ID: 906004668

View in Genome Browser
Species Human (GRCh38)
Location 1:42458017-42458039
Sequence AGGTCATTCCAGGTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906004660_906004668 21 Left 906004660 1:42457973-42457995 CCAAAAATCAAAACAAAATGAGC 0: 1
1: 0
2: 7
3: 131
4: 1402
Right 906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG 0: 1
1: 1
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906004668 Original CRISPR AGGTCATTCCAGGTGGAGTA TGG Intronic
901027148 1:6284731-6284753 AGGTCCATCCAGGTGGGGTTGGG + Intronic
904302252 1:29561848-29561870 AGGTGAATCCAGGTGGAATGAGG + Intergenic
905187271 1:36205464-36205486 ATGTCAGTGCAGGTGGAGCAGGG + Intergenic
906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG + Intronic
906977324 1:50589385-50589407 AGGTGACTCCAGGTGGGGAAGGG + Intronic
907071478 1:51539515-51539537 AGGTCATTGTAGCTGGTGTATGG - Intergenic
910009794 1:82447468-82447490 AGGTCACTCCAGTTGTAGTGTGG + Intergenic
910616255 1:89201618-89201640 AGTTCATTCCAAGTTGAATATGG - Intergenic
911886462 1:103306601-103306623 AGATCAGTCCAGGTGGAATCAGG + Intergenic
912455026 1:109791475-109791497 AGGGCATTCCAGGAGGAGAGAGG + Intergenic
913583563 1:120250791-120250813 AGGTCATTCCAGCTGCATTCTGG - Intergenic
913624613 1:120647529-120647551 AGGTCATTCCAGCTGCATTCTGG + Intergenic
914565551 1:148862627-148862649 AGGTCATTCCAGCTGCATTCTGG - Intronic
914607274 1:149267625-149267647 AGGTCATTCCAGCTGCATTCTGG + Intergenic
916024601 1:160822912-160822934 AGGGTATTCTAGGTGGAGGAGGG - Intronic
916389663 1:164318156-164318178 AGGTAATAGCACGTGGAGTAAGG + Intergenic
917687768 1:177434940-177434962 AGTTCAATGCAGGTGGGGTATGG - Intergenic
920349475 1:205328500-205328522 TGGTCATTCCAAGTGGAGGCAGG - Intergenic
922038566 1:221873651-221873673 AGGACATTCCATGCGGAGGAGGG - Intergenic
923225985 1:231939416-231939438 AGTTCATTACAGATGGAGAAAGG - Intronic
923525766 1:234771444-234771466 AGATCATACCAGTTGGAATACGG - Intergenic
1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG + Intronic
1063924026 10:10959767-10959789 AGGTCATTTCCTGTGGGGTATGG - Intergenic
1067276552 10:44840072-44840094 AGCTCATTTCAGGTGGGGTGTGG - Intergenic
1071472225 10:85991738-85991760 AGGTCATTTCAGGAGAAGGAGGG + Intronic
1075319360 10:121477607-121477629 AGGCCATTCATGGTGGAGCAAGG - Intergenic
1078792815 11:14561632-14561654 AGGACAGTCCAGGTGGAGTTGGG - Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1079293434 11:19209802-19209824 AGGACATTCCAGGCAGAGGAGGG - Intronic
1079493904 11:21019403-21019425 GGGTCATTCCAGGCACAGTATGG + Intronic
1082933709 11:58635217-58635239 AGCTCTCTCCTGGTGGAGTATGG + Intergenic
1083408053 11:62472211-62472233 AGGTCAATCCAAGTGGAGGCCGG - Intronic
1086817392 11:91389933-91389955 AGGTCATTCAAAGTGGAAGAGGG - Intergenic
1087542553 11:99538978-99539000 ATGTAAACCCAGGTGGAGTAGGG + Intronic
1088193438 11:107251225-107251247 AAGTCATTCCAATTGGATTACGG + Intergenic
1089627605 11:119761546-119761568 AGGTCAGTCCAGGTTGTGAAGGG - Intergenic
1091754696 12:3043769-3043791 AGGGCATTCCAGGTGGGGAAAGG + Intergenic
1092024778 12:5231505-5231527 AGGTCAGTAGAGGTGGAGTCAGG - Intergenic
1093674882 12:21927021-21927043 AAGTCATTCCAGGAGAGGTATGG + Intronic
1095257143 12:40051901-40051923 AGATCATTCTAGTTGGAGTACGG + Intronic
1095644257 12:44524191-44524213 AGGTGAGGCCAGGTGAAGTATGG - Intronic
