ID: 906001610

View in Genome Browser
Species Human (GRCh38)
Location 1:42431196-42431218
Sequence TCTCCAGGACCACCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906001610_906001617 10 Left 906001610 1:42431196-42431218 CCACTCTGGGGTGGTCCTGGAGA 0: 1
1: 0
2: 2
3: 25
4: 225
Right 906001617 1:42431229-42431251 CAGAGTTTTGACTTGGAAAGAGG 0: 1
1: 1
2: 0
3: 12
4: 225
906001610_906001614 3 Left 906001610 1:42431196-42431218 CCACTCTGGGGTGGTCCTGGAGA 0: 1
1: 0
2: 2
3: 25
4: 225
Right 906001614 1:42431222-42431244 TGTGGCCCAGAGTTTTGACTTGG 0: 1
1: 0
2: 0
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906001610 Original CRISPR TCTCCAGGACCACCCCAGAG TGG (reversed) Intronic
900161736 1:1227260-1227282 GCTCCAGGACCAGTGCAGAGGGG - Intronic
900222297 1:1515779-1515801 TCTCCAAGACCATCCCTGGGGGG + Intronic
900645835 1:3708336-3708358 TCTCCAGGGGCACCGCAGTGAGG - Intronic
900769743 1:4531187-4531209 CGCCCAGGACCACCCAAGAGTGG - Intergenic
901072080 1:6526036-6526058 ACTCCAGGTCCAGCCCAGAGGGG + Intronic
901684687 1:10937400-10937422 GTTCCAGGAGCACCCCAGAGGGG - Intergenic
903387384 1:22936452-22936474 ACCCCAGGACCACCAGAGAGTGG + Intergenic
903677723 1:25075003-25075025 TCACCAGGACCCCCGGAGAGAGG + Intergenic
903958249 1:27039972-27039994 TCTCAGGGACCACCCCAAAAGGG - Intergenic
904734627 1:32621542-32621564 CCTCCAGCCTCACCCCAGAGAGG - Exonic
906001610 1:42431196-42431218 TCTCCAGGACCACCCCAGAGTGG - Intronic
906993646 1:50766456-50766478 TCTTCAGCACTTCCCCAGAGTGG - Intronic
907603128 1:55789835-55789857 TCTTCAGGACCCTCCAAGAGTGG + Intergenic
909931449 1:81503683-81503705 TCTCCAGGACAATCCCTGATTGG - Intronic
912645299 1:111386598-111386620 GCTCCAGGACCACCTCAGCCTGG + Intergenic
914849907 1:151306670-151306692 TCTTCAGGACGAGCCCACAGAGG - Intronic
915069514 1:153254631-153254653 GCTCCAGGAGCACCCAAAAGAGG + Intergenic
916599247 1:166276171-166276193 CCTCCTGGACCTCCGCAGAGTGG + Intergenic
919230268 1:194764518-194764540 TCTTCTGGACCATCCCAGATGGG + Intergenic
921159149 1:212460820-212460842 CCTCCTGGACCTCCCCAGCGGGG + Intergenic
921720866 1:218469615-218469637 TCTTTAGGGCCACCCCAGAGTGG - Intergenic
922714515 1:227859943-227859965 TCTGCAGGACCTCCCCCAAGGGG - Intergenic
924628601 1:245716072-245716094 TCTTCAGCACCACCCCATTGAGG + Intergenic
1062796435 10:348100-348122 TCTCCAGGACCATGCCAAAAGGG + Intronic
1064692091 10:17928776-17928798 TCTCCTGGTCCACCAGAGAGTGG - Intergenic
1065131172 10:22621882-22621904 TTTCCATGACCACAACAGAGGGG + Intronic
1065590756 10:27259080-27259102 TCCCCAGGCCCACCCCATGGGGG + Intergenic
1065681763 10:28242592-28242614 TCTCCAGGACCCTTCCAGAGGGG + Intronic
