387 10:14346081-14346103 GTTTTAACATGGCTGAAACTTGG + Intronic
1064559351 10:16580865-16580887 TTTTCTACAAGAATGGAAATGGG + Intergenic
1065196663 10:23273376-23273398 TTTTTATCATGAATGGAAATTGG + Intronic
1065332240 10:24614427-24614449 TTTTCAACATTAAAGGAACTAGG + Intronic
1066248143 10:33604839-33604861 TTAACAACATTGATGGACCTAGG + Intergenic
1066270410 10:33817075-33817097 TTGTCAACATGGATGAAATGAGG + Intergenic
1066517202 10:36176143-36176165 GTTGCCACATGGATGAAACTTGG + Intergenic
1066523083 10:36244435-36244457 GCAGCAACATGGATGGAACTGGG + Intergenic
1067800864 10:49358729-49358751 GCAACAACATGGATGGAACTGGG + Intergenic
1068885712 10:62094721-62094743 TCTTCAGCAGGGATGGGACTTGG - Exonic
1069249497 10:66250091-66250113 GCAACAACATGGATGGAACTGGG + Intronic
1069701285 10:70428324-70428346 CATTCAGAATGGATGGAACTGGG - Exonic
1070620426 10:78005465-78005487 TCTCCAACTTTGATGGAACTAGG + Intronic
1072865955 10:99061908-99061930 TTTTCCCCATGGATGGGAATGGG + Intronic
1073786500 10:106896017-106896039 GTTAGAACATAGATGGAACTTGG + Intronic
1073991255 10:109264608-109264630 CTTTACACATGGATGGAAGTGGG + Intergenic
1074053930 10:109905106-109905128 GTTACAACATGGATGAACCTTGG + Intronic
1074219559 10:111423078-111423100 TCTGCAACATGTATGCAACTAGG + Intergenic
1075801520 10:125157533-125157555 CTTTCCACAGGGATGTAACTGGG + Intronic
1080004511 11:27392371-27392393 TAGTCAACATGCTTGGAACTAGG - Intronic
1080830833 11:35891832-35891854 TTTTCAACATTGTTGGAAACTGG + Intergenic
1080897296 11:36457221-36457243 TTTATAACATGGCTGAAACTTGG - Intronic
1080944598 11:36957458-36957480 TGCACAACATGGATGGAACTGGG + Intergenic
1081959268 11:47122325-47122347 TTTTCATCATGGATGAAACAAGG + Intronic
1082301619 11:50512847-50512869 ATCTCAACATGGCTGCAACTGGG - Intergenic
1085862767 11:80254083-80254105 TTTTAAAAATAGAGGGAACTAGG + Intergenic
1086393755 11:86392751-86392773 TTTGTACCATGGATGGAAGTGGG + Exonic
1086767249 11:90711961-90711983 GTAGTAACATGGATGGAACTGGG - Intergenic
1086835549 11:91617117-91617139 GTGACAACACGGATGGAACTGGG - Intergenic
1087429608 11:98036046-98036068 GTGGCAACCTGGATGGAACTGGG + Intergenic
1087444528 11:98232986-98233008 TTTTCAAAATTGAAGGAATTTGG - Intergenic
1087466207 11:98509859-98509881 TTTGCAATCTGGATGGAACTGGG - Intergenic
1087897912 11:103608169-103608191 TTTTCAGCATGAATGTTACTAGG - Intergenic
1089978153 11:122750527-122750549 TCTTCAGGATGGATGGAATTTGG - Intronic
1090519555 11:127463828-127463850 TTGTCACCATGGATGGACATGGG + Intergenic
1090717658 11:129444382-129444404 TTTTCAAAATGGAGGCGACTTGG + Intronic
1090830995 11:130420782-130420804 TTATCAACAAGGCTGAAACTTGG + Intronic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1092703908 12:11263385-11263407 GTGGCAATATGGATGGAACTGGG + Intergenic
1092707907 12:11304523-11304545 GTGGCAATATGGATGGAACTGGG + Intergenic
1092715738 12:11388726-11388748 GTGACAATATGGATGGAACTGGG + Intronic
1093511091 12:19929357-19929379 CCTTCAACATGGATGAAAATGGG - Intergenic
1095134331 12:38580741-38580763 TTTTCAGCAAGTATGGAACATGG + Intergenic
1095266060 12:40159262-40159284 TTTTCAAAATGGCAGGAACACGG - Intergenic
1095564405 12:43604932-43604954 TTTACAATATGGATGAACCTAGG - Intergenic
1095628870 12:44350662-44350684 GCAACAACATGGATGGAACTGGG - Intronic
1095912686 12:47444900-47444922 ATCTCAACATGGCTGCAACTGGG + Intergenic
1096906315 12:54939714-54939736 TTTACAAAATGGATGGATCTGGG + Intergenic