1096412503 12:51387625-51387647 AGGCCCTTCCAGGTGGGGCAGGG + Intronic
1096652551 12:53069016-53069038 TGCTCATTCAAGTTGGAGTAGGG + Intronic
1098874133 12:75849304-75849326 AGGTCATTCCAGGTGAGTGAAGG - Intergenic
1102708056 12:114899670-114899692 AGGTCATTCCAGGTGGAGTTGGG + Intergenic
1104139230 12:125971697-125971719 TGGTCTCTCCAGGTGGAGTACGG - Intergenic
1106860015 13:33895444-33895466 TGGCCATTCTAGCTGGAGTAAGG - Intronic
1109583269 13:64367787-64367809 AGGCCATTCCAGGTTGGGCATGG - Intergenic
1110685755 13:78372011-78372033 TGGTCATTCTGGCTGGAGTAAGG + Intergenic
1111297326 13:86297642-86297664 AGTTCATCCCTGGTGGAGAAAGG - Intergenic
1112363786 13:98740302-98740324 TGGACAGTCCAGGTGGAGTGCGG - Intronic
1117534091 14:56687722-56687744 AGTACATTGCAGATGGAGTAGGG + Intronic
1122313151 14:100810064-100810086 AGGTCATCCCATGTGGGATAAGG + Intergenic
1125365831 15:38914644-38914666 ATGTGATTTCAGGTGGAGAATGG + Intergenic
1129277697 15:74457954-74457976 TGGGCAGTCCAGGTGGAGGAGGG - Intronic
1129508443 15:76102489-76102511 AGAGCATTCCAGGTGGAGAAAGG + Intronic
1132333868 15:101030650-101030672 ATGTCATTCCAGGTGGGGTGAGG - Intronic
1132958105 16:2607116-2607138 AGGGCAGGCCAGGTGGAATACGG + Intergenic
1132970579 16:2686364-2686386 AGGGCAGGCCAGGTGGAATACGG + Intronic
1133777637 16:8909962-8909984 AGGTCAGTCCAGTTGGACTGAGG - Intronic
1137327882 16:47460533-47460555 AGGTGATTCCATGGGGAGGAGGG + Intronic
1137708685 16:50551671-50551693 AGGTGATTTCAGGTGGAATCTGG + Intronic
1138881628 16:61022949-61022971 TGCTGTTTCCAGGTGGAGTAAGG - Intergenic
1139487066 16:67263928-67263950 AGGAGATTCCAGCTGGAGAAAGG + Intronic
1140774479 16:78237561-78237583 AGGTCATTCCAGGTCAACCAGGG - Intronic
1142247387 16:88976281-88976303 AGGGCATCCCAGGAGGAGGAGGG + Intronic
1143163272 17:4885132-4885154 AGGGCATTCCAGGGGGAGAGGGG - Intronic
1143862139 17:9898719-9898741 AGATCATGCCAGGGGGAGTGTGG + Intronic
1144874116 17:18388259-18388281 AGGGGATTTCTGGTGGAGTAAGG + Exonic
1146589991 17:34120667-34120689 AGGTTATACTAGATGGAGTAAGG + Intronic
1146884397 17:36461542-36461564 GGACCATTCCAGGTGGTGTATGG + Intergenic
1148086616 17:44997538-44997560 AGGTCATACCAGGTGGAGCTGGG + Intergenic
1149237570 17:54610801-54610823 AGGTTGTTCAATGTGGAGTAAGG + Intergenic
1149291344 17:55220570-55220592 AGGTGATTCCAGGTTGACAAAGG - Intergenic
1154126038 18:11692935-11692957 ATGTCTTTCCAGGTAGAGCATGG - Intronic
1158366686 18:56744651-56744673 AGGTGATTTCAGGTGCAGCATGG - Intronic
1161113583 19:2483964-2483986 AGGTCATTCCAGGTCTTGTTTGG - Intergenic
1165120403 19:33555286-33555308 AGGTCATTTCAGGGAGAGGAAGG - Intergenic
1167695036 19:51010169-51010191 AGGGAAATCCAGGTGGAGTGAGG + Intergenic
927942766 2:27115850-27115872 AGGACATTCCAGATTGAGGATGG - Intronic
929306359 2:40367305-40367327 AGGGAATTCCAGGTTGACTAGGG - Intronic
930186435 2:48416371-48416393 AGCTCATGCCACGTGGAGGATGG + Intergenic
931989656 2:67777146-67777168 AGGACATTCCAGATGGTGTGAGG - Intergenic
932809272 2:74810655-74810677 AGTGCATTCCAGGTTGAGAATGG + Intergenic
935189604 2:100766306-100766328 TGGGCATTCCAGGTTGAGGAAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936677477 2:114731900-114731922 AGCACATTCCATGTGGAGTATGG + Intronic
937667038 2:124499479-124499501 AGGTCATGCCTGGTGGAGGAAGG + Intronic
937830485 2:126416384-126416406 ATGTCATTTTAGCTGGAGTAAGG - Intergenic
