ID: 906006154

View in Genome Browser
Species Human (GRCh38)
Location 1:42472933-42472955
Sequence ATGTGTATGTATATATATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3404
Summary {0: 1, 1: 0, 2: 51, 3: 515, 4: 2837}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906006154_906006156 1 Left 906006154 1:42472933-42472955 CCAAGATATATATACATACACAT 0: 1
1: 0
2: 51
3: 515
4: 2837
Right 906006156 1:42472957-42472979 CATAAGTGTGATGAAGGTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 109
906006154_906006155 -5 Left 906006154 1:42472933-42472955 CCAAGATATATATACATACACAT 0: 1
1: 0
2: 51
3: 515
4: 2837
Right 906006155 1:42472951-42472973 CACATACATAAGTGTGATGAAGG 0: 1
1: 0
2: 1
3: 23
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906006154 Original CRISPR ATGTGTATGTATATATATCT TGG (reversed) Intronic
Too many off-targets to display for this crispr