1097325716 12:58274298-58274320 TTTTTAACATAAATGTAACTCGG - Intergenic
1097349007 12:58527186-58527208 TTTTCCAAAGAGATGGAACTTGG + Intergenic
1098854581 12:75637780-75637802 GTTTCAAGATGGAAGGAACCAGG - Intergenic
1098915725 12:76255008-76255030 TTTTCAACATGGAAAGAAACAGG - Intergenic
1099007673 12:77253678-77253700 GTTGCAACATGGATGGAAATGGG + Intergenic
1099569056 12:84291809-84291831 GTTTCAACATGCATGGAATTTGG + Intergenic
1100206271 12:92353785-92353807 TCTTCAACATGGCTGGATCCGGG + Intergenic
1100639680 12:96470625-96470647 TTTTCACCCTGGATGTAACAAGG - Intergenic
1100954021 12:99885898-99885920 GTAGCAACTTGGATGGAACTGGG - Intronic
1101223301 12:102662721-102662743 GTCTCAACATGGCTGCAACTGGG + Intergenic
1102909463 12:116701567-116701589 GCTACAACATGGATGAAACTCGG - Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1104925250 12:132310599-132310621 TTTTCAACTTGGAAGGAAGTGGG + Intronic
1106544750 13:30720781-30720803 TTTGCAACATGCAAGGAAATAGG - Intronic
1109332493 13:60946751-60946773 ATAGCAACTTGGATGGAACTAGG - Intergenic
1109737113 13:66500385-66500407 TTGACAACATGGATGAACCTAGG + Intronic
1109961183 13:69634131-69634153 TTTCTAACATGGATGTAACTGGG - Intergenic
1111227134 13:85288751-85288773 TTTTCACCATTGCTGGAGCTGGG + Intergenic
1114357568 14:21928765-21928787 TTTTCAATATGGAATGAACAAGG + Intergenic
1115065010 14:29248410-29248432 TTCTCATCATGAATGGAAGTTGG + Intergenic
1115955994 14:38779900-38779922 GCAGCAACATGGATGGAACTGGG + Intergenic
1116085570 14:40233030-40233052 ATTTCAACATGGTTCAAACTTGG + Intergenic
1116451706 14:45074457-45074479 ATTTTAACATGTATGGAAGTTGG - Intergenic
1116737889 14:48717319-48717341 GCATCAACATGGATGGAGCTGGG - Intergenic
1117525914 14:56604141-56604163 TTTTTATTATGGATGGAACCAGG + Intronic
1118700547 14:68428670-68428692 TATGCAACATGGATGAACCTGGG - Intronic
1118728563 14:68650211-68650233 TATTCAAAATGGATGAAAATTGG - Intronic
1119960683 14:78852982-78853004 GCATCAATATGGATGGAACTGGG - Intronic
1120073446 14:80128839-80128861 GTAACAACATAGATGGAACTGGG - Intergenic
1120775491 14:88431752-88431774 GTGGCAACATGGATGGAACATGG - Intronic
1122306493 14:100769922-100769944 TTTTCAACAGGGAGGAAAGTGGG - Intergenic
1202834587 14_GL000009v2_random:68449-68471 ATTTAATCATGGAGGGAACTGGG + Intergenic
1125251416 15:37709217-37709239 TCTTCAAGATGGCTGGAAGTGGG + Intergenic
1127750755 15:62040054-62040076 GCAACAACATGGATGGAACTGGG + Intronic
1128529595 15:68434931-68434953 GTTGCAACATGGATGAACCTTGG - Intergenic
1129135762 15:73549209-73549231 ACAACAACATGGATGGAACTGGG + Intronic
1129497732 15:76001906-76001928 TTTTGAACCTGTATGGAACAAGG + Intronic
1131594326 15:93781531-93781553 TTTTCAATTTGTATTGAACTTGG - Intergenic
1131854906 15:96583394-96583416 TTTTAACCATGGCTGGAATTAGG - Intergenic
1133044338 16:3078404-3078426 GTCTCAACATGGCTGCAACTGGG + Intronic
1133664545 16:7953569-7953591 GCAACAACATGGATGGAACTTGG + Intergenic
1134667731 16:16031350-16031372 CTTTCAACATGGATGCATCCGGG - Intronic
1135118851 16:19747784-19747806 GCAGCAACATGGATGGAACTGGG - Intronic
1138904836 16:61318795-61318817 TTTTCATCATGAATGGGTCTTGG - Intergenic
1139159438 16:64486555-64486577 TTTTCAACATGATTGAACCTAGG - Intergenic
1140322952 16:73971596-73971618 TTTTCAATATGGATGTAATTTGG - Intergenic
1140438467 16:74967994-74968016 GCTACAACATGGATGGAGCTCGG + Intronic
1141325837 16:83058522-83058544 TTGGCAACATGGTTGGAATTTGG - Intronic