939106879 2:137959306-137959328 AGGAAATTCCAGATGCAGTATGG + Intergenic
942438333 2:176004931-176004953 AGATCATTCCAGCTGCAGTGTGG + Intergenic
942661351 2:178268543-178268565 ATGGCATTCCAAGGGGAGTATGG - Intronic
1169826038 20:9769815-9769837 AGGTCATATCAGATGGAGAATGG - Intronic
1170735816 20:19013360-19013382 GGGTGATTCCAGGTGGATGATGG + Intergenic
1172308311 20:33897628-33897650 AGGACATTCCAGGAGGACTGGGG - Intergenic
1172511658 20:35505008-35505030 AAGTCACTCCATGGGGAGTAAGG + Intronic
1173278673 20:41607104-41607126 AGTTCATTCTGGCTGGAGTATGG - Intronic
1173867810 20:46323689-46323711 ACGTCCTTCCAGGTGAAGCATGG - Intergenic
1174530461 20:51208721-51208743 AGGTCATTCCTGAAGGAGTGAGG + Intergenic
1174751966 20:53120156-53120178 TGCTCATTCCATGTGGAGAAGGG - Intronic
1176365281 21:6029092-6029114 AGGTCATGCCAGCTGGTGTGAGG + Intergenic
1177352878 21:19967670-19967692 AGGTCATTGCAGATGTAGTTAGG + Intergenic
1179758237 21:43509453-43509475 AGGTCATGCCAGCTGGTGTGAGG - Intergenic
1182754385 22:32666932-32666954 AGGACATTCCAGGTAGAGGCTGG - Intronic
1184162373 22:42704691-42704713 ACTTCATTCCAGGAGGAATAAGG + Intronic
952788363 3:37177116-37177138 AGGTAATGACAGGTGTAGTATGG + Intronic
956204885 3:66745057-66745079 ATTTCATTCCAGGGGGAGTCTGG + Intergenic
956252471 3:67249282-67249304 AGGTCCCTCCAAGTGGAGTCAGG + Intergenic
962174441 3:133138291-133138313 AAGTCATTCCTTGTGGGGTAAGG - Intronic
963738969 3:149055793-149055815 AGACCAGTCCTGGTGGAGTATGG - Intronic
963795753 3:149629179-149629201 AGGTCTTTCCAGTAGGAGTTGGG - Intronic
965376076 3:167926108-167926130 CTGACATTCCTGGTGGAGTAGGG - Intergenic
970926965 4:21463201-21463223 AAGTCATTCTAACTGGAGTAAGG + Intronic
971041155 4:22753713-22753735 ATGGCATTCCAGGTGGAGGAAGG - Intergenic
972007087 4:34123048-34123070 AGGACATTCGTGGTGGAGTAGGG - Intergenic
972171518 4:36351195-36351217 AGGGCCTTTCAGGTGGAGTGAGG - Intergenic
974576641 4:63733022-63733044 AGGTCATTCCTGGTTGAAGAAGG - Intergenic
975748905 4:77502407-77502429 AGGTCAGTCCTGGTGGAATGAGG + Intergenic
976738525 4:88334726-88334748 AGGTCACTCCAGCTGTAGCATGG - Intergenic
977842648 4:101727605-101727627 AAGCCATTCTATGTGGAGTAAGG - Intronic
980463225 4:133145693-133145715 AGGTCAATCCTGGTGGAGCCTGG + Intergenic
982110687 4:152050846-152050868 AGTTCCTTCCAGGAGGAGGAGGG + Intergenic
985840227 5:2300313-2300335 AGGTCTGTCCAGGTGAGGTAAGG + Intergenic
987768588 5:22269686-22269708 AAGTCATTTCAGGTGAAGGATGG - Intronic
992187555 5:74258826-74258848 AGGGCATTGCAGGTAGAGAATGG - Intergenic
993158534 5:84258488-84258510 AGGGCAATCCAGGTAGAGTGAGG + Intronic
993794504 5:92249723-92249745 GGGTCCTGCCTGGTGGAGTAGGG - Intergenic
993887918 5:93438607-93438629 AGATCATTCCAGCTGCAGTATGG - Intergenic
995554392 5:113312539-113312561 AGGTCAATGCAGCTGGAGAATGG + Intronic
995907031 5:117136946-117136968 AGGTCATTCCATGTGTGGAATGG + Intergenic
995919677 5:117296475-117296497 AGGTCATGCATGGTGGTGTAGGG + Intergenic
996089053 5:119332618-119332640 AGGTCAACCAAGGTGCAGTAGGG + Intronic
997158870 5:131586360-131586382 AGGTCATTCTAGGCTGGGTATGG + Intronic
997254199 5:132415216-132415238 AGGTTATTTCAGGTGGCGCAGGG + Intronic
997426090 5:133803628-133803650 TGGTCTTTCTGGGTGGAGTAGGG + Intergenic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
999024362 5:148209314-148209336 AGCTCACTCCAGATGGAGTCAGG - Intronic
