ID: 906023815

View in Genome Browser
Species Human (GRCh38)
Location 1:42655986-42656008
Sequence CCTCAGCCTCTCCCAAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1289
Summary {0: 1, 1: 3, 2: 22, 3: 243, 4: 1020}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906023810_906023815 3 Left 906023810 1:42655960-42655982 CCTCCCATGCTTAAGTGATCCTC 0: 4
1: 225
2: 3398
3: 11200
4: 47627
Right 906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG 0: 1
1: 3
2: 22
3: 243
4: 1020
906023812_906023815 -1 Left 906023812 1:42655964-42655986 CCATGCTTAAGTGATCCTCTCTC 0: 1
1: 1
2: 62
3: 931
4: 6406
Right 906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG 0: 1
1: 3
2: 22
3: 243
4: 1020
906023811_906023815 0 Left 906023811 1:42655963-42655985 CCCATGCTTAAGTGATCCTCTCT 0: 1
1: 5
2: 65
3: 1154
4: 9879
Right 906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG 0: 1
1: 3
2: 22
3: 243
4: 1020
906023809_906023815 9 Left 906023809 1:42655954-42655976 CCTCAACCTCCCATGCTTAAGTG 0: 3
1: 66
2: 1151
3: 5057
4: 22531
Right 906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG 0: 1
1: 3
2: 22
3: 243
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906023815 Original CRISPR CCTCAGCCTCTCCCAAGTAC AGG Intergenic
900278614 1:1850380-1850402 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
900287053 1:1906855-1906877 CTTCAGCCACTCCCAAGGGCTGG - Intergenic
900551442 1:3258218-3258240 CCTCAGAATCTGCAAAGTACAGG - Intronic
900934133 1:5754683-5754705 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
901036319 1:6338340-6338362 CCTGAGCCTCTCCCGAGTCGTGG + Intronic
901073640 1:6537871-6537893 CCTCGGCCTCTCCAAAGTGCTGG - Intronic
901242145 1:7701668-7701690 CCTCAGCCTCCTAAAAGTACTGG + Intronic
901391691 1:8950231-8950253 CCTTAGCCTCCCCAAAGTGCTGG + Intronic
901424424 1:9172644-9172666 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
901552639 1:10007194-10007216 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
901553339 1:10012681-10012703 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
902234690 1:15049772-15049794 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
902319846 1:15653745-15653767 CCTCAGCCTCTCAAAATGACAGG + Intronic
902646923 1:17806008-17806030 AATCAGCCACTCCCAAGGACCGG - Intronic
902680241 1:18038594-18038616 TCTCTGTCTCTCCCAAGAACTGG + Intergenic
902942303 1:19809197-19809219 CCTCAGCCCCTCCAAAGGCCAGG - Intergenic
903030208 1:20458677-20458699 CCTCGGCCTCCCCAAAGTACAGG + Intergenic
903074600 1:20753189-20753211 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
903079201 1:20795545-20795567 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
903137623 1:21319663-21319685 CCTCAGCCTCTCCTGAGACCTGG + Intronic
903434469 1:23336173-23336195 CCTCACCCTCCCCAAAGTGCTGG - Intronic
903468249 1:23567661-23567683 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
903469851 1:23579103-23579125 CCTCAGCCTCCCCAAAGTGTTGG - Intergenic
903476556 1:23623309-23623331 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
903497831 1:23782477-23782499 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
903594634 1:24484682-24484704 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
903611963 1:24621698-24621720 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
903809164 1:26025143-26025165 CCTCAGTTTCTCCGAAGTGCCGG + Intronic
903869496 1:26423289-26423311 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
903927364 1:26840128-26840150 CCCAAGCCTCTCCCCAGGACAGG - Intronic
903941875 1:26937530-26937552 CCTCGGCCTTTCCAAAGTGCTGG + Intronic
904139047 1:28337245-28337267 CCTCAGCCTCACCAAAGTACTGG + Intergenic
904158278 1:28502985-28503007 CCTCAGCCTCTTCTGAGTAACGG - Intergenic
904202775 1:28832181-28832203 CCACAGCCTCTCCCAATCCCTGG - Intronic
904286608 1:29456786-29456808 CCTTATCCTCTCCCCAGGACAGG - Intergenic
904662877 1:32098250-32098272 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
904731467 1:32595515-32595537 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
905110654 1:35592036-35592058 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
905115366 1:35634626-35634648 TCTCAGCCTCTCAAAAGTGCTGG + Intronic
905132983 1:35775450-35775472 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
905432430 1:37934180-37934202 CCTCAACCTCTCAAAAGTGCTGG + Intronic
905607322 1:39313863-39313885 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
905653836 1:39673157-39673179 CCTCAGCCTCCACCAGGTCCTGG + Intergenic
905672502 1:39801235-39801257 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
905672608 1:39802107-39802129 CCTCAGCCTCCCCAAAGTACTGG + Intergenic
905747258 1:40428676-40428698 CCTCAGCCCCCCCAAAGTGCTGG - Intergenic
905936200 1:41826266-41826288 ACTCAGCCTCTCCCAGTGACAGG - Intronic
906023815 1:42655986-42656008 CCTCAGCCTCTCCCAAGTACAGG + Intergenic
907297744 1:53466238-53466260 CCTCACCCTCCCCAAAGTGCTGG - Intronic
907467304 1:54647358-54647380 CCTCAGCCTCTCCAAAGTGCTGG - Intronic
907561573 1:55394808-55394830 CCTCAGCCTTCCCAAAGTGCTGG + Intergenic
907656755 1:56351030-56351052 TCTCTGCCTCTCCAAAGTGCTGG - Intergenic
908281183 1:62537331-62537353 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
908340863 1:63177831-63177853 CCTCAGCCTCCCAAAAGCACTGG - Intergenic
909419686 1:75450176-75450198 TCTCTGCCTCTCTCAAGTACTGG - Intronic
909543064 1:76812641-76812663 CCGCAGCCCCTCCCATGGACTGG + Intergenic
910077543 1:83298691-83298713 TCACACCCTCTCCCAAGTTCTGG - Intergenic
910578038 1:88789410-88789432 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
910834399 1:91493729-91493751 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
911162885 1:94699353-94699375 CCTCAGACTCTCAAAAGTGCTGG - Intergenic
911184893 1:94893624-94893646 CCTCGGCCTCCCACAAGTGCTGG + Intronic
911447525 1:98016624-98016646 CCTTGGCCTCCCCAAAGTACTGG - Intergenic
911634294 1:100216526-100216548 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
912137062 1:106674100-106674122 CCTCAGCCCCTCAAAAGTGCTGG - Intergenic
912396529 1:109349094-109349116 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
912398622 1:109369068-109369090 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
912532379 1:110335539-110335561 TCTCAGCCTCCCCAAAGCACTGG - Intergenic
912622101 1:111171985-111172007 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
