ID: 906022638

View in Genome Browser
Species Human (GRCh38)
Location 1:42644057-42644079
Sequence AACTTTTACTTGGTGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906022634_906022638 -9 Left 906022634 1:42644043-42644065 CCCAGAAGTTTATTAACTTTTAC 0: 1
1: 1
2: 3
3: 26
4: 324
Right 906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG 0: 1
1: 0
2: 1
3: 21
4: 320
906022635_906022638 -10 Left 906022635 1:42644044-42644066 CCAGAAGTTTATTAACTTTTACT 0: 1
1: 1
2: 1
3: 19
4: 383
Right 906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG 0: 1
1: 0
2: 1
3: 21
4: 320
906022633_906022638 1 Left 906022633 1:42644033-42644055 CCATGTACAGCCCAGAAGTTTAT 0: 1
1: 0
2: 2
3: 21
4: 192
Right 906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG 0: 1
1: 0
2: 1
3: 21
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906022638 Original CRISPR AACTTTTACTTGGTGTATTA GGG Intronic
904957596 1:34298062-34298084 CTCCTTTACTTGGTGTAGTATGG + Intergenic
906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG + Intronic
908674385 1:66586300-66586322 ATCTTTTAGTTGGTATATTTAGG + Intronic
909415984 1:75406176-75406198 AACTTGTTATTGGTCTATTAAGG - Intronic
909672715 1:78206894-78206916 AACTTGTTATTGGTGTATTCAGG - Intergenic
910826895 1:91418730-91418752 AAAAATTACATGGTGTATTAGGG - Intergenic
911126053 1:94341975-94341997 AACTTTTACTGGGAGTATAACGG - Intergenic
915027723 1:152847954-152847976 AACTTGTACTTGCTCTGTTAGGG - Intergenic
915991949 1:160526641-160526663 AACTTTTTATTGGTCTATTTAGG + Intergenic
916343465 1:163761764-163761786 AACTTTTTATTGGTCTATTCAGG - Intergenic
916821927 1:168408197-168408219 AATTTTTACTTTATGTATTTTGG - Intergenic
916963352 1:169910951-169910973 TATTTTCACTGGGTGTATTAGGG + Intergenic
918377921 1:183927833-183927855 AACTTTTAGGAGCTGTATTATGG - Exonic
919031241 1:192245572-192245594 AACTTGTTATTGGTGTATTCAGG + Intergenic
919219681 1:194610474-194610496 CAATATTACTTGGTGTTTTAAGG - Intergenic
919445412 1:197698875-197698897 AACTTGTTATTGGTGTATTCAGG - Intronic
921102297 1:211939603-211939625 CTTTTTAACTTGGTGTATTATGG - Intergenic
922111139 1:222556952-222556974 AGCTTTAACTTGGTTTATTTTGG + Intergenic
922397719 1:225219622-225219644 AACTTTTTATTGGTCTATTCAGG - Intronic
923644209 1:235799599-235799621 AAATTTTAGTTGGAGAATTAAGG - Intronic
1063071152 10:2665979-2666001 GTCTTTTACTTGATGTATTTAGG - Intergenic
1066140165 10:32497068-32497090 AACTTGTAATTGGTCTATTCAGG + Intronic
1066217836 10:33305312-33305334 AACCTTTTCATGGTATATTAGGG + Intronic
1066780014 10:38934459-38934481 TACTTATACATGGTGTAATATGG - Intergenic
1067923566 10:50484361-50484383 AACTTGTTATTGGTCTATTAAGG - Intronic
1069014754 10:63417392-63417414 AACTTTTAGTATGTATATTATGG + Intronic
1069123468 10:64598960-64598982 AATTTTTAAGTGGTGTAATAAGG + Intergenic
1069348647 10:67499609-67499631 AACTTGTTATTGGTGTATTCAGG + Intronic
1069673625 10:70232238-70232260 AACTCTGAGTTGGTGTATGAAGG - Intronic
1070355926 10:75640149-75640171 AACTTTTACATGGCGTTTAAAGG + Intronic
1070375538 10:75827475-75827497 AAGTTTTATTTGGTCTCTTATGG + Intronic