1008305749 6:49897372-49897394 TGGTCATTCTTGCTGGAGTAAGG - Intergenic
1008340652 6:50359967-50359989 TGGTCATTCTTGCTGGAGTAAGG - Intergenic
1010320033 6:74496304-74496326 AAGTAATTCAAGATGGAGTAAGG - Intergenic
1014271502 6:119341409-119341431 AGATTATCCCAGGTGGAGTGGGG + Intronic
1015523764 6:134156728-134156750 AGATCATTCCAGGTAAAATATGG + Intergenic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1021927204 7:25545257-25545279 AGGACCTTCCAGGAGCAGTAAGG - Intergenic
1023000064 7:35800105-35800127 AGGTTATTCCGAGTGAAGTAAGG + Intergenic
1023615363 7:42014220-42014242 CTTTTATTCCAGGTGGAGTAAGG - Intronic
1030320609 7:108163882-108163904 AGGTCATACCGGGTGGGGTGGGG + Intronic
1030320628 7:108163943-108163965 AGGTCATACCGGGTGGGGTGGGG + Intronic
1030320646 7:108164004-108164026 AGGTCATACCAGGTGGGGTGGGG + Intronic
1030320664 7:108164065-108164087 AGGTCATACCAGGTGGGGTGGGG + Intronic
1030320674 7:108164095-108164117 AGGTCATACCGGGTGGGGTGGGG + Intronic
1030320693 7:108164156-108164178 AGGTCATACCGGGTGGGGTGGGG + Intronic
1030320702 7:108164186-108164208 AGGTCATACCAGGTGGGGTGGGG + Intronic
1030320711 7:108164216-108164238 AGGTCATACCAGGTGGGGTGGGG + Intronic
1032654165 7:133909473-133909495 AGAGCACTCCAGGTGGAGAAAGG + Intronic
1034386868 7:150747595-150747617 AGGACATGCCAGGTGGAGACAGG - Intronic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1035177547 7:157062518-157062540 AGGGCATTGCAGGTGGGGGAGGG + Intergenic
1035262834 7:157672534-157672556 AGGTGATTCCAGGTCGGGAAAGG + Intronic
1035403725 7:158585888-158585910 AGGTCAAGCCAGCTGGAGGAAGG + Intronic
1037727810 8:21497726-21497748 AGGTCATTGTGGATGGAGTAGGG + Intergenic
1039805916 8:40998000-40998022 GGGTCCTTCCAAGTGGAGGATGG - Intergenic
1039912146 8:41834166-41834188 AGGTCACTCCAGCAGGAGGAGGG + Intronic
1040304203 8:46203602-46203624 AGGTCAGCCCTGGTGGCGTATGG - Intergenic
1042788601 8:72578323-72578345 AGTTCATTCCATCTGTAGTATGG - Intronic
1044639192 8:94360565-94360587 AGGGCATGCCAGCTGGAATAAGG - Intergenic
1045752241 8:105498736-105498758 AGTTCATTCCTGGTGGAGCTTGG + Intronic
1048009797 8:130446398-130446420 AGAACATTGAAGGTGGAGTAGGG + Intergenic
1048094742 8:131279442-131279464 ACTTAATTCCATGTGGAGTAGGG - Intergenic
1048320577 8:133396718-133396740 ATGCCATGCCAGGTGGAATATGG + Intergenic
1049184653 8:141243445-141243467 ATGTCATTTCAGGTTTAGTATGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055819487 9:80244740-80244762 ATTTCATTCCAGTTGTAGTATGG + Intergenic
1056143831 9:83709451-83709473 AAGTCATTCTAGGTAGAGGAAGG - Intergenic
1059255163 9:112923717-112923739 AGGTCTGTCCATGTTGAGTATGG + Intergenic
1059505957 9:114800110-114800132 GGCTCATCCCAGGTGGAGTGGGG + Intronic
1061716213 9:132520029-132520051 AGGACATTTCAGGGGGAGGAAGG - Intronic
1186149586 X:6660300-6660322 AAGTCAGTCCAGGTTGAGCACGG + Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1189878420 X:45462397-45462419 TGGTCATTCTGGCTGGAGTAAGG - Intergenic
1192206958 X:69102714-69102736 AGGTCATTCAAGCTGGGGTGGGG - Intergenic
1192623659 X:72705513-72705535 AGGACATTCCACCTGGAGAAAGG + Intronic
1195859677 X:109369773-109369795 AGTTGATTCCAGTTGGATTAAGG + Intergenic
1198545847 X:137692009-137692031 AGGACATGCCAGTTGGAGTTAGG + Intergenic
1199444864 X:147910681-147910703 AGATGATTCCAGCTGGAATATGG - Intergenic