912843266 1:113058045-113058067 CCTCAGCCTCTCCCAGTAGCTGG - Intergenic
912853238 1:113145190-113145212 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
912855277 1:113163229-113163251 CCTCAGCTTCTCCAAAGTGCTGG + Intergenic
912923141 1:113888639-113888661 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
912998058 1:114551669-114551691 CCTCAGCCTCCCCAAAGTGTTGG - Intergenic
913202585 1:116507370-116507392 CCTCAGCCTCTCCAAAGTGCTGG - Intergenic
914227509 1:145733387-145733409 CCTCAGCCTAGCCAAAGTGCTGG + Intronic
914424887 1:147566504-147566526 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
914744856 1:150494114-150494136 CCTCACCCTCCCCAAAGTGCTGG - Intronic
915084993 1:153380323-153380345 CCTCAGCCTCTCCGAGTAACTGG - Intergenic
915107027 1:153541106-153541128 CCTCAGCCTCTCCCACCTCAAGG + Intronic
915148786 1:153812278-153812300 CCTTAGCCTCCCCAAAGTGCTGG + Intronic
915230044 1:154438744-154438766 CCTCTGGCTCTCCCCAGGACAGG - Intronic
915494579 1:156272686-156272708 CCTCAGCCTCTCCCAGTAGCTGG + Intronic
915560933 1:156687500-156687522 CCTCAGCATCCCCCGAGTACAGG + Intergenic
915567054 1:156720860-156720882 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
915576609 1:156783152-156783174 CCTCGGCCTCTCCAAAGTGCTGG + Intronic
916013879 1:160731065-160731087 CCTCAGCCTCTCCAAAGTGCTGG + Intergenic
916028940 1:160859954-160859976 CCTCCGCCTCTCAAAAGTGCTGG - Intronic
916068188 1:161153138-161153160 CCCCAGCCTCCCCAAAGTGCTGG - Intronic
916224332 1:162474671-162474693 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
917162236 1:172070835-172070857 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
917325691 1:173829657-173829679 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
917339335 1:173958428-173958450 CCTCAGCCTCCCCCAGTAACTGG - Intronic
917432468 1:174985129-174985151 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
917795170 1:178528123-178528145 CCTCAGCCCCTGCCAAGTGCAGG - Intronic
918336597 1:183521347-183521369 CCTCTGCCTCCCCTAAGTGCTGG + Intronic
918538596 1:185603086-185603108 CCTCAGCCTCCCAGAAGTTCTGG - Intergenic
918593395 1:186264709-186264731 CCTCAACATCCCACAAGTACTGG + Intergenic
918638413 1:186808114-186808136 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
919672440 1:200350065-200350087 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
919675580 1:200379097-200379119 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
919850716 1:201670263-201670285 CCTCAGCCTCTCCGAGTTACTGG - Intronic
919974091 1:202599640-202599662 CCCCACCCACTCCCCAGTACAGG - Intronic
920257956 1:204669072-204669094 CCTCAGCCTCTCCAGAGTTCTGG + Intronic
920319132 1:205104270-205104292 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
920609641 1:207424229-207424251 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
920838107 1:209530666-209530688 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
920962625 1:210677301-210677323 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
921192180 1:212720299-212720321 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
921301676 1:213756858-213756880 CCTCGGCCCCCCCAAAGTACTGG + Intergenic
921345246 1:214177005-214177027 CCTCATCCTCTTCCAATAACTGG - Intergenic
922003332 1:221503456-221503478 TCCCGGCCTCTCTCAAGTACTGG - Intergenic
922113175 1:222582931-222582953 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
922513421 1:226187903-226187925 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
922587279 1:226744114-226744136 CCTCAGCCTCCCCAAAATGCTGG - Intergenic
922598500 1:226832443-226832465 CCTCAGCCTCCCCAAAGTTCTGG + Intergenic
922679114 1:227576145-227576167 CCTCAGCCTCAACAAAATACTGG - Intronic
922792582 1:228318289-228318311 CCTCAGTCTCTCCCATGTGATGG - Intronic
922897243 1:229109719-229109741 CCTCAGCCTCCCAAAAGTGCCGG - Intergenic
922904200 1:229161468-229161490 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
923025448 1:230200310-230200332 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
923030682 1:230246987-230247009 CCTTAGCCTCCCCAAAGTGCTGG - Intronic
923272524 1:232370623-232370645 CCTCAGCCTCCCCCAATAGCTGG - Intergenic
923421014 1:233815052-233815074 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
923675828 1:236080178-236080200 CTTCAGCCTCACCAAAGTGCTGG - Intergenic
923798934 1:237187692-237187714 CCTCAGCCTCCCCAAAGTGTTGG + Intronic
924231742 1:241967728-241967750 CTTCAGCCTCCCCAAAGTGCTGG + Intergenic
924276795 1:242396792-242396814 CCTCAGCCTCTCCTAGTTGCTGG + Intronic
924616618 1:245617346-245617368 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
924712840 1:246545053-246545075 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1062766668 10:71382-71404 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1063451791 10:6154909-6154931 TCACAGCCTCTACCAAGGACAGG - Intronic
1063689352 10:8271665-8271687 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1063747696 10:8903899-8903921 CCTGATTCCCTCCCAAGTACAGG + Intergenic
1064047876 10:12034553-12034575 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1064347106 10:14542005-14542027 CCTCAGCCTCTCAAAAGTGATGG - Intronic
1064549340 10:16483030-16483052 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1065097939 10:22301008-22301030 CATCAGCCTCTCAAAAGTGCTGG + Intergenic
1065124554 10:22561813-22561835 CCTCAGCCTCCCTAAAGTGCTGG + Intronic
1065216531 10:23454611-23454633 TCTCAGCCTCCCCAAAGTTCTGG + Intergenic
1065578390 10:27147241-27147263 CCTCAGCCTCTCAAAAGTGTTGG - Intronic
1065591311 10:27264952-27264974 CCTCCGCCTCTCAAAAGTGCTGG - Intergenic
1065710380 10:28511178-28511200 CCTCGGCCCCCCCAAAGTACTGG + Intergenic
1065870236 10:29950219-29950241 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1065913853 10:30335235-30335257 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1066078422 10:31904875-31904897 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
1066147550 10:32577111-32577133 CCTCAGCCTCCCCAAAATGCTGG - Intronic
1066209220 10:33220644-33220666 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1066396811 10:35033484-35033506 CCTCAGCCTCCCAGAAGTGCTGG - Intronic
1066402898 10:35092203-35092225 CCTCAGCCTCCCAAAAGTTCTGG + Intergenic
1067377589 10:45742043-45742065 CCTCGGCCTCCCAAAAGTACTGG + Intronic
