ID: 905995313

View in Genome Browser
Species Human (GRCh38)
Location 1:42376303-42376325
Sequence AGGAAATATAATCCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905995313_905995317 1 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995317 1:42376327-42376349 TACTTCACTGACATCAGGTGTGG No data
905995313_905995320 20 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data
905995313_905995318 6 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG No data
905995313_905995315 -4 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995315 1:42376322-42376344 TCCTTTACTTCACTGACATCAGG No data
905995313_905995319 15 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995319 1:42376341-42376363 CAGGTGTGGCCAGGTGAACTTGG 0: 1
1: 0
2: 4
3: 31
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905995313 Original CRISPR AGGAAATATAATCCTTCCCT GGG (reversed) Intergenic