1148507079 17:48135948-48135970 TTTGCCACAGGGATGGATCTAGG - Intronic
1149075205 17:52588608-52588630 TCAACTACATGGATGGAACTGGG - Intergenic
1149130956 17:53301887-53301909 ATTACAACATGGATAGAACTGGG + Intergenic
1149159862 17:53679194-53679216 TTTTCATAGTGGATAGAACTAGG - Intergenic
1149314338 17:55424097-55424119 GTTACAACATGGATGAACCTTGG + Intergenic
1153493051 18:5669666-5669688 TTTGCAAGGTGCATGGAACTGGG + Intergenic
1155089847 18:22496028-22496050 TTTGCAGGATGGATGAAACTGGG - Intergenic
1155125282 18:22869286-22869308 TTTTCTACAGGGTTGGGACTTGG - Intronic
1155164883 18:23224075-23224097 TTTTAAAGCTGGAAGGAACTTGG + Intronic
1155455606 18:26009020-26009042 TATTCAACCTCGTTGGAACTTGG + Intergenic
1155461290 18:26087110-26087132 GGTTCAACATGGATGAACCTCGG + Intronic
1156208579 18:34912973-34912995 TTTTTAATATGGATGGAAAGAGG + Intergenic
1156730096 18:40183191-40183213 GCTACAACATGGATGAAACTTGG + Intergenic
1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG + Intergenic
1162270505 19:9611133-9611155 TTTTCCACATGGATTAAATTTGG + Exonic
1162275792 19:9653681-9653703 TTTTCCACATGGATTAAATTTGG + Exonic
1162280269 19:9691071-9691093 TTTTCCACATGGATTAAATTTGG + Exonic
1165086069 19:33348281-33348303 AATTCAACATGGATGGATATAGG + Intergenic
1165125940 19:33597255-33597277 TCTTCAACATGGATAAATCTTGG - Intergenic
1168389163 19:55992163-55992185 GTGGGAACATGGATGGAACTGGG - Intergenic
927343016 2:22003934-22003956 TTTAAGACATGGATGTAACTGGG - Intergenic
927951819 2:27175553-27175575 GTTTCAAGAAGGATGGAGCTGGG - Intergenic
929055456 2:37872745-37872767 TTTTGAACATGCATGTAATTGGG - Intergenic
929747689 2:44675969-44675991 GTTACAACATGGATGAACCTTGG - Intronic
930429601 2:51257390-51257412 GTAGTAACATGGATGGAACTAGG + Intergenic
930465587 2:51744783-51744805 TTTGCAATATGGATTGAACCTGG + Intergenic
932404009 2:71501700-71501722 GCTACAACATGGATGGACCTTGG - Intronic
932520007 2:72401712-72401734 CCAGCAACATGGATGGAACTAGG + Intronic
932941908 2:76176942-76176964 TTAGCAACATGGATGAACCTGGG - Intergenic
933404039 2:81835327-81835349 TCAACAACATGGATGAAACTAGG + Intergenic
933794289 2:85907308-85907330 TTGTTAACATGGAAGGGACTAGG - Intergenic
934679418 2:96272010-96272032 TTCTCAACAGGGATGCAAATTGG + Intronic
935428747 2:102950186-102950208 ATTTCCACATGGAGGGCACTTGG - Intergenic
935496712 2:103791444-103791466 GTAACAACATGGATGGAACTGGG + Intergenic
935793617 2:106617826-106617848 GTGACAACATGGATGAAACTAGG + Intergenic
936507996 2:113123371-113123393 TTTTGAGCATTCATGGAACTTGG + Intronic
936926221 2:117739758-117739780 TTTTCATGTTGGATGTAACTTGG + Intergenic
937614952 2:123911257-123911279 TTTTCACCAGGGATGAAATTTGG + Intergenic
938899141 2:135784431-135784453 TTTTCTACATAGATAGTACTAGG + Exonic
939042010 2:137201060-137201082 TGTTCAACCTGGATGAATCTTGG - Intronic
939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG + Intronic
939450758 2:142371108-142371130 TTTTCAATATGGAAGCAACTTGG - Intergenic
939774953 2:146373411-146373433 TTTTTAACATGAATGGATGTTGG + Intergenic
940145037 2:150537168-150537190 GCAGCAACATGGATGGAACTAGG + Intronic
940263725 2:151814463-151814485 GTTTAAACAGGGCTGGAACTAGG + Intronic
941616699 2:167728641-167728663 TTTTTAACATTCATGAAACTGGG - Intergenic
942324039 2:174760398-174760420 GGTACAACATGGATGGAGCTTGG + Intronic
942329752 2:174810165-174810187 CTTTGAACATGCATGGAATTGGG + Intronic
942352684 2:175069417-175069439 CCAACAACATGGATGGAACTGGG + Intergenic