1071076918 10:81765876-81765898 AACTTGTTATTGGTGTATTCAGG + Intergenic
1071401470 10:85277073-85277095 AACTTGTAATTGGTCTATTCAGG + Intergenic
1073520510 10:104124293-104124315 AAGTTTTACCTGGTGTTTAAGGG - Intronic
1075830872 10:125409673-125409695 AATTTTTACTTTATGTATTTGGG + Intergenic
1076550271 10:131273464-131273486 AACTTTTCCTTGGCGTTTTGTGG - Intronic
1079300157 11:19271313-19271335 AACTTGTTATTGGTCTATTAAGG - Intergenic
1081373452 11:42332165-42332187 AATTTTTCCTAGGTATATTACGG - Intergenic
1081514693 11:43815504-43815526 AAGTCTTTCTTTGTGTATTATGG + Intronic
1082182891 11:49142127-49142149 AACTTTTTATTGGTCTATTCAGG - Intergenic
1086421651 11:86643484-86643506 TACTTTTTCTTGGTGTGTCAAGG - Intronic
1091477420 12:789379-789401 AACTTTTACTTAGCATAGTATGG + Intronic
1092386606 12:8040335-8040357 AACTTTTATAAGGTATATTAGGG + Intronic
1092463624 12:8708521-8708543 AACTTTTCCTTTGTTTATTAAGG + Intronic
1093664143 12:21792231-21792253 AACTTTTTATTGGTCTATTCAGG + Intergenic
1094244029 12:28266449-28266471 AGCTTTTACTAGGTGAATTATGG + Intronic
1094253261 12:28391499-28391521 TCCATTTACTTGGTGTATTTTGG + Intronic
1095914762 12:47466459-47466481 AACTTGTTATTGGTGTATTCAGG + Intergenic
1096015764 12:48272785-48272807 AACTTTTTATTGGTCTATTCAGG + Intergenic
1096914726 12:55019415-55019437 AACTTTTAATTTGTGAATTTAGG - Intergenic
1097140518 12:56899079-56899101 AACTTTTGATTGGTGAATGATGG + Intergenic
1097397191 12:59090068-59090090 AACTTCCAGTTGCTGTATTATGG + Intergenic
1097517896 12:60628330-60628352 AGCTTTTATTTGATGTATGAGGG + Intergenic
1097941310 12:65309578-65309600 TATTTATACTTGGTGTGTTATGG + Intronic
1098726146 12:73970217-73970239 AACTTTTTATTGGTCTATTCAGG + Intergenic
1098852793 12:75617510-75617532 AACTTGTTATTGGTGTATTCAGG - Intergenic
1099185140 12:79507774-79507796 AACTTGTTATTGGTGTATTCAGG + Intergenic
1099297372 12:80845447-80845469 AAATGTTACTTGGAGTATTATGG + Intronic
1099397159 12:82154877-82154899 AATTTTTAATTGGTAAATTAGGG - Intergenic
1099404156 12:82239525-82239547 AACTTTTATTTTGTGTATAAGGG + Intronic
1099532794 12:83806362-83806384 AATTTTTACTTGAAATATTAAGG + Intergenic
1099664954 12:85616512-85616534 AACCTTTCCTTTTTGTATTAAGG - Intergenic
1099809221 12:87559621-87559643 AACTTGTTATTGGTCTATTAAGG - Intergenic
1099987352 12:89682949-89682971 AACATTTATTTTATGTATTAGGG - Intronic
1100761047 12:97807676-97807698 AACTTGTTATTGGTCTATTAAGG - Intergenic
1100956302 12:99912676-99912698 AAATTTTACTTTGAGTGTTAAGG + Intronic
1101691142 12:107083156-107083178 AACTTGTTATTGGTGTATTCAGG - Intronic
1102419669 12:112793833-112793855 ATCTTTTAATTGCTGGATTATGG + Intronic
1102762841 12:115403980-115404002 AACTCTTACATGGTGTTTTGAGG - Intergenic
1103099146 12:118157200-118157222 GACTTTTACCTGGGGTATGAGGG - Intronic
1103168844 12:118795816-118795838 AACTTTTTATTGGTCTATTCAGG + Intergenic
1106297101 13:28424597-28424619 AACTATTAATTGGTTTAATATGG - Intronic
1106336193 13:28785239-28785261 AACTTGTTATTGGTGTATTCAGG + Intergenic
1108532894 13:51344053-51344075 AACTTTTAATTGGTGGATCCAGG + Intronic
1108770482 13:53694523-53694545 AACTTTTTCCTGGTTTATTATGG - Intergenic
1109096930 13:58130766-58130788 AACTTTTTATTGGTCTATTCAGG + Intergenic