1067390441 10:45858247-45858269 CCTCAGCCACTCCCAACAACTGG + Intergenic
1067501025 10:46805573-46805595 CCTCAGCCACTCCCAACAACTGG - Intergenic
1067572772 10:47384124-47384146 CATCAGCCTTTCCCCAGGACAGG - Intronic
1067593557 10:47534342-47534364 CCTCAGCCACTCCCAACAACTGG + Intronic
1067640666 10:48042446-48042468 CCTCAGCCACTCCCAACAACTGG + Intergenic
1067872835 10:49977820-49977842 CCTCAGCCACTCCCAACAACTGG - Intergenic
1068583112 10:58765304-58765326 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1068689067 10:59897503-59897525 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1068868426 10:61918781-61918803 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1068894048 10:62179984-62180006 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1069005901 10:63317108-63317130 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1069035245 10:63639801-63639823 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1069450276 10:68511806-68511828 CCTCAGCCTCCCAAAAGTACTGG + Intronic
1069669235 10:70187865-70187887 CCTCAGCCTCCCACAATTGCTGG + Intergenic
1070137630 10:73708475-73708497 CCTCAGCCACTCCCAACAACTGG + Intergenic
1070215912 10:74380506-74380528 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1070680048 10:78442713-78442735 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1070829879 10:79411731-79411753 CTTCAGACTCTCCCTAGCACTGG - Intronic
1071252958 10:83839575-83839597 CCTTAGCCTTTCTCAAGTAAAGG + Intergenic
1071296004 10:84220397-84220419 TCTCAAAGTCTCCCAAGTACTGG - Intergenic
1071488861 10:86122530-86122552 GCTCAGCCTCTCCCTGGCACTGG + Intronic
1071543443 10:86508868-86508890 CCTCAGCCTCTCCAAGTAACTGG + Intronic
1071604587 10:86976339-86976361 CCTCAGCCTCCCCACAGCACTGG + Intronic
1071828985 10:89353397-89353419 CCCCAGCCCCTCCCAAGTGCTGG + Intronic
1071867819 10:89755842-89755864 CCTCAGCTTCCCCCAAGTGTTGG + Intronic
1072019046 10:91380425-91380447 CCTCAGCCTTATCAAAGTACTGG - Intergenic
1072085596 10:92076518-92076540 CCTCAGCCTCTCCCTATAGCTGG + Intronic
1072658391 10:97346806-97346828 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1072885483 10:99268903-99268925 CCTCGGCCTCCCAAAAGTACTGG - Intergenic
1072967293 10:99984990-99985012 CCTCAGCTTCTCAAAAGTGCTGG + Intronic
1073246439 10:102093832-102093854 CCTCAGACTCCCCAAAGTACTGG + Intergenic
1073255001 10:102145315-102145337 CCTCAGCCTCCCACAAGTGCTGG - Intronic
1073360809 10:102897132-102897154 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1073421387 10:103426542-103426564 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1073500935 10:103936360-103936382 ACACAGCCTCTCCCCAGGACAGG + Intergenic
1073561263 10:104498823-104498845 CCTCACCCCCACCCAACTACTGG - Intergenic
1073837115 10:107457003-107457025 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1073848967 10:107592255-107592277 CCTCAGCCTCCGCAAAGTGCTGG + Intergenic
1074477162 10:113784015-113784037 CCTCGGCCCCCCCCAAGTGCTGG + Intergenic
1074521665 10:114230811-114230833 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1074788900 10:116866572-116866594 CCTCAGCCTCCCAAAAGTGCCGG - Intronic
1075049271 10:119170643-119170665 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
1075130355 10:119732749-119732771 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1075396355 10:122130530-122130552 CCTCAGCCTCCCCAAAGTGTTGG + Intronic
1075815892 10:125264590-125264612 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1075965952 10:126611781-126611803 CCTCAGCCTCTCACCATTTCTGG + Intronic
1076109757 10:127851442-127851464 CCACAGCCTCTCCCCTCTACTGG - Intergenic
1076587599 10:131560005-131560027 GCTCTGTGTCTCCCAAGTACGGG + Intergenic
1076732807 10:132446845-132446867 CCTCAGCCTGGACCAAGTGCGGG - Intronic
1077449428 11:2627999-2628021 CCTTGGCCACCCCCAAGTACTGG + Intronic
1078019898 11:7648339-7648361 CCTCAGGCTCTCCCACTAACAGG + Intronic
1078135522 11:8648779-8648801 CCTCAGCCTCTGGCAGGTAGTGG - Intronic
1078326266 11:10383696-10383718 CCTCAGCCTCCCCAAAGTGTGGG - Intronic
1078584208 11:12566951-12566973 TCTTAGCCTCCCCCAAGTGCTGG + Intergenic
1078904763 11:15673441-15673463 GCTCAGCCTCTCCTTAGTACAGG + Intergenic
1078985741 11:16594939-16594961 CCTCGGCCTCCCCGAAGTGCTGG + Intronic
1079001479 11:16761006-16761028 CCTCAGTCTCCCCAAAGTGCTGG + Intergenic
1079441153 11:20516176-20516198 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
1079486505 11:20940886-20940908 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
1079582424 11:22082312-22082334 CTTCAGCCTCCCCAAAGTGCTGG + Intergenic
1079600741 11:22310380-22310402 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1079743861 11:24100746-24100768 TCTCTGCCTCTCTCATGTACTGG - Intergenic
1080170792 11:29299985-29300007 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1080539684 11:33254498-33254520 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1081095880 11:38934704-38934726 CCTCAGCCTCTGTTAAGTGCTGG - Intergenic
1081510351 11:43765947-43765969 CCTCAGCCTCCCGCCACTACAGG + Intronic
1081518440 11:43857455-43857477 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1081944265 11:46975031-46975053 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1082021818 11:47540633-47540655 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1082027458 11:47583299-47583321 CCTCAGCTTCTCAAAAGTGCTGG + Intronic
1082051346 11:47772907-47772929 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1082088600 11:48070249-48070271 CCTCAGCCTCCCCAAAATGCTGG - Intronic
1083239762 11:61379090-61379112 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1083348320 11:62009680-62009702 CTTCAGCCTCCCCAAAGTGCTGG - Intergenic
1083352666 11:62042000-62042022 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1083565372 11:63711027-63711049 CCTCGGCCTCCCACAAGTGCTGG - Intronic
1083679621 11:64345103-64345125 TCTCAGCCTCCTCCAAGTGCTGG - Exonic
1083683158 11:64360520-64360542 CCTCAGCCTCCTTGAAGTACTGG - Exonic
1083919908 11:65776876-65776898 CCTCAGCCTCACCAAAGTGTTGG - Exonic
1083987949 11:66229123-66229145 CCTCAGCCTCCCAAAAGTACTGG - Intronic
1084054244 11:66621625-66621647 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1084083827 11:66845658-66845680 GCTCAGCCTGTCTCAAGGACTGG - Intronic
1084104312 11:66971150-66971172 CCCCAGCCTGTCCCAAACACTGG - Intergenic