942635362 2:177998378-177998400 TATTTAACATGGATGGAAAAGGG - Intronic
944470508 2:200047664-200047686 GTGACAACATGGGTGGAACTGGG + Intergenic
945157490 2:206854976-206854998 GTTACAACATGGATGAACCTTGG + Intergenic
946558745 2:220889293-220889315 TTTTCAATTTGGATGGAATCTGG + Intergenic
946955072 2:224920901-224920923 TTTACTACATAGATGGAACAGGG - Intronic
947261415 2:228227607-228227629 TTTTCCACATGGCTGGCTCTGGG + Intergenic
1169261407 20:4141121-4141143 TTATCCACAGGAATGGAACTTGG + Intronic
1170176897 20:13481219-13481241 GCAACAACATGGATGGAACTGGG - Intronic
1171032531 20:21690599-21690621 TTTTAAACATGAATGGTACTGGG + Intergenic
1173336696 20:42117820-42117842 TTTTTAAGATGGAAGGTACTGGG + Intronic
1173675035 20:44825999-44826021 TTTTTCAAATGGATGGAACTAGG - Intergenic
1177204042 21:17991100-17991122 GTAGCAACATGGATAGAACTGGG - Intronic
1177299340 21:19220656-19220678 TTCTCAAAATGGATGTGACTTGG - Intergenic
1177401396 21:20610310-20610332 TCAACAACATGGATGGAACTGGG + Intergenic
1178180023 21:30149352-30149374 TTTTCAGCATCGCTGGAGCTAGG - Intergenic
1179300766 21:40107955-40107977 TTTTTAACATGAATGGATGTTGG - Intronic
1179400948 21:41082749-41082771 TCAACAACATGGATGGAGCTGGG - Intergenic
1179953707 21:44726312-44726334 TCAGCAACATAGATGGAACTGGG + Intergenic
1182126561 22:27820208-27820230 GCTGCAACATGGATGGACCTTGG - Intergenic
1182145648 22:27995225-27995247 TCTTAACCATGGATGGAGCTAGG + Intronic
1182978213 22:34643191-34643213 TTGGGAACTTGGATGGAACTCGG - Intergenic
1183521250 22:38297369-38297391 TTTTCAGCAAGGCTGGAAATGGG - Intronic
1183579929 22:38718131-38718153 TTTGCAACATTGAAGGAAATGGG - Intronic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
1184775871 22:46622394-46622416 TTTTGAAAATGGAAGGAAGTAGG + Intronic
950938386 3:16866812-16866834 TTTACCACAAGGATGTAACTGGG + Intronic
951153008 3:19314793-19314815 TTTTCAATATGGAATGATCTGGG - Intronic
951919512 3:27838952-27838974 TTTTCAACTTGGAGGGAGCTGGG + Intergenic
952162540 3:30708549-30708571 TTTCCTACATGGAAGGAAGTGGG - Intergenic
952591373 3:34958950-34958972 GCAGCAACATGGATGGAACTCGG - Intergenic
952726289 3:36589257-36589279 GCAACAACATGGATGGAACTGGG + Intergenic
952914601 3:38224286-38224308 GCTACAACATGGATGAAACTTGG - Intronic
953136157 3:40183411-40183433 TCTTCAACATGTATGGAATGTGG + Intronic
953264027 3:41368683-41368705 GCTACAACATGGATGGACCTTGG - Intronic
954595689 3:51822105-51822127 GCTACAACATGGATGAAACTTGG - Intronic
955730383 3:61979377-61979399 TGTTCAACAGGGATAGGACTAGG - Intronic
955806533 3:62741567-62741589 TTTTTAACATGAATGGATGTTGG - Intronic
956988668 3:74735833-74735855 TTTTCAAAATGGTTTAAACTAGG + Intergenic
957779239 3:84797312-84797334 GTAACAACATGGATGGAATTGGG + Intergenic
959731942 3:109614050-109614072 TTAGCAACATAGAAGGAACTGGG + Intergenic
960410822 3:117322268-117322290 GCTACAACATGGATGAAACTTGG + Intergenic
960587991 3:119338175-119338197 GTATCAACATGGATGTTACTTGG + Intronic
960662974 3:120080887-120080909 TTTTCATCATGGATGTACTTAGG - Intronic
960691936 3:120355536-120355558 GTTACAACATGGATGAATCTTGG + Intergenic
960783047 3:121341708-121341730 TTTACAACATGAATGGAACTGGG + Intronic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
961475533 3:127144013-127144035 TTTGCAACATCATTGGAACTGGG - Intergenic
961801079 3:129450067-129450089 TTTTTAATAGGGATGGAAATGGG + Intronic
963196914 3:142543023-142543045 TTTTAATCATGGAGTGAACTGGG + Intronic
