ID: 905995318

View in Genome Browser
Species Human (GRCh38)
Location 1:42376332-42376354
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905995312_905995318 11 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG No data
905995314_905995318 5 Left 905995314 1:42376304-42376326 CCAGGGAAGGATTATATTTCCTT No data
Right 905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG No data
905995313_905995318 6 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr