ID: 905995316 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:42376323-42376345 |
Sequence | ACCTGATGTCAGTGAAGTAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905995316_905995319 | -5 | Left | 905995316 | 1:42376323-42376345 | CCTTTACTTCACTGACATCAGGT | No data | ||
Right | 905995319 | 1:42376341-42376363 | CAGGTGTGGCCAGGTGAACTTGG | No data | ||||
905995316_905995320 | 0 | Left | 905995316 | 1:42376323-42376345 | CCTTTACTTCACTGACATCAGGT | No data | ||
Right | 905995320 | 1:42376346-42376368 | GTGGCCAGGTGAACTTGGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905995316 | Original CRISPR | ACCTGATGTCAGTGAAGTAA AGG (reversed) | Intergenic | ||