1066198208 10:33122313-33122335 TCTCAGGGTCCACCCCGGAGAGG + Intergenic
1067409623 10:46053121-46053143 CTTCCAGAACCACCCCAGGGTGG + Intergenic
1068684367 10:59854465-59854487 TCTCTTGGACTACCCCAGAATGG - Intronic
1069773834 10:70915526-70915548 CCTCCAGGACCTCCCCAGCCTGG + Intergenic
1072271318 10:93779824-93779846 CCTCCAGCACCAGCTCAGAGAGG - Intronic
1072662587 10:97371782-97371804 TCCCCAGGCCCATCCCAGACCGG - Intronic
1073077238 10:100831804-100831826 CCTCCAGGTCCACCCCAGACAGG + Intergenic
1076747830 10:132523217-132523239 CCTCCAGGACCACAGCAGAGGGG - Intergenic
1078069766 11:8100763-8100785 GCACCATGACCACCCCAGAAAGG - Intronic
1078251802 11:9622813-9622835 TCTCCACGTCCTCACCAGAGTGG + Intergenic
1078338334 11:10481523-10481545 TCTCCAAGACCACTCCAGGTTGG + Intronic
1082713020 11:56577622-56577644 TCGCCAGGAACACCCCAAACAGG + Exonic
1083417654 11:62535945-62535967 CCTCCTTGACCACCCCAGTGCGG + Exonic
1083718221 11:64591297-64591319 CCTCCAGCATCTCCCCAGAGAGG - Exonic
1085400506 11:76232963-76232985 TATGCAGGACCACCCTAGGGGGG - Intergenic
1088342901 11:108789002-108789024 TCAACAGGGCCAGCCCAGAGAGG - Intronic
1088811360 11:113395021-113395043 TCTCCAGGAACATCTCAGGGGGG - Exonic
1089658844 11:119972516-119972538 GCTCCAGCACCACCCCAGGCAGG - Intergenic
1091413920 12:263630-263652 TCTGCAGGAACAGCCCACAGAGG + Intergenic
1091615558 12:2048515-2048537 TCTCTACGACCAACACAGAGTGG + Intronic
1091678707 12:2510756-2510778 ACTCCAAACCCACCCCAGAGGGG + Intronic
1092532965 12:9360441-9360463 TCTTCAGGATCCCCCGAGAGGGG - Intergenic
1092695757 12:11169824-11169846 GCTCCAGTACCACTCCAGCGAGG - Intronic
1092919447 12:13218089-13218111 TCTCCATGACCACTCAAGAATGG + Exonic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1096084817 12:48858312-48858334 TCCCCAGGGCCACTCCAGAGGGG + Intronic
1096809188 12:54158940-54158962 TCTCCAAGGCCATCCCACAGAGG - Intergenic
1097573062 12:61356732-61356754 TCACCAGGCCCACCCCACTGAGG - Intergenic
1097729907 12:63116589-63116611 TCTCAAGACCCTCCCCAGAGAGG - Intergenic
1098054768 12:66493148-66493170 TGCCCAGGCCCATCCCAGAGGGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101828906 12:108242112-108242134 ACTCCAGCCCCTCCCCAGAGAGG + Intronic
1102183120 12:110927814-110927836 TCTCCAAGGCCACCATAGAGTGG - Intergenic
1102572208 12:113833698-113833720 TCTTCAGGACCACCAGAGAGGGG - Intronic
1102872492 12:116424975-116424997 TCTGAAGGAACTCCCCAGAGAGG + Intergenic
1106005860 13:25769736-25769758 TGTCCAGGACCACCCCTGTGAGG + Intronic
1106474992 13:30090693-30090715 TGTCTAGGACCACCCAAGTGAGG - Intergenic