1084186067 11:67472315-67472337 CCTCAGCTTCCCCAAAGTGCTGG - Intergenic
1084630992 11:70349378-70349400 CCTTGGCCTCTCCAAAGTGCTGG - Intronic
1084924318 11:72500140-72500162 CCTCGGCCTCCCCAAAGTACTGG + Intergenic
1084975815 11:72797418-72797440 TCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1085185877 11:74575848-74575870 CCTCAGCCTCCCAGAAGTGCTGG + Intronic
1085357016 11:75847720-75847742 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1085554364 11:77406525-77406547 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1086034219 11:82397033-82397055 CCTCAGCCTCACAAAAGTGCTGG + Intergenic
1086034624 11:82401873-82401895 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
1087035336 11:93750085-93750107 CCTCACCCTCACACAAGTGCAGG + Intronic
1087043296 11:93822329-93822351 CCTCGGACTCTCCAAAGTGCTGG + Intronic
1087058719 11:93958053-93958075 CCCCAGCCTCTGCCATGTAGGGG + Intergenic
1087061661 11:93984768-93984790 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1087356137 11:97097164-97097186 ACTCTGCCTCTCTCATGTACTGG - Intergenic
1087797919 11:102473731-102473753 ATGCAGCCTCTCCCAAGCACTGG - Intronic
1088425305 11:109695829-109695851 TCTCTGCCTCTCTCATGTACTGG - Intergenic
1088815835 11:113420135-113420157 CCCCAGTGGCTCCCAAGTACTGG - Intronic
1088873348 11:113911776-113911798 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1088917559 11:114239026-114239048 ACTGAGCCACTACCAAGTACAGG - Intronic
1089245241 11:117114522-117114544 CCTCTGCCTCCCACAAGTGCTGG - Intergenic
1089407208 11:118207978-118208000 TCTCAGCCTCTCCAAATTGCTGG - Intronic
1089409150 11:118224290-118224312 CATCAGCCTTTCCCAAGGTCAGG + Intronic
1089967507 11:122665441-122665463 CCTCAGCCTCCCACAAGTGCTGG + Intronic
1089990111 11:122851148-122851170 CCTCAGCCTCCCCCAATAGCTGG - Intronic
1090053591 11:123402264-123402286 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1090058998 11:123447537-123447559 CCTCAGCCTGTCTCTAGGACTGG - Intergenic
1090096273 11:123744315-123744337 CCTCAGCCTCCCACAAGTGCTGG + Intergenic
1090108590 11:123878905-123878927 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1090770341 11:129914250-129914272 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1090918391 11:131186901-131186923 GCTCCGCCTCTCGCAAGGACAGG - Intergenic
1091154661 11:133361742-133361764 CCGCAGCCGCTCCCAAGGGCTGG + Intronic
1091251353 11:134146813-134146835 CCTCGGCCTCCCCCAGGTGCTGG + Intronic
1091430163 12:426994-427016 CCTCAGCCACCCCAAAGTGCTGG - Intronic
1091483190 12:856086-856108 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1092496241 12:8998076-8998098 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
1092790557 12:12067298-12067320 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1092794173 12:12093864-12093886 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
1093066358 12:14662424-14662446 CCTCAGCCCCCCCAAAGTGCTGG - Intronic
1093076870 12:14768219-14768241 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
1093159889 12:15734088-15734110 TCTCAGCCTCCCCAAAGTTCTGG + Intronic
1093184580 12:16005191-16005213 CCTCAGCCTCCCCAAAGCACTGG - Intronic
1094693455 12:32792999-32793021 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1095432382 12:42147840-42147862 CCTCGGCCTCCCCGAAGTGCTGG + Intergenic
1095569828 12:43672182-43672204 CCTCAGCCTCCTCAAAGTGCTGG - Intergenic
1095706936 12:45247174-45247196 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1095846063 12:46746328-46746350 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1096159603 12:49366228-49366250 CCTCGGCCTCTCAGAAGTGCTGG + Intergenic
1096172911 12:49487843-49487865 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1096209404 12:49752011-49752033 CCTCAGCCTCTCAGAAGTGCTGG + Intronic
1096324310 12:50645707-50645729 CCTTGGCCTCCCCCAAGTGCTGG + Intronic
1096665930 12:53165067-53165089 CCTCAGCCTCTCAACAGTACTGG - Intronic
1096711039 12:53456215-53456237 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1096712824 12:53470133-53470155 CCTCAGCCTCCCACAAGTGCTGG - Intronic
1097088951 12:56489851-56489873 CCTCAGCCTCCCACAAGTGCTGG + Intergenic
1097128711 12:56794445-56794467 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
1097420833 12:59377071-59377093 CCTTAGCCTCTAACAAGTGCTGG + Intergenic
1097644528 12:62220856-62220878 CCTCGGCCTCACCAAAGTGCTGG - Intronic
1098241548 12:68472508-68472530 CAGCAGCCTCTCCCAAGCAGGGG + Intergenic
1098483563 12:70994959-70994981 CCTCAGCCTCTCAAAAGTGCTGG - Intergenic
1099415370 12:82378775-82378797 CCTCAGCCCTTCCCAAATGCCGG - Intronic
1099595243 12:84654780-84654802 CCTCAACCTCCCCAAAGTGCTGG - Intergenic
1100557514 12:95710751-95710773 CCTCAGCCTCCCACAAGTGCTGG - Intronic
1100625860 12:96331191-96331213 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1100730915 12:97467801-97467823 CCCCCGCCTCTCCCAAATTCAGG - Intergenic
1101383418 12:104234541-104234563 CCTCAGCCTCCCAAAAGTTCTGG + Intronic
1101896184 12:108758711-108758733 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1102103021 12:110295412-110295434 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1102237389 12:111302647-111302669 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1102252188 12:111394866-111394888 CCCCAGCCTCTGCCAGGTTCTGG + Intergenic
1102315917 12:111887420-111887442 CCTCAGCCTCTCAAAACTGCTGG - Intronic
1102322737 12:111951978-111952000 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
1102560688 12:113760172-113760194 CCTCCGCCTCCCCAAAGTGCCGG - Intergenic
1102735160 12:115152944-115152966 CCACAGCCTTTCCCAAGGAAAGG - Intergenic
1102912126 12:116724464-116724486 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1103030918 12:117612153-117612175 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1103304442 12:119952732-119952754 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1103395230 12:120601978-120602000 CTTCAGCCTCTCAAAAGTGCTGG + Intergenic
1103404903 12:120668245-120668267 CCTCAGCCTCCCCAGAGTGCTGG - Intergenic
1103509329 12:121463827-121463849 CCTCAGCCTCCCATAAGTGCTGG + Intronic
1103510372 12:121469364-121469386 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1103587178 12:121964647-121964669 CCTCGGCCCCTCCCAAATGCTGG - Intronic
1103677610 12:122668518-122668540 GTTCAGCCTCTCCCTAGTCCTGG + Intergenic