1109902496 13:68792635-68792657 AACTTTTTATTGGTCTATTCAGG + Intergenic
1110035675 13:70679926-70679948 AAATTTTACTTATTGTATTTTGG - Intergenic
1110317055 13:74121042-74121064 AACTTTTATTTGGAGTGTTTTGG - Intronic
1110737151 13:78950498-78950520 AACTTTTTATTGGTGTATTCAGG + Intergenic
1111350965 13:87031004-87031026 ATCTTTTTATTGGTGTATTTAGG - Intergenic
1111677264 13:91402270-91402292 AACTTTTCCTTGGTAGATTTTGG + Intronic
1114519418 14:23323714-23323736 AGCTTCTACTTGGCCTATTATGG + Intronic
1117641359 14:57802779-57802801 AACTTGTTATTGGTGTATTCTGG - Intronic
1119907629 14:78320083-78320105 AACATTTACCTGGTGTCTTCAGG + Intronic
1120134561 14:80851010-80851032 AACTTTTACTTTCTGTCTTCAGG + Intronic
1120304520 14:82751856-82751878 TACTTTTATGTGGTGTTTTATGG - Intergenic
1122296251 14:100707884-100707906 ATCTTTTACTTGGGATATTTAGG - Intergenic
1123792381 15:23734711-23734733 AACATTTACTTTCTGTATTTTGG + Intergenic
1124017750 15:25892123-25892145 ATCTTTTACTTGCTGACTTAGGG + Intergenic
1124683896 15:31762115-31762137 TACTTTTAGTGGGTGAATTATGG + Intronic
1124848706 15:33315259-33315281 AACTTGTACCTGGTGGTTTATGG + Intronic
1124987096 15:34630791-34630813 TAGTTTATCTTGGTGTATTAGGG + Intergenic
1125809799 15:42528500-42528522 AATTTTTATTTGTTTTATTAGGG - Intronic
1127461320 15:59201903-59201925 AAATTCTACTTGGTCTTTTAGGG - Intronic
1129507634 15:76095791-76095813 AACTTGTTATTGGTGTATTCAGG + Intronic
1131373171 15:91900972-91900994 GATTTTTACTTCATGTATTATGG + Intronic
1131892698 15:96990466-96990488 ATCTTTTAATTGGTGCATTCAGG + Intergenic
1133510573 16:6453495-6453517 AACTTGTTATTGGTCTATTAAGG - Intronic
1137368640 16:47883678-47883700 AACTTTTACTGGGTGAATGAAGG - Intergenic
1138068093 16:53963171-53963193 AACTTTTACTTGTGTTATTATGG - Intronic
1139260268 16:65585563-65585585 AACTTTTTCTTTATGTATTTTGG + Intergenic
1140596061 16:76414058-76414080 AACTTCTAGTTAGTGTAATAAGG - Intronic
1142995786 17:3759528-3759550 AACTTTGCCTTGGTGCAGTATGG - Exonic
1144234705 17:13247296-13247318 AACTTTTGCTTAATGTATTTTGG - Intergenic
1144406296 17:14955715-14955737 AAATTTTAATTGGTGAAATAAGG + Intergenic
1144603411 17:16640188-16640210 AATTTTTACTTCTTGTCTTATGG - Intronic
1145784006 17:27582492-27582514 AACCTTTACCTGGTTTATAAAGG - Intronic
1147199633 17:38791733-38791755 TACTTCTACTCAGTGTATTAAGG + Intronic
1149812244 17:59687734-59687756 AACTTCTACTTTCTGTAATAAGG + Intronic
1150373290 17:64660815-64660837 AACTTTTATTTGGTTTGTAAAGG - Intronic
1153081465 18:1231231-1231253 AACTTTTGCTTTGTGCATTTAGG + Intergenic
1155389007 18:25313402-25313424 AGCTTTTACTTGGTGTGAAAGGG - Intronic
1156368318 18:36449746-36449768 AAATTTTTCTCGATGTATTAGGG + Intronic
1156755046 18:40513403-40513425 AACTTTTTATTGGTCTATTCTGG - Intergenic
1157066994 18:44363674-44363696 AACTTGTAATTGGTCTATTCAGG + Intergenic
1158463431 18:57667582-57667604 GACTTTCACTTGTTTTATTATGG - Intronic
1159072106 18:63636730-63636752 AATTTGTACTTGATGAATTAAGG - Intergenic
1159660617 18:71091562-71091584 AACTTGTTATTGGTCTATTAAGG + Intergenic
1163612140 19:18307258-18307280 AAATGTTACTTGGTGTTTTTTGG - Exonic
