ID: 905995312

View in Genome Browser
Species Human (GRCh38)
Location 1:42376298-42376320
Sequence ATATAATCCTTCCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905995312_905995315 1 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995315 1:42376322-42376344 TCCTTTACTTCACTGACATCAGG No data
905995312_905995318 11 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG No data
905995312_905995317 6 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995317 1:42376327-42376349 TACTTCACTGACATCAGGTGTGG No data
905995312_905995319 20 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995319 1:42376341-42376363 CAGGTGTGGCCAGGTGAACTTGG No data
905995312_905995320 25 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905995312 Original CRISPR ATATAATCCTTCCCTGGGAA AGG (reversed) Intergenic