1103692898 12:122790297-122790319 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1103747555 12:123136050-123136072 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1103785486 12:123429863-123429885 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1103801383 12:123540053-123540075 CCTCAGCCTTCCCAAAGTGCTGG + Intergenic
1103811397 12:123616902-123616924 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1103983057 12:124749264-124749286 CCTCAGCCTCTTCTAAGTGCTGG + Intergenic
1104661607 12:130615559-130615581 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1104811199 12:131621290-131621312 CCTCAGCCTCTCCCCGGGGCAGG + Intergenic
1105297223 13:19098475-19098497 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1105491186 13:20890197-20890219 CCTCAGCCTCTCCAAAGTGCTGG - Intronic
1105496811 13:20937758-20937780 CCTCAGCCTCTCCGAGTTGCTGG + Intergenic
1105694731 13:22876595-22876617 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1105750109 13:23415280-23415302 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
1105902912 13:24772858-24772880 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1106152760 13:27122078-27122100 CCTTAGCCTCCCCAAAGTGCTGG - Intronic
1106190497 13:27448786-27448808 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1106290916 13:28361027-28361049 CCTCGGCCTCCCACAAGTGCTGG - Intronic
1106421167 13:29587587-29587609 CCTTAACCTCTGCCAAGTCCAGG + Intronic
1106923286 13:34587973-34587995 CCACAGCCTCTCCTCACTACTGG + Intergenic
1107944430 13:45405172-45405194 CCTCAGCCTCCCCAAAGCACTGG + Intronic
1108348889 13:49572550-49572572 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1108635330 13:52328610-52328632 CCTCAGCCTCTCAGAAATGCTGG - Intergenic
1108652481 13:52494619-52494641 CCTCAGCCTCTCAGAAATGCTGG + Intergenic
1108671249 13:52691231-52691253 CCTCAGCCTACCCAAAGTGCTGG + Intronic
1108794197 13:54011430-54011452 GCTCAGCCTCTCTCAAGTTGTGG + Intergenic
1110215167 13:73017236-73017258 CCTCAGCTTCTCAAAAGTGCTGG + Intergenic
1110743080 13:79019702-79019724 GCTCTGCCTCTCTCAGGTACTGG + Intergenic
1111820245 13:93204935-93204957 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1112022122 13:95380647-95380669 CCCCAGCCTCTGCAGAGTACGGG + Intergenic
1112483646 13:99800380-99800402 TATCAGCCTCTCCCAGGCACTGG - Intronic
1112651655 13:101405624-101405646 CCACAGCCTCTCACACGCACTGG + Intronic
1113298263 13:108986370-108986392 CCTCAGCCTCCCTTAAGTGCTGG - Intronic
1113676046 13:112208769-112208791 CCCCAGCCTCTCCCAGCTCCTGG - Intergenic
1113818366 13:113192005-113192027 CCTCAGCCTCCCGAAAGTGCTGG - Intronic
1114213604 14:20637770-20637792 CCTCACCCTCCCCAAAGTGCTGG - Intergenic
1114830712 14:26138125-26138147 CCACAGACTCTCCCAAATCCTGG + Intergenic
1114950999 14:27753304-27753326 CCTCAGCCTCTCCCACTAGCTGG - Intergenic
1115230331 14:31153456-31153478 CCTGAGCCTCCCCAAAGTGCTGG + Intronic
1115381420 14:32744564-32744586 CCTTGGCCTCCCCAAAGTACTGG + Intronic
1115411430 14:33079860-33079882 CCTCAGCCTCCCCAAGGTGCTGG + Intronic
1115528208 14:34302221-34302243 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1115562375 14:34594845-34594867 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1116020456 14:39454007-39454029 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1116205695 14:41863112-41863134 CCTCAGCCTCCCCAAAGTACTGG + Intronic
1116681276 14:47973301-47973323 TCTCTGCCTCTCTCACGTACCGG - Intergenic
1117151293 14:52890851-52890873 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1117683400 14:58228366-58228388 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
1118104551 14:62642747-62642769 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
1118187045 14:63546984-63547006 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
1118471362 14:66077929-66077951 CCACAGCCTCTCCCATTTACAGG - Intergenic
1118817763 14:69324900-69324922 TCTCAGCCTCTCAGAAGTACAGG - Intronic
1118839996 14:69502710-69502732 CCCCAGCATCTCCCAAGGAAGGG - Intronic
1118991262 14:70799260-70799282 CCTCAGCTTCCCCAAAGTGCTGG + Intronic
1119255932 14:73196722-73196744 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1119382759 14:74239536-74239558 CCTCAGCCCCTCCAAAGAACAGG + Exonic
1119514043 14:75233993-75234015 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1119642634 14:76326732-76326754 CCTCCTCCTCTCCCAATTTCAGG + Intronic
1119801665 14:77450757-77450779 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1120331524 14:83099441-83099463 CCTCAGCCTCTCAAAAGTGCAGG - Intergenic
1120928495 14:89822509-89822531 TCTCAGCCTCTCCCAACCAGTGG - Intronic
1121198316 14:92095490-92095512 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1121297070 14:92836812-92836834 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1121564611 14:94899614-94899636 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1121829631 14:97038845-97038867 CCTCTGACTCTCTCAAGTCCTGG + Intergenic
1122007708 14:98718957-98718979 GTTCAGCCTCTCCCATGTGCTGG - Intergenic
1122048152 14:99038005-99038027 CCTGAGCCTCTCCCAGGGCCCGG + Intergenic
1122482076 14:102053860-102053882 CCTCAGCCTCCCCAGACTACAGG + Intergenic
1122685620 14:103504342-103504364 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1122687393 14:103516056-103516078 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1122743887 14:103887011-103887033 CCTCAGCCTTTACCTAGAACCGG + Intergenic
1123111095 14:105867161-105867183 CCCCAGCCTCTCCCAACAGCTGG + Intergenic
1123720143 15:23053311-23053333 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1123957851 15:25358119-25358141 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1124439440 15:29675610-29675632 CCTCAGCCTCCCCGAAGTGCTGG - Intergenic
1124799076 15:32811896-32811918 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
1124865525 15:33486945-33486967 CCTCGGCCTCTCAAAAGTCCTGG - Intronic
1125011905 15:34886872-34886894 CCTCAGCCTCCCCGAAGTGTTGG - Intronic
1125434724 15:39632426-39632448 CCTCAGCCTCTCCAAAGTGCTGG + Intronic
1125479059 15:40068105-40068127 CCTCAGCCTCCCCAAAGTACTGG + Intergenic
1125548199 15:40524404-40524426 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1125648899 15:41297085-41297107 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1125658283 15:41376143-41376165 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1125800058 15:42437790-42437812 CCTCAGCCTCCCCAAATAACTGG - Intronic