1164771691 19:30814685-30814707 AGATTTAACTTGGTGTTTTAGGG + Intergenic
1166645831 19:44530957-44530979 AACTGTTACTTAGGGTATGAGGG + Intergenic
925372102 2:3353449-3353471 AACTTTTAATGAGTGTAATAAGG + Intronic
926454183 2:13043742-13043764 AACTTTTTATTGGTCTATTCAGG - Intergenic
927021010 2:19017223-19017245 AACTTTTTATTGGTCTATTCAGG + Intergenic
927303689 2:21545311-21545333 AATATTTACATGGTGTAATAGGG - Intergenic
928825939 2:35420997-35421019 AACTTATACCTGGTTTATGAGGG - Intergenic
928859578 2:35841065-35841087 AACTTTTATTGGATATATTATGG - Intergenic
929102313 2:38327628-38327650 TTCTTTTAATTGGTGTATTTAGG - Intronic
930836958 2:55804326-55804348 AACTTTTTCTTGATGATTTAGGG - Intergenic
931183494 2:59927224-59927246 AAATTTTTCTTGGGTTATTAAGG + Intergenic
931578713 2:63749702-63749724 AACTTTCAATGGGTGTATCAGGG + Intronic
931856975 2:66313004-66313026 AACTTTAACTTGCAGTATCAGGG + Intergenic
933532916 2:83533256-83533278 AACTTGTAGTTGGTGTTATAAGG + Intergenic
935332310 2:101986044-101986066 GTCTTTTACTTTGTGTATTCTGG - Intergenic
935898963 2:107770036-107770058 AACTTTTTCTTGATGAATTTGGG - Intergenic
936639963 2:114300983-114301005 AACTTGTTATTGGTGTATTCAGG + Intergenic
936877235 2:117205320-117205342 AACTGCTCCTTGGTATATTAAGG - Intergenic
938749561 2:134315586-134315608 AACTTTTACTTGCTATATCTGGG - Intronic
939201842 2:139045545-139045567 ACCTTTTACTTGTTGTAAGATGG - Intergenic
939439528 2:142227406-142227428 AGCTTTTACTTTATGTATTTTGG - Intergenic
939526133 2:143296680-143296702 AACTTTTACTTTAGGTATTAGGG + Intronic
939725732 2:145719254-145719276 AACTTTTACTTTGTCTTCTATGG + Intergenic
941312909 2:163956412-163956434 CTATTTTACTTGGTGTATAAGGG - Intergenic
941608782 2:167634664-167634686 AACTTGTAATTGGTCTATTCAGG - Intergenic
942722546 2:178969047-178969069 AACTTGTTATTGGTGTATTCAGG - Intronic
943630276 2:190243454-190243476 GACTTTAAGTTGGTGTATCAGGG - Intronic
946991761 2:225339092-225339114 AACTTTTACTTGGTCTCTCTCGG + Intergenic
947100292 2:226613620-226613642 AGATTTTACTTGCTGTTTTAGGG + Intergenic
1170328328 20:15180420-15180442 AACTTCTATCTGGTGAATTAAGG + Intronic
1170469976 20:16659028-16659050 AACTTGTTCTTGGTCTATTCAGG + Intergenic
1170729909 20:18964671-18964693 AACATTTATTTGGGTTATTATGG + Intergenic
1172831097 20:37835369-37835391 ATCTTTTCCTATGTGTATTAGGG - Intronic
1176344146 21:5725731-5725753 AACTTTTTATTGGTCTATTCAGG + Intergenic
1176350960 21:5846315-5846337 AACTTTTTATTGGTCTATTCAGG + Intergenic
1176500681 21:7598725-7598747 AACTTTTTATTGGTCTATTCAGG - Intergenic
1176538467 21:8123800-8123822 AACTTTTTATTGGTCTATTCAGG + Intergenic
1177042368 21:16129880-16129902 AACTTGTAATTGGTCTATTCAGG + Intergenic
1177529791 21:22344273-22344295 AAATTTTTCTAGGTGGATTATGG - Intergenic
1177764078 21:25436936-25436958 AACTTGTTATTGGTCTATTAGGG - Intergenic
1178796901 21:35753162-35753184 AGCTTTTACTTGCTGTTTTTGGG - Intronic
1179516943 21:41914949-41914971 TACTTGTACTTGCTGTATTTGGG - Intronic
1181935374 22:26434303-26434325 ACCTTTTACTTGGTCAATCAGGG + Exonic
949155318 3:819948-819970 AACTTTTTATTGGTCTATTCAGG - Intergenic
949377958 3:3410799-3410821 AACTTGTAATTGGTCTATTCAGG - Intergenic
