ID: 905995316

View in Genome Browser
Species Human (GRCh38)
Location 1:42376323-42376345
Sequence ACCTGATGTCAGTGAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905995316_905995319 -5 Left 905995316 1:42376323-42376345 CCTTTACTTCACTGACATCAGGT No data
Right 905995319 1:42376341-42376363 CAGGTGTGGCCAGGTGAACTTGG No data
905995316_905995320 0 Left 905995316 1:42376323-42376345 CCTTTACTTCACTGACATCAGGT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905995316 Original CRISPR ACCTGATGTCAGTGAAGTAA AGG (reversed) Intergenic