963479055 3:145846147-145846169 GCAACAACATGGATGGAACTAGG - Intergenic
964413196 3:156420829-156420851 TTCTAAACAAGGATAGAACTAGG - Intronic
964915313 3:161834229-161834251 TTTTCAAAATGGTTTGAACTTGG + Intergenic
964932163 3:162039612-162039634 AGTTCAACATGGATGGCAATAGG + Intergenic
964975779 3:162618125-162618147 GTTACTACATGAATGGAACTGGG - Intergenic
966573200 3:181470514-181470536 GCAGCAACATGGATGGAACTAGG - Intergenic
970374014 4:15438358-15438380 TTTTTAATATGGCTGTAACTGGG + Intronic
971798449 4:31258562-31258584 GCTGCAACATGGATGGAGCTGGG + Intergenic
973033929 4:45381703-45381725 GTAACAACATGGATGGAACTGGG + Intergenic
974192972 4:58532476-58532498 GCAACAACATGGATGGAACTGGG - Intergenic
974626898 4:64437396-64437418 TTTGCAACATGTATTGAACATGG + Intergenic
975707977 4:77129484-77129506 GCAGCAACATGGATGGAACTGGG - Intergenic
976082366 4:81369685-81369707 GCAACAACATGGATGGAACTGGG - Intergenic
976557449 4:86465786-86465808 GTCTCAACATGGCTGTAACTGGG - Intronic
978035623 4:103989778-103989800 TCCACAACATGGATGAAACTGGG - Intergenic
978142706 4:105335877-105335899 GCAGCAACATGGATGGAACTGGG + Intergenic
978623128 4:110654558-110654580 TTGGCAACATGGTTGGGACTGGG + Intergenic
978955917 4:114613248-114613270 TTTTGGACATGTATGGTACTTGG - Intronic
979276235 4:118817168-118817190 TTTTTAAAATAGATGTAACTAGG - Intronic
979440788 4:120747913-120747935 ATTTCAACATGGAAGGCACCTGG - Intronic
979982389 4:127272968-127272990 GTCTCAACATGGCTGCAACTGGG + Intergenic
980283905 4:130757447-130757469 TTTCCATCATGGAAGGAACAAGG + Intergenic
980600146 4:135012815-135012837 TTTTCAAGGTGGAGGGAAATTGG - Intergenic
980667335 4:135956584-135956606 GTCTCAACATGGCTGCAACTGGG + Intergenic
981195738 4:141918430-141918452 GTAACAACATGGATGGAACTGGG + Intergenic
981863062 4:149380136-149380158 TTTTCAACATAGCTGAGACTGGG - Intergenic
982048905 4:151479475-151479497 TTCTCAAAAAGGATTGAACTGGG - Intronic
983643654 4:169967794-169967816 ATGGCAATATGGATGGAACTGGG - Intergenic
984186775 4:176553969-176553991 TATGCTACATGGATGAAACTTGG + Intergenic
984800730 4:183714477-183714499 TGATCAACATGGATGGCAGTGGG + Intergenic
986670957 5:10142150-10142172 GTAGCAACATGGATGGAACTGGG + Intergenic
986757175 5:10848612-10848634 GCAACAACATGGATGGAACTGGG + Intergenic
987103147 5:14610398-14610420 ATTTCAGCATGGAAGGAATTAGG + Exonic
987378172 5:17257440-17257462 TATTCTACATGAATGGAGCTGGG + Intronic
988491756 5:31711150-31711172 TGTTCATCATGGATGGATATTGG + Intronic
988625310 5:32868855-32868877 GTTTCAACATGGATGTAACTGGG + Intergenic
988645345 5:33089329-33089351 GTAGCAACATGGATGGAGCTGGG - Intergenic
989074370 5:37547941-37547963 GTAACAACATGGATGGAACTGGG - Intronic
989435464 5:41408132-41408154 GTTTCACCATGGATGGCAATGGG - Intronic
989530781 5:42505433-42505455 TTTTGAACATGCATGGCACAGGG - Intronic
990251412 5:53919286-53919308 TTCTCAACTTGGAAGGAATTAGG + Intronic
990263883 5:54055306-54055328 GTTACAACATGGATGAACCTTGG - Intronic
990604972 5:57400008-57400030 ACAGCAACATGGATGGAACTGGG - Intergenic
990652494 5:57917869-57917891 ATGGCAACATGGATGGAACTGGG - Intergenic
991284153 5:64951785-64951807 TCTACAACATGGATGGACCTTGG - Intronic
991368154 5:65890446-65890468 TTGACACCATGGATGTAACTAGG + Intergenic
991401140 5:66252952-66252974 TCTTCCACATGGAAGGAAATAGG - Intergenic
991528227 5:67587484-67587506 GCTACAACATGGATGAAACTTGG + Intergenic
991601721 5:68357704-68357726 TTTTCAGAATGGATTTAACTTGG + Intergenic