1125912993 15:43458527-43458549 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1125960455 15:43825672-43825694 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1126020409 15:44395123-44395145 CCTCAGCCTCTCCAAGGAGCTGG + Intronic
1126029068 15:44478195-44478217 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1126130506 15:45336860-45336882 CCTCAGCCTCTTCAAAGTGCTGG - Intergenic
1126436315 15:48642125-48642147 CCTCTGCCTCTCCAAATTACAGG - Intronic
1126775473 15:52096685-52096707 CCTCAGCCCCGCCAAAGTGCTGG + Intergenic
1127000010 15:54491874-54491896 CCTCAGCCTCTCCGAATAGCTGG - Intronic
1127077565 15:55342640-55342662 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1127078555 15:55352196-55352218 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1127085541 15:55421248-55421270 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
1127267861 15:57376182-57376204 CCTCGGCCTCTCCAAATTCCTGG - Intronic
1127415241 15:58750927-58750949 CCTCGGCCTCCCACAAGTGCTGG + Intergenic
1127737800 15:61861211-61861233 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
1127755881 15:62091522-62091544 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1127936323 15:63642586-63642608 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1127972060 15:63969487-63969509 CCTCAGCCTCTCAAAAGTGTTGG - Intronic
1128051273 15:64666876-64666898 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1128978921 15:72172678-72172700 CCTTGGCCTCTCCAAAGTGCTGG + Intronic
1129136856 15:73561427-73561449 CCTCAGCCTCCCAGAAGTGCTGG - Intronic
1129203171 15:74018067-74018089 CCTCAGCCTCCCAGAAGTGCTGG - Intronic
1129204354 15:74026900-74026922 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1129364842 15:75047927-75047949 CCTCACCATCTCCCAAATCCAGG - Intronic
1129432193 15:75507515-75507537 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1129986694 15:79924579-79924601 CCTCAGCCACTCAAAAGTGCTGG + Intergenic
1131289686 15:91096145-91096167 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1131494558 15:92894678-92894700 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1131796186 15:96019115-96019137 CCTCAGCCTCTGCCACGTACAGG + Intergenic
1132124232 15:99207507-99207529 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1132150954 15:99458453-99458475 CCTCAGCCTCCTCAAAGTGCTGG - Intergenic
1132494130 16:252429-252451 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
1132662925 16:1069592-1069614 CCTCACCTTCCCCCAAGTGCAGG + Intergenic
1133183184 16:4074923-4074945 CCTCAGCCTCTCAAAAGTATTGG - Intronic
1133363639 16:5193832-5193854 GCTCAGGCTCTCCCAAGTGCAGG - Intergenic
1133549013 16:6835636-6835658 CCTCAGCCTCTCCCAGTAGCTGG - Intronic
1133672310 16:8034668-8034690 CCTCAGCCTCTCAAAAGTGCTGG + Intergenic
1133833007 16:9341574-9341596 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1133940084 16:10301985-10302007 CCGCAGCTTTTCCCAACTACTGG + Intergenic
1134159124 16:11871315-11871337 CCTCAGCCTCTCAAAAGTGCTGG - Exonic
1134286140 16:12863480-12863502 CCTCAGCCTCCCCCAACAGCTGG - Intergenic
1134485846 16:14657790-14657812 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1134883341 16:17767493-17767515 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1135004977 16:18812399-18812421 CTTCAGCCTCCCCAAAGTGCTGG - Intronic
1135170060 16:20176090-20176112 CCTCCGCCTCACCAAAGTGCTGG + Intergenic
1135304549 16:21356822-21356844 CCTCTGCCTCCCCAAAGTACTGG - Intergenic
1135375208 16:21940531-21940553 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1135403760 16:22183842-22183864 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1135700800 16:24630854-24630876 CAGCAGCCTCTCCCAGGCACTGG - Intergenic
1136115829 16:28093675-28093697 CCTCAGCTTTTCCCAAGGGCTGG + Intergenic
1136301288 16:29335950-29335972 CCTCAGCCTCCCCAAAGTACTGG - Intergenic
1136345547 16:29673350-29673372 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
1136505764 16:30702201-30702223 ACTCAGCCTCTCAAAAGTGCTGG + Intronic
1136673384 16:31877505-31877527 CCTAAGCCCCTCCTAAGAACAGG - Intronic
1137425586 16:48377643-48377665 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1137876632 16:52003024-52003046 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1138111421 16:54327251-54327273 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1138381523 16:56606225-56606247 CCTCATCCTCTGCCAAGTCAGGG + Intergenic
1138467845 16:57206151-57206173 CCTCAGCCTCTCAAAAGTGTTGG - Intronic
1138608063 16:58101374-58101396 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1139052071 16:63136560-63136582 CCTCAGCCTCTCAAAAGTGCTGG - Intergenic
1139250094 16:65487052-65487074 CCTCAGCCTCTCCCAGTAGCTGG - Intergenic
1139425854 16:66879694-66879716 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1139457621 16:67094965-67094987 CCTCAGCCTCTCAAAAGCACTGG - Intronic
1139457775 16:67096057-67096079 CCTCAGCTTCCCCAAAGTGCTGG - Intronic
1139532134 16:67547576-67547598 CCTCAGCCCCTCCTTAGAACAGG - Intergenic
1139574326 16:67831694-67831716 CCTCAGCCTCTCCAGAGGACAGG + Intronic
1139604417 16:68007869-68007891 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1139685268 16:68598477-68598499 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1139690355 16:68637779-68637801 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
1139712782 16:68789279-68789301 CTTCAGCCTCCCCAAAGTGCTGG + Intronic
1139720829 16:68852577-68852599 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
1139768902 16:69256268-69256290 CCTCAGCCTCCCCAAAGTGTTGG + Intronic
1139821433 16:69724440-69724462 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1140182832 16:72737023-72737045 CCTCAGCCCCCCTCAAGTGCTGG - Intergenic
1140624038 16:76770505-76770527 CCTCAGCCTCCCACAAGTGCTGG + Intergenic
1141583805 16:85019465-85019487 CCTCAGCCTCTTAAAAGTGCTGG - Intergenic
1142062989 16:88042665-88042687 CCTCAGCCTCCCCAAAGTACTGG - Intronic
1142331343 16:89455986-89456008 CTTCAGCCTCTCAAAAGTGCTGG - Intronic
1142491461 17:282391-282413 CCTCAGACTCTGCCAAGCCCCGG - Intronic
1143025502 17:3939357-3939379 CCTCAGCCTCTCCCCTGACCTGG - Intronic
1143151864 17:4812063-4812085 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1143236922 17:5410478-5410500 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1143267085 17:5646548-5646570 CCTCAGCCTCCCCAAACTGCTGG + Intergenic
