ID: 905993792

View in Genome Browser
Species Human (GRCh38)
Location 1:42363436-42363458
Sequence CTGTGTGTCCAAAAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905993792_905993793 -4 Left 905993792 1:42363436-42363458 CCACTTTCTTTTTGGACACACAG No data
Right 905993793 1:42363455-42363477 ACAGTCTCATTCCATCACCCAGG 0: 5
1: 81
2: 690
3: 4689
4: 23943
905993792_905993796 10 Left 905993792 1:42363436-42363458 CCACTTTCTTTTTGGACACACAG No data
Right 905993796 1:42363469-42363491 TCACCCAGGTTGGAGTGCAATGG 0: 465
1: 18443
2: 117578
3: 221540
4: 217634
905993792_905993799 21 Left 905993792 1:42363436-42363458 CCACTTTCTTTTTGGACACACAG No data
Right 905993799 1:42363480-42363502 GGAGTGCAATGGTGTAATCTCGG 0: 154
1: 8490
2: 49852
3: 113244
4: 157491
905993792_905993794 0 Left 905993792 1:42363436-42363458 CCACTTTCTTTTTGGACACACAG No data
Right 905993794 1:42363459-42363481 TCTCATTCCATCACCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905993792 Original CRISPR CTGTGTGTCCAAAAAGAAAG TGG (reversed) Intergenic
No off target data available for this crispr