992337874 5:75791921-75791943 TTTTTAACATGAATGGATGTTGG + Intergenic
994028266 5:95110461-95110483 GTTCCAATATGGAAGGAACTTGG + Intronic
994088620 5:95787697-95787719 GCTACAACATGGATGAAACTTGG + Intronic
994100501 5:95886269-95886291 TCTTCAAAAGGGATGAAACTTGG + Exonic
994226703 5:97260400-97260422 GCAACAACATGGATGGAACTGGG + Intergenic
994476695 5:100280164-100280186 GCAACAACATGGATGGAACTGGG - Intergenic
994856710 5:105130965-105130987 TTGTCAGCATGCATGAAACTGGG - Intergenic
996244546 5:121245184-121245206 TTGTCAACATGAATGGATCATGG + Intergenic
996947417 5:129087209-129087231 TTTTATACATAGATGGAACGTGG - Intergenic
997305695 5:132834531-132834553 TTTTCAATAGAGATGGAGCTAGG + Intergenic
997785461 5:136707970-136707992 GCAGCAACATGGATGGAACTGGG + Intergenic
998329006 5:141306881-141306903 CTCACAACATGGATGGAGCTGGG + Intergenic
998670317 5:144346152-144346174 GCAGCAACATGGATGGAACTGGG - Intronic
1000653512 5:163847725-163847747 TTTTCTATATGGATGGATGTAGG + Intergenic
1000661579 5:163945924-163945946 TTTTCTATATGGATTGATCTGGG + Intergenic
1001230995 5:169988286-169988308 TTTGCAACAGTGATGGATCTCGG - Intronic
1001332836 5:170774198-170774220 TTTCCAACATGGATGGAACTGGG + Intronic
1002782578 6:378936-378958 TTTTCAATATTGATCGCACTGGG + Intergenic
1003494334 6:6651015-6651037 GTGGCAACATGGATGGAACTGGG - Intronic
1003594083 6:7459175-7459197 TCTACAACATGGATGAATCTTGG - Intergenic
1003939838 6:11013733-11013755 TTTTCAAGATGGTTAGAATTGGG + Intronic
1004883347 6:20029929-20029951 GCTTCAACATGGATGAAACTGGG - Intergenic
1006276771 6:33010425-33010447 TTTTCAACTTGGAGGGAGCTAGG + Intergenic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007886893 6:45240198-45240220 GTGTCAACATGGCTGCAACTGGG - Intronic
1008619941 6:53261936-53261958 TGTTCAAGATGGAAGGAACCAGG + Intergenic
1009062469 6:58414269-58414291 TTCTCAACATGGCTGCAACCGGG + Intergenic
1009250156 6:61288833-61288855 GTCTCAACATGGCTGCAACTGGG + Intergenic
1009720763 6:67466675-67466697 TATTCAACATGGAAGGATATGGG - Intergenic
1010645438 6:78382217-78382239 TTTACAACATGGATGGACCTGGG + Intergenic
1011174899 6:84549586-84549608 TCAACAACATGGATGGAACTGGG - Intergenic
1011402354 6:86977330-86977352 GTAGCAACATGGATGGAGCTGGG - Intronic
1012738365 6:102980121-102980143 TTTTCAAAATGAAGGTAACTTGG + Intergenic
1012739091 6:102991301-102991323 TAAACAACATAGATGGAACTGGG + Intergenic
1013039227 6:106417420-106417442 TTTTCAACAAGGCTGGGAATAGG - Intergenic
1013175407 6:107672438-107672460 TTTACACCATGGATGTAAATTGG - Intergenic
1013864689 6:114681130-114681152 TCTTCAACATGGTTGGCAATTGG + Intergenic
1014371807 6:120618978-120619000 TTTTCAACGTGGATGAAAAATGG + Intergenic
1014506005 6:122257369-122257391 TTTTCAAAATATATGAAACTTGG + Intergenic
1014663778 6:124209265-124209287 GCAACAACATGGATGGAACTGGG - Intronic
1014910094 6:127081639-127081661 GCAGCAACATGGATGGAACTGGG - Intergenic
1015722000 6:136252043-136252065 TTTTCTACCTGGATCAAACTGGG - Intergenic
1016291098 6:142528951-142528973 TTTTCAAAATGTTTGGACCTGGG - Intergenic
1016314990 6:142775025-142775047 TTTTCAACTAGGATGAAATTGGG + Exonic
1016593898 6:145777005-145777027 TTTTTAACATGAATGGATGTTGG + Intergenic
1016733559 6:147451912-147451934 TGAACAACATGGATTGAACTGGG - Intergenic
1017384970 6:153872748-153872770 TTTTCAGTGTGGATGGAACCAGG - Intergenic
1018605619 6:165595123-165595145 ATTTCCACATGGCTGGACCTGGG - Intronic