1143369831 17:6432257-6432279 CCTCAGCCTCCCACGACTACAGG - Intronic
1143427843 17:6854135-6854157 CCGCATCCTCCCCCAAGTTCCGG - Intergenic
1143507135 17:7373303-7373325 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1143711463 17:8738712-8738734 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1144115633 17:12087095-12087117 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1144152044 17:12457542-12457564 TCTCAGCTTCTCCCTGGTACAGG - Intergenic
1144786271 17:17833732-17833754 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
1144936026 17:18899783-18899805 CCTCAGCTTCTCTAAAGTGCTGG + Intronic
1145168796 17:20637161-20637183 CCTGAGACCCTCCCAACTACAGG + Intergenic
1145197212 17:20904506-20904528 CTTCAGCCTCTCAAAAGTGCTGG + Intergenic
1145938359 17:28727868-28727890 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1145989333 17:29069493-29069515 CCTCGGCCTCCCAAAAGTACTGG + Intergenic
1146014013 17:29218150-29218172 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1146125113 17:30225243-30225265 CCTCTGCCTCTGCCAGGTAGAGG + Intronic
1146151203 17:30474219-30474241 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1146233463 17:31134127-31134149 CCTTAGCCTCCCCAAAGTGCTGG + Intronic
1146234259 17:31143519-31143541 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1146323191 17:31862820-31862842 CCTCAGCCTTCCCAAAGTGCTGG + Exonic
1147021176 17:37534473-37534495 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1147196893 17:38772828-38772850 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1147204541 17:38827273-38827295 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1147616827 17:41834494-41834516 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1147760044 17:42791707-42791729 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1147774209 17:42889117-42889139 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1147819503 17:43233251-43233273 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820595 17:43239399-43239421 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820807 17:43240664-43240686 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147821617 17:43245133-43245155 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147822711 17:43251291-43251313 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147825228 17:43266087-43266109 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826069 17:43270822-43270844 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826348 17:43272599-43272621 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147827236 17:43277451-43277473 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147828348 17:43283607-43283629 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147829458 17:43289771-43289793 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147830549 17:43295906-43295928 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147831233 17:43299494-43299516 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1148037065 17:44672230-44672252 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1148064923 17:44862182-44862204 CCTCAGCCTCTCAAAAGTGTTGG - Intronic
1148256338 17:46135779-46135801 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1148264399 17:46213665-46213687 CCTCGGCCTCCACAAAGTACTGG - Intronic
1148430495 17:47639292-47639314 TCTCAGCCTCCCCAAAGTGCCGG - Intergenic
1148706512 17:49638338-49638360 CCTCGGCCTCCCACAAGTGCTGG - Intronic
1148939358 17:51194629-51194651 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1149243458 17:54678205-54678227 CCTCAGCCTCCTCAAAGTGCTGG + Intergenic
1149698801 17:58638108-58638130 CCTCAGCCTCCCAGAAGTGCTGG + Intronic
1149773010 17:59335797-59335819 CCTCAGCCTCTGACAAGTCTTGG + Intronic
1150060179 17:62060946-62060968 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1150100667 17:62420888-62420910 CCTCGGCCTCCCCCAAGTGCTGG - Intergenic
1150114998 17:62539750-62539772 CCTCGGCCTCCCCAAAGTTCTGG + Intronic
1150234037 17:63578111-63578133 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1150374266 17:64667169-64667191 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1150606799 17:66698721-66698743 CCTCAGTCTCCCCAAAGTGCTGG - Intronic
1150751201 17:67864274-67864296 CCTCAACCTCCCCAAAGTGCTGG - Intronic
1150752459 17:67877881-67877903 CCTCTGCCTCTCAAAAGTGCTGG + Intronic
1150759656 17:67950146-67950168 CCTCGGCCTCTCCAAAGTGCTGG - Intronic
1150761626 17:67967389-67967411 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1150779475 17:68109021-68109043 CCTCAGCCTCCCCAAAGTCCTGG - Intergenic
1150868069 17:68875657-68875679 CCTCAGCCTCTGCCATGTAGTGG + Exonic
1150877281 17:68984099-68984121 CCTCAGCCTCTGCCATGTAGTGG + Exonic
1150891209 17:69152405-69152427 CCTCAGCCTCTGACATGTAATGG + Exonic
1151279162 17:73059414-73059436 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1151300860 17:73224174-73224196 CCTCAGCCTCCCCAAAATGCTGG - Intronic
1151480159 17:74365798-74365820 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1151626426 17:75278730-75278752 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1151651102 17:75470218-75470240 CCTCAGCCTCTTAAAAGTTCTGG - Intronic
1151737711 17:75955116-75955138 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1151788441 17:76288131-76288153 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
1152224693 17:79087302-79087324 TCTCAGCCTCGTCCAAGCACCGG + Intronic
1152959510 18:70699-70721 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1153539244 18:6136244-6136266 TCACAGCCCCTCCCAAGTGCTGG + Intronic
1153759695 18:8318545-8318567 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1153808416 18:8730993-8731015 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1153847746 18:9065027-9065049 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1153863867 18:9243883-9243905 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1153893768 18:9541114-9541136 CCTCAGCCTCCCATAAGTGCTGG - Intergenic
1153903088 18:9636392-9636414 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1154065888 18:11106661-11106683 TCTCAGCCTCCCCAAAGTCCTGG + Intronic