950803282 3:15573372-15573394 GACTTTTACTTTTTTTATTAAGG - Intronic
951467988 3:23022535-23022557 ATCTTTTAATTGGAGTATTTTGG - Intergenic
952766823 3:36961497-36961519 AATTTTATCTTGGTCTATTAAGG - Intergenic
953092278 3:39740649-39740671 AACTTGTTATTGGTGTATTCAGG + Intergenic
957626702 3:82661638-82661660 AACTTGTTATTGGTGTATTCAGG + Intergenic
957629779 3:82704093-82704115 AACTTGTTCTTGGTCTATTAAGG + Intergenic
958562426 3:95764406-95764428 CATTTTTTCTTGATGTATTATGG + Intergenic
958855029 3:99374937-99374959 GACTTTTACTTTGTATGTTATGG + Intergenic
960276915 3:115739048-115739070 AACATTTTATTGGTCTATTAAGG + Intergenic
961986040 3:131135985-131136007 TACTATTACATGGAGTATTATGG + Intronic
963409655 3:144911413-144911435 AAATTTTACTTGTTTTATTTTGG + Intergenic
963876146 3:150477386-150477408 AACTTTTGCTTTATGTATTTAGG + Intergenic
963997778 3:151730243-151730265 GACTTTTAATTGGAGCATTATGG - Intergenic
964266805 3:154906637-154906659 GTCTTTTAATTGGTGTATTTAGG - Intergenic
965494021 3:169375643-169375665 AACTTGTTATTGGTGTATTCAGG - Intronic
965621619 3:170647817-170647839 AACTTGTTATTGGTGTATTCAGG + Intronic
966692417 3:182755527-182755549 CATTTTTATTTGGTGTATGAGGG - Intergenic
967424365 3:189309337-189309359 AACTGTCACTTCCTGTATTAAGG - Intronic
967638932 3:191837925-191837947 AACTTTTTATTGGTCTATTCAGG - Intergenic
968115767 3:196088410-196088432 AACTTTTACTTTGGGTTTCAAGG - Intergenic
968696205 4:2029494-2029516 AACTTGTTATTGGTGTATTCAGG + Intronic
970019188 4:11547898-11547920 AAATTTTACTTTCTCTATTAGGG - Intergenic
970885479 4:20983713-20983735 AACTTTTACTTTGAGTATTAAGG + Intronic
971134216 4:23849217-23849239 AATTTTTATCTGATGTATTACGG - Intronic
971729416 4:30358175-30358197 AACTTTTAATTGGTTTGTTCAGG + Intergenic
971909235 4:32773501-32773523 CACTATTACTTCATGTATTATGG - Intergenic
972143441 4:35990641-35990663 AATTTTTACTTCATGTATTGTGG - Intronic
972664916 4:41156129-41156151 AAATGTTACTTGGTGGATAATGG - Intronic
972860653 4:43165435-43165457 AAATTTTACTTTTTGTATGACGG + Intergenic
973081554 4:46000038-46000060 AACTTTTTATTGGTCTATTCAGG + Intergenic
973296678 4:48530482-48530504 GATTTTTAGTTGGCGTATTAGGG - Intronic
975519033 4:75278326-75278348 AACTTGTTATTGGTGTATTCAGG - Intergenic
976020539 4:80618793-80618815 GATTTTTACTTAGTGTAATAAGG + Intronic
976903268 4:90205874-90205896 AACTTTTTATTGGTCTATTCAGG + Intronic
976934880 4:90617997-90618019 ATCCTTGACTTGGTGTAATATGG + Intronic
977298976 4:95245733-95245755 AACACTTACTTTGTGTATAAAGG + Intronic
977713708 4:100156758-100156780 AACTTGTTATTGGTGTATTTGGG + Intergenic
977797263 4:101181260-101181282 GACTTTTACTGGGTATATTATGG + Intronic
978091200 4:104717937-104717959 AGCTTTTTCTCCGTGTATTAAGG - Intergenic
978270439 4:106883122-106883144 AACTTTTTTTTGGTCTATTCAGG + Intergenic
978603549 4:110453745-110453767 AAATTTTACTTAGTACATTAAGG + Intronic
978906308 4:114009822-114009844 AACTTGTAATTGGTCTATTCAGG + Intergenic
979142155 4:117190492-117190514 AAGTATTAATTAGTGTATTAGGG - Intergenic
979529354 4:121752505-121752527 AACTTGTTATTGGTGTATTCAGG - Intergenic