1018884573 6:167923392-167923414 TTCTTAACATGTATGAAACTGGG - Intronic
1020846274 7:13288317-13288339 TTTGCAACATGTATGGAACTGGG + Intergenic
1020922921 7:14287453-14287475 TTTTCATCATGGTTGGCATTTGG + Intronic
1021247062 7:18276203-18276225 TTTTTAACCTGTATGAAACTAGG + Intronic
1022018280 7:26373677-26373699 CATTCAACATGGATGAAACTTGG - Exonic
1022181697 7:27926794-27926816 TCCCCAACATGGAAGGAACTGGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024686312 7:51749701-51749723 TCAGCAACATGAATGGAACTTGG - Intergenic
1024915120 7:54490467-54490489 GCAGCAACATGGATGGAACTAGG - Intergenic
1026082583 7:67235302-67235324 TTTTCTAAATGTATGTAACTGGG + Intronic
1026677102 7:72437158-72437180 TTTTGAAAATGCCTGGAACTAGG + Intronic
1026694485 7:72578700-72578722 TTTTCTAAATGTATGTAACTGGG - Intronic
1027241588 7:76333629-76333651 TTTTCAGGCTGTATGGAACTAGG - Intronic
1028549385 7:92041380-92041402 TTTTAATCATGAATGGAAATCGG + Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030883397 7:114909549-114909571 GCAACAACATGGATGGAACTGGG - Intergenic
1031068628 7:117136631-117136653 TCTACAACATGGATTGAAATAGG + Intronic
1031078432 7:117234885-117234907 GCAACAACATGGATGGAACTGGG - Intergenic
1031320088 7:120314237-120314259 TTTTCAAAATGCATTGAACCCGG + Intronic
1031376821 7:121036414-121036436 ACTGCAACCTGGATGGAACTGGG - Intronic
1033369014 7:140692333-140692355 GTTACAACATGGATGAAACCTGG - Intronic
1034127079 7:148683095-148683117 TTTGCAACATGGATGGAACGTGG + Intergenic
1036408608 8:8478051-8478073 TTTTCAACATTCAAGGAATTAGG - Intergenic
1037441854 8:18924479-18924501 TTTTCACCACGGATAGAAGTTGG - Intronic
1038396040 8:27246181-27246203 CTTTCTACATGGAAGGAAATGGG + Intronic
1039299575 8:36194933-36194955 TTTTCAACATGGATCGCCATGGG - Intergenic
1039610671 8:38916564-38916586 GCAACAACATGGATGGAACTGGG - Intronic
1040381745 8:46879687-46879709 GTCTCAACATGGCTGTAACTAGG - Intergenic
1040956008 8:52980619-52980641 TTCTCCACATGGCTGCAACTGGG + Intergenic
1041182327 8:55261572-55261594 TTTTCAAAATTGATGGAAGGTGG + Intronic
1041302407 8:56426517-56426539 GCTGCAACATGGATGGAGCTGGG - Intergenic
1041855149 8:62444514-62444536 TTAGCAACATGGATAGAGCTGGG - Intronic
1042783992 8:72526252-72526274 GTAGCAACATGGATGGAACTAGG - Intergenic
1043311171 8:78861238-78861260 TTTTGTCTATGGATGGAACTAGG - Intergenic
1044551360 8:93516219-93516241 TCTTTAACATGGAAGGAGCTTGG - Intergenic
1045172961 8:99691054-99691076 GTTTCAACATGGATGAACCTTGG + Intronic
1045436698 8:102171383-102171405 TTTTCAACGAGGATGAAAGTAGG + Intergenic
1046267789 8:111853895-111853917 GCAACAACATGGATGGAACTGGG - Intergenic
1046984096 8:120368561-120368583 TTTTCAACACTGTTGGAACCCGG + Intronic
1047217578 8:122889036-122889058 GTAGCAACATGGATGAAACTGGG - Intronic
1047563299 8:126012516-126012538 GTCTCAACATGGCTGCAACTGGG - Intergenic
1047999966 8:130370746-130370768 GCTACAACATGGATGAAACTTGG + Intronic
1051066743 9:13113891-13113913 TTTTAAACATGGTTTGAATTTGG - Intronic
1051821437 9:21174100-21174122 TGTTCAACATGTATGCAACATGG - Intergenic
1052024279 9:23557432-23557454 TGTGCAACATGGATGGACCTTGG + Intergenic
1052053661 9:23879642-23879664 ATAGCAACATGAATGGAACTGGG - Intergenic
1052214161 9:25945055-25945077 CTAACAACATGGATGGAACTGGG - Intergenic
1056252555 9:84764904-84764926 GCACCAACATGGATGGAACTGGG + Intronic
1056823685 9:89862082-89862104 TTTTCAACAAGCATGTAGCTTGG + Intergenic
1057123234 9:92595860-92595882 TTTTAAAAATGGAAGGAAATAGG - Intronic
1057537044 9:95920562-95920584 TCTTGAACATGGATGGCGCTAGG - Intronic
1058365656 9:104205756-104205778 CTTTCCACATGTAAGGAACTTGG + Intergenic
1058555373 9:106161028-106161050 TTATCAAGATGGAGGGCACTGGG + Intergenic
1058850636 9:109008563-109008585 TTTTCAAAATGGTTGTAACACGG + Intronic
1058880513 9:109282085-109282107 GCTTCCACATGGATGGACCTAGG + Intronic
1060495701 9:124117100-124117122 TATGCAACATGGATGGCTCTCGG - Intergenic
1060747794 9:126149192-126149214 TATTCAACATGGATGATTCTAGG + Intergenic
1061288460 9:129637545-129637567 TTTCCAACATGGGGGGGACTTGG + Exonic
1062251402 9:135597259-135597281 TTTTCAACATGGAAGCCTCTGGG - Intergenic
1062509968 9:136899727-136899749 TTTACAACATGGGTGGGGCTGGG + Intronic
1186927156 X:14346778-14346800 TGTAAAACATGGATGGAACTGGG - Intergenic
1186999033 X:15156315-15156337 TTATTAACATGGATGGAAAGTGG + Intergenic
1187368606 X:18685115-18685137 GTTTCCACATGGATTCAACTGGG + Intronic
1187879759 X:23835882-23835904 TTTTCTACAAGGATTGAGCTGGG - Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189627214 X:42911729-42911751 TCAGCAACATGGATGAAACTGGG + Intergenic
1189964409 X:46357160-46357182 GCAACAACATGGATGGAACTGGG - Intergenic
1190020255 X:46867797-46867819 GCAGCAACATGGATGGAACTAGG - Intronic
1190443135 X:50495631-50495653 ATTTCAAAAAGGATGGAACTTGG - Intergenic
1191015044 X:55800320-55800342 GCAGCAACATGGATGGAACTGGG + Intergenic
1191732676 X:64354007-64354029 GCAACAACATGGATGGAACTGGG + Intronic
1191810599 X:65183261-65183283 TCATCAACATGGATGGAGTTGGG + Intergenic
1191829385 X:65399875-65399897 GCAACAACATGGATGGAACTGGG + Intronic
1191833474 X:65439856-65439878 GTCTCAACATGGCTGCAACTGGG + Intronic
1192377148 X:70574692-70574714 TTTTCTGCCTGCATGGAACTTGG + Intronic
1192886583 X:75341688-75341710 GCAACAACATGGATGGAACTGGG - Intergenic
1193425169 X:81333427-81333449 TTTTTAACATGGAAGGATGTTGG + Intergenic
1194225139 X:91246984-91247006 TCAACAACATAGATGGAACTGGG - Intergenic
1194521480 X:94923583-94923605 GCAACAACATGGATGGAACTGGG + Intergenic
1195769305 X:108332148-108332170 GCAGCAACATGGATGGAACTGGG - Intronic
1196352253 X:114745648-114745670 TCAACAACATGAATGGAACTGGG + Intronic
1196357126 X:114808267-114808289 GCAACAACATGGATGGAACTGGG - Intronic
1196929830 X:120670519-120670541 TCTACAACATGGATGAAACTTGG + Intergenic
1197013985 X:121602002-121602024 TTTTCAACATGGATGGATGTTGG + Intergenic
1197110360 X:122766065-122766087 TTTTCAAAATTAATGAAACTGGG + Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1198407391 X:136327277-136327299 TTTTAAAAAGGGATGGCACTGGG + Intronic
1198559964 X:137838840-137838862 GCAACAACATGGATGGAACTGGG + Intergenic
1198563351 X:137877326-137877348 GCTACAACATGGATGGACCTTGG + Intergenic
1198570733 X:137953298-137953320 GCAACAACATGGATGGAACTAGG - Intergenic
1198938441 X:141925353-141925375 GCAACAACATGGATGGAACTGGG - Intergenic
1199391892 X:147289940-147289962 TTTTCACCAAGGATTGAAGTAGG + Intergenic
1199545562 X:149004577-149004599 TCTTCAGCATGGCTGGACCTGGG + Intergenic
1200561607 Y:4710291-4710313 TCAACAACATAGATGGAACTAGG - Intergenic
1200949492 Y:8880570-8880592 TCAACAACATGGGTGGAACTAGG + Intergenic
1201470987 Y:14334821-14334843 TTTTCATCATGGAAGGTCCTTGG + Intergenic
1201700627 Y:16877795-16877817 GTCTCAACATGGCTGCAACTGGG - Intergenic
1201730753 Y:17200289-17200311 GCAGCAACATGGATGGAACTGGG - Intergenic