ID: 905995320

View in Genome Browser
Species Human (GRCh38)
Location 1:42376346-42376368
Sequence GTGGCCAGGTGAACTTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905995312_905995320 25 Left 905995312 1:42376298-42376320 CCTTTCCCAGGGAAGGATTATAT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data
905995314_905995320 19 Left 905995314 1:42376304-42376326 CCAGGGAAGGATTATATTTCCTT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data
905995316_905995320 0 Left 905995316 1:42376323-42376345 CCTTTACTTCACTGACATCAGGT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data
905995313_905995320 20 Left 905995313 1:42376303-42376325 CCCAGGGAAGGATTATATTTCCT No data
Right 905995320 1:42376346-42376368 GTGGCCAGGTGAACTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905995320 Original CRISPR GTGGCCAGGTGAACTTGGTC TGG Intergenic