980744358 4:136996172-136996194 AACTTGTTATTGGTCTATTAGGG + Intergenic
983985675 4:174057527-174057549 AGCTTTTACTTCATGTATTCTGG - Intergenic
984161598 4:176259350-176259372 TACTTTTACTTGATGAATGACGG + Intronic
984268570 4:177523606-177523628 AACTTGTTATTGGTGTATTCAGG - Intergenic
985239563 4:187915821-187915843 ACTTTTTACTTGGTGTATCTAGG + Intergenic
986118977 5:4812614-4812636 AACTTGTTATTGGTCTATTAAGG - Intergenic
987687903 5:21228739-21228761 AACTTGTTATTGGTCTATTAAGG - Intergenic
990164774 5:52982317-52982339 AACTTTCACATGGTATATCATGG - Intergenic
991927312 5:71718574-71718596 AACTTTTACGTGGTGTAGCCAGG + Intergenic
991965682 5:72088118-72088140 AATTATTAATTGGTGTATTTGGG + Intergenic
992150957 5:73902588-73902610 AACTTTTAAAAGGTGTATAATGG + Intronic
992760733 5:79949127-79949149 AGCTGTCACTTGGTTTATTATGG + Intergenic
993370133 5:87083095-87083117 GTCTTTTAATTGGTGTTTTAGGG + Intergenic
993464959 5:88233806-88233828 CACTTTTACTTGATGTCTCATGG - Intronic
993589882 5:89781237-89781259 AACTTTTTATTGGTCTATTTAGG - Intergenic
993978993 5:94519303-94519325 AATTATTATTTGGTGAATTATGG - Exonic
994113238 5:96032264-96032286 AACTTTTCCTAGGTGCATTTTGG - Intergenic
994204662 5:97021024-97021046 AACGTATACTTGCGGTATTAAGG - Intronic
994233091 5:97331643-97331665 AACTTTTTATTGGTCTATTCAGG + Intergenic
994277681 5:97858466-97858488 AACTTTGTATTGGTCTATTAAGG - Intergenic
994442961 5:99834508-99834530 AACATTTACTTATTTTATTATGG - Intergenic
994802341 5:104395096-104395118 AACTTGTTCTTGGTCTATTCAGG + Intergenic
996211420 5:120815876-120815898 AACTTTTAATTGGGGCATTTAGG + Intergenic
996250355 5:121321189-121321211 AAGTTTGTCTTGGTGAATTAAGG - Intergenic
996462892 5:123767432-123767454 AACTTTTTATTGGTCTATTTAGG + Intergenic
996866025 5:128123394-128123416 AAAGTTTTCTTGGTGTATTGAGG - Intronic
996883157 5:128323966-128323988 AACTTGTTATTGGTCTATTAAGG + Intronic
996952953 5:129149835-129149857 AACTTGTAATTGGTCTATTCAGG + Intergenic
997011858 5:129887922-129887944 AAAATTCACTTGGTGTATTAAGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998884070 5:146675947-146675969 ATCTTTTCCTTTGTGTAATAGGG + Intronic
999782346 5:154859368-154859390 AACTTTTTCTTGGTGTTCTATGG + Intronic
1000657742 5:163901907-163901929 GACTTTTAATTGGTGTATTTGGG - Intergenic
1001271368 5:170314714-170314736 AAATTTTATTTGGTGTAACAGGG + Intergenic
1001460838 5:171912496-171912518 AACTTTTCCTTGTTATATTGTGG - Intronic
1008175856 6:48267441-48267463 AATTTTTAATTGGTCTATTCAGG + Intergenic
1008782440 6:55123803-55123825 AACTTGTAATTGGTCTATTCAGG + Intronic
1009264426 6:61535252-61535274 AACTTTTTATTGGTGTATTCAGG - Intergenic
1009316570 6:62228200-62228222 AACTTTTTATTGGTCTATTCAGG + Intronic
1009733748 6:67646938-67646960 ATCTTGTACTTTGTATATTATGG - Intergenic
1009993432 6:70872338-70872360 CATTTTTACTTTGTGTATTTTGG + Intronic
1010009143 6:71029619-71029641 AAATTTTATTTGTTATATTATGG + Intergenic
1010184353 6:73125634-73125656 AAAGTTCACTTGGTGTATTAAGG + Intronic
1010504593 6:76641707-76641729 ACCTTTTACTTAATATATTAGGG + Intergenic
1011944436 6:92883174-92883196 CTCTTTTAATTGCTGTATTAGGG - Intergenic