1106858182 13:33875301-33875323 TCTCCAGGCCCTCCCCAAACTGG - Intronic
1108523222 13:51263166-51263188 TCTCCAGGCCCAGCCCACAGGGG + Intronic
1111736304 13:92143992-92144014 TCTCCAAAACCACCTTAGAGGGG + Intronic
1111759975 13:92450801-92450823 TCTCCAGGACCAACCTGTAGCGG + Intronic
1113065391 13:106368906-106368928 TCTTCAGGCCCCTCCCAGAGAGG + Intergenic
1114084462 14:19229341-19229363 TGCCCAGGACCAGCCCAGTGAGG - Intergenic
1118259462 14:64233875-64233897 TCTTCAGCACCACACCAGGGGGG + Intronic
1119171037 14:72536671-72536693 TCTCCCTGACCAGCCCAGAGAGG + Intronic
1120204315 14:81571561-81571583 TCTTCTCGACCACCCAAGAGTGG - Intergenic
1121244177 14:92450558-92450580 TTTCCAGGACAACCTCAGAAGGG + Intronic
1124553056 15:30700010-30700032 TCTCCAGGAACTTCCCAGTGAGG + Intronic
1124678187 15:31705660-31705682 TCTCCAGGAACTTCCCAGTGAGG - Intronic
1126181560 15:45790510-45790532 TCTCCACCACCACCCCCTAGTGG + Intergenic
1127708830 15:61574920-61574942 TCTCCTCAACCACCCCAGTGAGG - Intergenic
1129295112 15:74595988-74596010 TCTCCAGGACAATCCCTGATTGG - Exonic
1129678851 15:77646702-77646724 TCCCCAGGAGCACCCCAGGAAGG + Intronic
1130409425 15:83632134-83632156 TCTCCAAGACCACCTCAGCCTGG + Intergenic
1131434769 15:92413979-92414001 CCTCCAGGCCCAGCCCAAAGTGG + Intronic
1132581396 16:686301-686323 TGTCCAGGCCCACCCCAGGTAGG + Intronic
1132738869 16:1401132-1401154 TCTAGAGCACCACCCCAGAGAGG + Intronic
1133887534 16:9844537-9844559 GCTCCACCACCACCCAAGAGAGG + Intronic
1134826378 16:17287674-17287696 TCTCCAGGAGCCCCACACAGTGG - Intronic
1135483568 16:22843821-22843843 TCTTCAGACCCTCCCCAGAGAGG - Intronic
1143457787 17:7078870-7078892 TCCCCAGCTCCACCCCAGACTGG - Exonic
1143756596 17:9072211-9072233 GCTCCAGGGCCACCCGGGAGGGG - Intronic
1144026656 17:11282780-11282802 TGTCCAGCCCCAACCCAGAGGGG + Intronic
1146281435 17:31547455-31547477 TCTCCAAGACCACCACATTGGGG + Intergenic
1148720921 17:49752597-49752619 TAACCATGACCACCCCACAGAGG + Intronic
1150178058 17:63083149-63083171 CCTTCAGGACCACCCCTGAATGG + Intronic
1151162016 17:72173853-72173875 CCTCCAGGACCACCCCAGGCAGG + Intergenic
1151539725 17:74758845-74758867 TCTCCAGGCCCAGCACTGAGAGG - Intronic
1151600996 17:75105945-75105967 CCTCCAGGACCAGCCATGAGTGG + Exonic
1151827438 17:76531118-76531140 CCTCCAGAATGACCCCAGAGAGG + Exonic
1151993994 17:77597080-77597102 TCATGAGGACCACCCCAGAGAGG - Intergenic
1152110380 17:78354462-78354484 TCTCCCTGCCCACCCCAGGGAGG - Intergenic
1154280331 18:12996622-12996644 TCTCCTAGACCTCCACAGAGTGG - Intronic
1157553961 18:48600486-48600508 GCTCAAGGACATCCCCAGAGTGG - Intronic
1157894950 18:51457083-51457105 TCTCCCCACCCACCCCAGAGAGG + Intergenic
1163368622 19:16889709-16889731 CCACCAGGACCAGCCCATAGAGG - Exonic
1164124519 19:22299855-22299877 ACTCCAGTGTCACCCCAGAGAGG - Intronic
1165316184 19:35056743-35056765 TCTCCAGGATCACCCCTCACTGG + Intronic
1166139131 19:40796579-40796601 TCTCCAGGACCAGCCCTGCTGGG + Exonic
1167510916 19:49894995-49895017 GCTCCATGCCCACACCAGAGTGG - Intronic
926007631 2:9384847-9384869 TCTTAAGGCCCTCCCCAGAGAGG - Intronic
927794063 2:26033506-26033528 TCTCCAGGGCCAGCCCTGACGGG - Intergenic
930095574 2:47563572-47563594 TCTCCAAGACCAGCCCAAAGCGG - Intronic
931288707 2:60854013-60854035 TCTTCACGTCCATCCCAGAGGGG + Intergenic
931772712 2:65512359-65512381 TTTCCAGGTCCACCCAAGATTGG - Intergenic
932611285 2:73202375-73202397 TCCCCACGACCGCCCCAGGGTGG + Exonic
933144010 2:78828772-78828794 TCTCCAGGACCACATCAGAACGG + Intergenic
934655261 2:96114090-96114112 CCTCCAAGACCGCCCCAGCGAGG + Exonic
934809350 2:97267071-97267093 TCTCCAGGTCCCACCCAGTGAGG + Intergenic
934828100 2:97489881-97489903 TCTCCAGGTCCCACCCAGTGAGG - Intergenic
936109255 2:109651538-109651560 TCTTCAGGGCCACCCTTGAGAGG - Intergenic
937043303 2:118837192-118837214 CCTCCAGGACCAGCGCAGAGGGG - Intergenic
937452392 2:122012357-122012379 TCTCCAGAACCTCCCCAGCTGGG + Intergenic
938123058 2:128647088-128647110 TGCCCAGCACCACCCCAGAGGGG + Intergenic
938492121 2:131766758-131766780 TGCCCAGGACCAGCCCAGTGAGG + Exonic
938495446 2:131795585-131795607 TGCCCAGGACCAGCCCAGTGAGG - Exonic
941958447 2:171229135-171229157 TTTCCAGGACCTGCCCAGTGAGG + Intronic
942201702 2:173577885-173577907 TCTCCAAAGTCACCCCAGAGTGG + Intergenic
943124691 2:183782073-183782095 TCTCCAAGACCACCTCAGCTTGG - Intergenic
944436018 2:199690537-199690559 TTTCAAAGACCACCTCAGAGAGG + Intergenic
944857829 2:203785351-203785373 TCTCCAAGGCCCCACCAGAGTGG + Intergenic
945977542 2:216282472-216282494 CCTCCACCACCACCCCAGAGAGG + Intronic
948699103 2:239749417-239749439 GCACCAAGACCACCCCTGAGGGG + Intergenic
1168748423 20:264535-264557 TCTCCTGGACCACCACAGAGAGG - Intergenic
1168856691 20:1013770-1013792 CCCCCAGGAGCACCCCTGAGTGG + Intergenic
1172444517 20:34986050-34986072 TCTCCCACACCTCCCCAGAGTGG - Intronic
1173413977 20:42839460-42839482 TCTGGAGGGCAACCCCAGAGTGG - Intronic
1174127470 20:48317575-48317597 TCTCCAACACCACCCCAGTCGGG - Intergenic
1174856149 20:54047320-54047342 TATATAGGACCAGCCCAGAGGGG + Intronic
1174863320 20:54112695-54112717 TCACAAGCACCACCTCAGAGAGG - Intergenic
1175901321 20:62360983-62361005 TCTCCACGGCAACCCCAGGGTGG - Intronic
1176039092 20:63055055-63055077 GTTCCAGGAGCACACCAGAGGGG + Intergenic
1176044319 20:63084425-63084447 TCTCCCGGACGCCCCCAGCGGGG + Intergenic
1176673422 21:9754907-9754929 TATCCAGGCCCACCACACAGTGG + Intergenic
1179154364 21:38836962-38836984 TCTCCAGGCACAGCCCACAGAGG + Intergenic
1179661573 21:42879291-42879313 TCCCCGGGGTCACCCCAGAGTGG + Intronic
1179928553 21:44551774-44551796 TCACCAGGTCAGCCCCAGAGAGG - Intronic
1179940607 21:44637092-44637114 TCACCAGGTCAGCCCCAGAGAGG + Intronic
1180293510 22:10863861-10863883 TGCCCAGGACCAGCCCAGTGAGG + Intergenic
1180496315 22:15893276-15893298 TGCCCAGGACCAGCCCAGTGAGG + Intergenic
1181867414 22:25869657-25869679 TCTCCAGGAGCCCACCAGGGTGG + Intronic
1181913841 22:26263162-26263184 TTTCCACAACCACCCAAGAGGGG + Intronic
1182041759 22:27243503-27243525 TTTCCAGGTCTTCCCCAGAGCGG - Intergenic
1182498417 22:30727546-30727568 GCCACAGAACCACCCCAGAGAGG + Intronic
1183265803 22:36824338-36824360 CCTCCAGTACCACCCAAGAAGGG - Intergenic
1183317703 22:37145987-37146009 TCTGCAGGACCCCCTCACAGGGG + Intronic
1183422691 22:37721360-37721382 TCACCAACACCAGCCCAGAGAGG + Intronic
1184834472 22:47013003-47013025 TCTCCCGGTCCACCCCAGCTCGG - Intronic
950197828 3:11021743-11021765 TCCCCTGGACCACCCCAGGTCGG + Intronic
950964853 3:17139025-17139047 CCTCCAGGAGCTCCCCAGGGAGG - Intergenic
952204994 3:31172407-31172429 TCTTCATGACCTCCTCAGAGGGG - Intergenic
953384683 3:42499845-42499867 TCTACAGGACTCCCCAAGAGTGG + Intronic
953887479 3:46723725-46723747 TCCCCAGGAGCACCAGAGAGTGG + Intronic
956200773 3:66703186-66703208 TCTCAGGTCCCACCCCAGAGAGG - Intergenic
957969635 3:87366421-87366443 CCTTCAGGACCAACTCAGAGAGG + Intergenic
961337450 3:126190058-126190080 TCTCCAGGGGCGCCCCAGAAAGG + Intronic
961459165 3:127039349-127039371 TCTCCAGGAAGGCCCCAAAGGGG - Intergenic
961510086 3:127395554-127395576 TCTCCAGGACTGCCCCACGGTGG - Intergenic
961578411 3:127857410-127857432 TCTCCACCACCCCACCAGAGGGG - Intergenic
961643892 3:128382172-128382194 TCTCCACAAGCAGCCCAGAGGGG - Intronic
961650934 3:128416329-128416351 CCTGCAGGACCTCCCCACAGCGG + Intergenic
964827751 3:160848994-160849016 TCTCCAGTACTACCGCAGGGTGG + Intronic
964999931 3:162940472-162940494 TCCCCATGACCACCCCAGCTGGG - Intergenic
966949438 3:184803185-184803207 TCTCCAGTGCAACTCCAGAGAGG + Intergenic
968834693 4:2954939-2954961 TCTCCAGGCCCTGCCCAGGGAGG - Intronic
968849583 4:3069846-3069868 CCTCCAGCCCCACCCCTGAGAGG - Intergenic
969418003 4:7073680-7073702 GCTCCAGGAACATCCCAGACAGG + Intergenic
970097971 4:12486743-12486765 TCTCCATAACCACCACAGATGGG + Intergenic
973865402 4:55107878-55107900 TCTTCAGTCCCACCCCAGATTGG - Exonic
977486698 4:97657538-97657560 TCTTCAGGCCCACCCCTGTGTGG - Intronic
981857404 4:149310808-149310830 TTTTCAGGACCACCCCTGAGTGG - Intergenic
982105142 4:152005115-152005137 CCTCCAGGCCTACCACAGAGGGG + Intergenic
984090479 4:175368394-175368416 TCCCCAGGACCAGTCCAGACTGG + Intergenic
986783209 5:11085933-11085955 TCTCCTGTACCATCCCAGAATGG + Intronic
987941518 5:24544680-24544702 TCTCCAGGACCATCCCAGATTGG - Intronic
989737001 5:44719814-44719836 TCTCCAGGATGACCAAAGAGAGG + Intergenic
991861068 5:71013740-71013762 TCCCCATGACCATCCCTGAGGGG + Intronic
996550938 5:124729305-124729327 CCTCCAAGAGCATCCCAGAGAGG + Intronic
997009860 5:129863094-129863116 TCTCCAGGCCCTATCCAGAGTGG - Intergenic
999309828 5:150544896-150544918 GCTCCAGGACTGCCCCAGGGAGG - Intronic
1000210230 5:159101098-159101120 TCTCGAGGACTGCCCGAGAGAGG - Intergenic
1001316370 5:170643877-170643899 TCCCCAGGACCACTTGAGAGGGG - Intronic
1001789661 5:174445158-174445180 ACTTCAGGCCCACCCCAGAGAGG - Intergenic
1001980061 5:176031714-176031736 TCTCCTGGCCTTCCCCAGAGGGG + Intronic
1002173077 5:177386063-177386085 GCTCCAGGACCTCCCCACAGGGG - Exonic
1002237321 5:177811949-177811971 TCTCCTGGCCTTCCCCAGAGGGG - Intergenic
1002276113 5:178105255-178105277 TCTCCTGGCCTTCCCCAGAGGGG + Intergenic
1002447246 5:179297181-179297203 TCTCCTAGACCACAGCAGAGGGG + Intronic
1002898435 6:1392289-1392311 TCGGCAGGACCACACCGGAGAGG + Intronic
1002939460 6:1703369-1703391 TCTCCAGTTCCACCCGAAAGTGG + Intronic
1005994661 6:30923932-30923954 GCTCCACTGCCACCCCAGAGTGG + Intronic
1008487781 6:52054037-52054059 TCACGAGGACCAGCCCCGAGAGG - Exonic
1015179393 6:130345583-130345605 TCTCCTGAAACACCCCCGAGAGG + Intronic
1016004949 6:139079742-139079764 TCTCCAGCACCCCCCCGGTGAGG - Intergenic
1016153377 6:140772170-140772192 TCTCCAGGACAACACCAAGGGGG + Intergenic
1018914364 6:168123798-168123820 TGACTAGGCCCACCCCAGAGTGG + Intergenic
1020092301 7:5348582-5348604 TCTGCTGGGCCACCTCAGAGAGG + Intronic
1020246579 7:6434067-6434089 GCTCCAGGACCAGCCCTGAATGG + Intronic
1021859392 7:24891272-24891294 CCTCCAGGATCTCCCCTGAGGGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1025082293 7:55994212-55994234 TCTCCAGAACACCCTCAGAGGGG - Intronic
1029023192 7:97386654-97386676 TCTTCAGTACCACACCACAGAGG + Intergenic
1030207785 7:106967273-106967295 TCTCCAGGACCACAGAAAAGAGG + Intergenic
1030689086 7:112514419-112514441 TCTCCAGGACCATTCCCGGGAGG - Intergenic
1033460346 7:141541770-141541792 TCTCAAGAACCATCCCATAGAGG - Intergenic
1035014330 7:155751627-155751649 TTGGCAGGAACACCCCAGAGGGG + Intronic
1036225278 8:6952808-6952830 ACTCCCAGGCCACCCCAGAGGGG - Intergenic
1036739898 8:11350517-11350539 CTTCCATGACCAACCCAGAGAGG + Intergenic
1036749064 8:11431835-11431857 TCTCCAGTAACCCCCCAGAGAGG - Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038780450 8:30565056-30565078 TCTCCAGGACCCCTCCACACAGG - Intronic
1039563398 8:38530891-38530913 TCCACAGGACTCCCCCAGAGAGG - Intergenic
1040455520 8:47593938-47593960 CCTCTGGCACCACCCCAGAGGGG + Intronic
1040654056 8:49484044-49484066 TCTTCAGGATGACACCAGAGTGG - Intergenic
1042156051 8:65844924-65844946 CCTCTAGAACCACCACAGAGAGG + Intergenic
1045066778 8:98454457-98454479 GCTCCAGGCCCACCCCAGTTTGG - Intronic
1045131828 8:99163016-99163038 TCTCCAAGGCCCCACCAGAGCGG + Intronic
1045543757 8:103110236-103110258 CCTCCTGAACCACCTCAGAGTGG + Intergenic
1046594696 8:116247772-116247794 CCTCCAGGGCCATGCCAGAGTGG - Intergenic
1047942402 8:129838109-129838131 TTCTCAGGACCACCCTAGAGAGG + Intergenic
1051165719 9:14260249-14260271 TCTCCTGGTCCACCCCAGGATGG + Intronic
1056060631 9:82882206-82882228 CCTCCAGGACCCCACAAGAGAGG + Intergenic
1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG + Intergenic
1057201412 9:93142349-93142371 TCACTGGGACCAGCCCAGAGGGG + Intergenic
1057417695 9:94879545-94879567 TCTCCAGGAATACCCCATAAAGG + Intronic
1057865588 9:98677840-98677862 GCTCCAGCACCATCTCAGAGAGG + Intronic
1058875626 9:109242334-109242356 ACAGCAGGCCCACCCCAGAGAGG + Intronic
1059857954 9:118422156-118422178 TATAAAGGACCACCCCAGACAGG - Intergenic
1060270286 9:122135276-122135298 TCTACAAAACCACCCCAGAAGGG + Intergenic
1061419710 9:130466600-130466622 TCTCCAGCATGTCCCCAGAGAGG - Intronic
1062409457 9:136415477-136415499 TCTCCTGGTCCACCCCTGACAGG - Intronic
1062492094 9:136810271-136810293 GCACCAGGACCACCCCTGTGTGG + Intronic
1185831645 X:3308879-3308901 TCTCCAGGAACCCTCCAGTGGGG - Exonic
1187498300 X:19814898-19814920 TCTCCAGGCCAACCACAGACAGG + Intronic
1191257319 X:58285274-58285296 TCTCTACGACCACCCCAGATCGG + Intergenic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1194245060 X:91500473-91500495 TCTGCAGGGTCACCCCAGAAAGG + Intergenic
1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG + Intergenic
1195569840 X:106385762-106385784 TCTCCAGCACCTGCCCAGTGAGG + Intergenic
1196396461 X:115267805-115267827 TCTCCAGTACCACACAAGAAAGG + Intergenic
1198436862 X:136625580-136625602 TCACTAGGACCATCACAGAGAGG + Intergenic
1198694005 X:139316263-139316285 TCTCCAGAGCCATCCCAGAGAGG - Intergenic
1199050127 X:143228428-143228450 TCTCCAAGGCCCCACCAGAGCGG + Intergenic
1200158136 X:153988915-153988937 CCCCCAGGACCAACGCAGAGAGG - Intergenic
1200564035 Y:4741783-4741805 TCTGCAGGGTCACCCCAGAAAGG + Intergenic