1012107407 6:95180855-95180877 TACTTTTACTTTGTGGAGTAGGG - Intergenic
1012514428 6:100042211-100042233 AACTTTTTATTGGTCTATTCAGG - Intergenic
1012739481 6:102997546-102997568 AAGTTTTATTTGGTGAATGAAGG - Intergenic
1012845660 6:104384883-104384905 AACTTTTTATTGGTCTATTCCGG - Intergenic
1015676827 6:135760028-135760050 AACTTTCACTTGTTGAATTCCGG - Intergenic
1016194201 6:141312235-141312257 AACATTTATTCTGTGTATTAGGG - Intergenic
1016396336 6:143627494-143627516 ATCTTTTAATTTTTGTATTAAGG + Intronic
1018557381 6:165063390-165063412 ACCTTTTGGTTGGTGAATTACGG + Intergenic
1018884907 6:167927143-167927165 AACTTTACCTTTGTGTATTTTGG + Intronic
1020997628 7:15283256-15283278 ATCTTTTAAGTGGAGTATTAGGG - Intronic
1021243122 7:18229559-18229581 CTCTTTTACTTGGTGAGTTATGG + Intronic
1021662436 7:22933323-22933345 AATTTTTGCTTCGTGTATTTTGG + Intergenic
1022148034 7:27567443-27567465 GCCTTTTAGTTGGTGTATTTAGG + Intronic
1024138594 7:46436730-46436752 GTCTTTTATTTGGTGTATTTAGG + Intergenic
1024475786 7:49808369-49808391 AATTTTTACTTCATGTATTTTGG - Intronic
1024950142 7:54852352-54852374 AACTTGTTCTTGGTCTATTCAGG + Intergenic
1027617328 7:80439386-80439408 CACTTTTACTTTTTATATTAAGG - Intronic
1028523307 7:91755893-91755915 AACTTGTTATTGGTCTATTAAGG - Intronic
1030413484 7:109212129-109212151 AACTCATTCTTGGTCTATTAAGG + Intergenic
1030534352 7:110747214-110747236 AACTTGTTATTGGTGTATTCAGG - Intronic
1030987956 7:116264170-116264192 AACTCTTACCTGATTTATTATGG - Intergenic
1031303386 7:120092172-120092194 AAGTTTAATTTTGTGTATTAGGG - Intergenic
1031487697 7:122348808-122348830 ATCTTTCATTTGGTGTATGAAGG + Intronic
1031793566 7:126141440-126141462 AAATTTAACTTAGTGTATTTGGG - Intergenic
1035696193 8:1598541-1598563 AACTTGTTATTGGTGTATTCAGG + Intronic
1037224770 8:16572395-16572417 AACTTGTACTTGAGGCATTAGGG + Intergenic
1040043127 8:42937063-42937085 AACTTGTTATTGGTGTATTCAGG + Intronic
1040417107 8:47205259-47205281 AACTTTTATTTTCTGTACTATGG - Intergenic
1041305505 8:56453731-56453753 ATCTTTTAATTAGTGTATTTAGG - Intergenic
1042556828 8:70040720-70040742 GACTTTTCCTTGGTGTTTTATGG + Intergenic
1042725918 8:71876758-71876780 AACTTTTTATTGGTCTATTCAGG + Intronic
1043108389 8:76146023-76146045 AAAATATACTTGGTTTATTAGGG + Intergenic
1044038294 8:87334058-87334080 AACTTGTTATTGGTGTATTCAGG + Intronic
1046335759 8:112784729-112784751 TACTTGTTATTGGTGTATTAAGG - Intronic
1046414029 8:113887082-113887104 AAGTTTTACTTGTTTTCTTATGG + Intergenic
1048467367 8:134677407-134677429 AACTTGTTATTGGTGTATTCAGG - Intronic
1051502965 9:17797950-17797972 AACATGTTCTTTGTGTATTAGGG + Intergenic
1051553375 9:18355669-18355691 AAGCATTACTTGGTGTATTTAGG - Intergenic
1051843582 9:21426287-21426309 AACTTTTTATTGGTCTATTCAGG + Intronic
1052096268 9:24388149-24388171 AACTTTTTATTGGTCTATTCAGG + Intergenic
1052280907 9:26732275-26732297 AACTTGTAATTGGTCTATTCAGG + Intergenic
1052382016 9:27781896-27781918 AACTTTTTATTGGTCTATTCAGG + Intergenic
1052434125 9:28404056-28404078 AACTTCTACTTGGTTTTTAAGGG - Intronic
1055122091 9:72672448-72672470 AACTTTTAATTGGGGTATTTAGG - Intronic
1055841971 9:80516109-80516131 AACTCTTTATTGGTGTATTCAGG + Intergenic
1056516990 9:87362377-87362399 AACATTTACTTTGTATATCAGGG - Intergenic
1056669378 9:88611635-88611657 AATTTTTTCTTTGTGTATTGTGG + Intergenic
1058077419 9:100664926-100664948 AATTTTTACGTAGTGAATTATGG + Intergenic
1058226671 9:102372314-102372336 AACTTTAACTTGGTGTCCTTGGG + Intergenic
1058353449 9:104054718-104054740 AACTTGTTATTGGTCTATTAAGG - Intergenic
1058548807 9:106090844-106090866 ATATTTTACTTTGTGTATTTTGG + Intergenic
1059630107 9:116112669-116112691 AACTTTTAATTCATGTATTGGGG + Intergenic
1060607181 9:124925772-124925794 AAAGTTAACTTGGTGTTTTATGG + Intronic
1186666765 X:11724677-11724699 AAAGTTTCCTTGGTGTCTTAAGG + Intergenic
1187620327 X:21045851-21045873 AACTTGTTCTTGGTCTATTCAGG + Intergenic
1187975323 X:24699349-24699371 AACTTTTCCTTTGTGTTTGAGGG + Intronic
1188771487 X:34159186-34159208 AACTTGTTATTGGTCTATTAAGG + Intergenic
1188772319 X:34167731-34167753 AACTTGTTATTGGTCTATTAAGG - Intergenic
1188902965 X:35757754-35757776 ATTTTTTAATTGGTTTATTAAGG + Intergenic
1189525767 X:41819518-41819540 TACTTTTTCTTAGTGTATTGTGG - Intronic
1190011856 X:46791957-46791979 ACTTTTTACATGGTGAATTAGGG - Intergenic
1190593433 X:52028301-52028323 AACTTTTTATTGGTCTATTCAGG + Intergenic
1190785875 X:53648272-53648294 AACTTTGAGTTTGTCTATTAAGG + Exonic
1191039204 X:56060870-56060892 AACTTGTTATTGGTGTATTCAGG + Intergenic
1191115701 X:56850291-56850313 AACTTCTTATTGGTCTATTAGGG - Intergenic
1191771293 X:64761717-64761739 AACTTTTTATTGGTCTATTCAGG + Intergenic
1192728775 X:73781214-73781236 TACTGTTAGTTTGTGTATTAGGG + Intergenic
1192932113 X:75817643-75817665 AACTTGTTATTGGTCTATTAAGG - Intergenic
1193003399 X:76588302-76588324 AACTTTTTATTGGTCTATTCAGG + Intergenic
1193028287 X:76870149-76870171 AACTTTTTATTGGTCTATTCAGG - Intergenic
1193034776 X:76937688-76937710 AACTTTTTATTGGTCTATTCAGG - Intergenic
1193043517 X:77028449-77028471 AACTTGTAATTGGTCTATTCGGG + Intergenic
1193110106 X:77720640-77720662 AACTTTTTATTGGTTTATTCAGG - Intronic
1193358367 X:80550696-80550718 AAATTTTATTTTGTGAATTAGGG - Intergenic
1193693205 X:84673372-84673394 AAGTTTTTTGTGGTGTATTAAGG - Intergenic
1194135965 X:90142227-90142249 CACTTTTATTTGGTGAGTTATGG - Intergenic
1194707084 X:97188790-97188812 AATTTTTAAATGGTTTATTATGG + Intronic
1194901106 X:99512685-99512707 AACTTTTTATTGGTCTATTCAGG + Intergenic
1195810325 X:108821907-108821929 AACTTGTAATTGGTCTATTCAGG + Intergenic
1195871741 X:109493583-109493605 AACTTTTAAGTGGTATAGTAGGG + Intergenic
1196183046 X:112715921-112715943 CATTTTTACTTGGAGTAATAGGG + Intergenic
1196360678 X:114852606-114852628 AGCTTTTAATTGGAGTATTTAGG - Intronic
1196560836 X:117146034-117146056 AACTTGTTATTGGTCTATTAAGG + Intergenic
1196697410 X:118627993-118628015 CACTTTTACATGGTTTCTTATGG + Intronic
1197157559 X:123286728-123286750 AACTTGTTATTGGTGTATTCAGG - Intronic
1197500725 X:127238659-127238681 CATTTTAACTTGTTGTATTATGG - Intergenic
1197601795 X:128539969-128539991 AACTTTTTATTGGTGTATTCAGG + Intergenic
1200481721 Y:3712305-3712327 CACTTTTATTTGGTGAGTTATGG - Intergenic
1201511806 Y:14772376-14772398 AACTTTTTATTGGTCTATTCAGG - Intronic