1154090921 18:11362317-11362339 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1154149455 18:11894838-11894860 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1154987710 18:21569346-21569368 CCTCAGCCTCCCAAAAGTTCTGG - Intronic
1154987969 18:21571437-21571459 CCTCAGCCTCCCAAAAGTCCTGG + Intronic
1154995556 18:21637047-21637069 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
1155057425 18:22197299-22197321 CCTCGGCCTCTCTAAAGTGCAGG + Intronic
1155204413 18:23545491-23545513 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1156273132 18:35555674-35555696 CCTCAGCTTCTCCAATGTGCAGG + Intergenic
1156325976 18:36075625-36075647 CCTCAGCCTCCCTAAAGTGCTGG - Intergenic
1156328274 18:36094286-36094308 CCTCTGCCTCCCCAAAGTGCTGG + Intergenic
1156539221 18:37893319-37893341 CCTCAGCATGTCCTATGTACTGG + Intergenic
1156774426 18:40770060-40770082 CCTCAGCCTCTCAAAAGTGCTGG - Intergenic
1156849766 18:41712754-41712776 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1156967164 18:43108057-43108079 CCTCAGCCTCCCCGAATAACTGG - Intronic
1156975209 18:43213441-43213463 CCTCAGCCTCCCAAAAGTACTGG - Intergenic
1157332805 18:46715835-46715857 CCTCAGCCTCTTACAAGTTCTGG + Intronic
1157372561 18:47129821-47129843 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
1157642588 18:49232857-49232879 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1157752795 18:50194240-50194262 CCCCCACCTCTCCCAAGTCCAGG + Intronic
1157936148 18:51874877-51874899 TCTCTGCCTCTCTCACGTACTGG + Intergenic
1158627378 18:59082988-59083010 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1158667277 18:59443717-59443739 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1158985800 18:62815404-62815426 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1159850460 18:73521046-73521068 CCTCAGCCTCCCAAAAGTACTGG - Intergenic
1160248663 18:77181948-77181970 CCTGAGCCTCTCCCACGGAGGGG - Intergenic
1160736034 19:662833-662855 CCTCAGTCTCCCGCATGTACAGG + Intronic
1161462793 19:4408721-4408743 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1161496636 19:4590126-4590148 CCTCAGCCTCCCCAGAGTGCTGG + Intergenic
1161820356 19:6526991-6527013 CCTCAGACTCCCCAAAGTGCTGG - Intergenic
1161948134 19:7451663-7451685 CCTCGGTCTCTCCAAAGTGCTGG + Intronic
1162030564 19:7915513-7915535 CCTCAGCCTCTCTTAAGTGCTGG - Intergenic
1162089976 19:8272970-8272992 CCTCAGACTCTCAAAAGTGCTGG - Intronic
1162157384 19:8688021-8688043 CCTCAGCCTCCCACGATTACAGG + Intergenic
1162173336 19:8809026-8809048 CCTCAGCCTCTCAAAAGTGCTGG + Exonic
1162227967 19:9240119-9240141 CCTTGGCCTCTCCAAAGTGCTGG + Intergenic
1162456342 19:10787217-10787239 CCTCGGCCTCCCAAAAGTACGGG - Intronic
1162468415 19:10857044-10857066 CCTCAGCCTCCCAAAAGTCCTGG + Intronic
1162670528 19:12253728-12253750 CCTCAGCATCCCCAAAGTGCTGG - Intronic
1163008032 19:14408420-14408442 CCTTAGTCTGTCCCGAGTACTGG - Exonic
1163021733 19:14484849-14484871 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
1163104870 19:15117421-15117443 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
1163141383 19:15351361-15351383 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1163143392 19:15364737-15364759 CCTTAGCCTCCCCAAAGTGCTGG + Intronic
1163146683 19:15384548-15384570 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1163160113 19:15459187-15459209 CCTCAGCCTCACCAAAGTGTGGG + Intronic
1163292584 19:16389202-16389224 CCTCAGCCCCTCCAAAGTGCTGG - Intronic
1163363155 19:16860714-16860736 CCTCAGCCTCTCCCAGTAGCTGG + Intronic
1163388153 19:17012930-17012952 CCCCAGCCTCCCCAAAGTGCTGG - Intronic
1163407032 19:17129147-17129169 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1163460166 19:17432519-17432541 CCTCAGCCTCCCACAAGTGCTGG + Intronic
1163520636 19:17789544-17789566 CCTGAACCTCTCCCAACTACAGG - Intergenic
1163590255 19:18189589-18189611 CCTCAGCCTCTCCGAGTAACTGG - Intergenic
1163776038 19:19218345-19218367 CCTCAGCCTCCCGAAAGTGCTGG - Intronic
1163790377 19:19302725-19302747 CCTGAGCCTCTCCCCAGGAGAGG - Intronic
1163890226 19:20005188-20005210 CCTCAGCCTCTCCCAGTAGCTGG + Exonic
1163923148 19:20312521-20312543 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1164079618 19:21851275-21851297 CCTCAGCCTCCCAAAAGTCCTGG - Intronic
1164906242 19:31970584-31970606 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1164949384 19:32323561-32323583 CCTCAGCCCCCCCAAAGCACTGG + Intergenic
1165047336 19:33115742-33115764 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1165083064 19:33322060-33322082 CCTCAGCCCCCCCAAAGTGCTGG - Intergenic
1165109819 19:33495733-33495755 CCTCAGCCTTCCCAAAGTGCTGG - Intronic
1165293422 19:34906910-34906932 CATCAGCCTCTCAAAAGTGCTGG + Intergenic
1165302247 19:34977560-34977582 CCTCGGCCTCCCCGAAGTGCTGG - Intergenic
1165343638 19:35229424-35229446 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1165457586 19:35922690-35922712 CCTCAGCCTCCCGAAAGTGCTGG + Intergenic
1165633317 19:37320000-37320022 CCTCAGCCTCTCCCAGTAGCTGG + Intronic
1165777001 19:38410661-38410683 CCTCAGCCTCCCCGAAGTCCTGG + Intronic
1165822802 19:38687220-38687242 CCTCAGCCCCCCCAAAGTGCTGG + Intronic
1166196666 19:41210746-41210768 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1166255360 19:41600694-41600716 CCGCAGCCTGTCCCAGGCACTGG + Intronic
1166401418 19:42483418-42483440 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1166586519 19:43953830-43953852 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1166620752 19:44297866-44297888 CCTCAGCCTCCCCAAAATGCTGG - Intronic
1166795061 19:45420871-45420893 CCTCAGCCTCTCCAAAGTGCTGG + Intronic
1166893211 19:46007297-46007319 CCTCAGCCTCTCAAAAGTACTGG + Intronic
1166928713 19:46287975-46287997 CCTCGGCCTCACCAAAGTGCTGG - Intergenic
1167328309 19:48838053-48838075 TCTCAGCCTCTCCCAAGCCCTGG - Exonic
1167371413 19:49084840-49084862 CCTCAGCCTCCCAAAAGTTCTGG + Intergenic
1167974484 19:53213761-53213783 CCTCAGCCTCCCGAAAGTGCTGG - Intergenic
1168240738 19:55087667-55087689 CCTCAGACTCTCCCCAATAGCGG + Exonic
1168268596 19:55237261-55237283 CCTCAGGCTCTTCCAAGGACAGG + Intronic
1168346657 19:55653167-55653189 CCTCAGCCTCTTCCTAGGAGGGG + Intergenic
1168542186 19:57222096-57222118 CCTCAGCCTCCCAAAAGTGCTGG - Exonic
1168708926 19:58486656-58486678 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
925328150 2:3038737-3038759 CCACAGCCTCTTCCAAGTCGTGG - Intergenic
925348384 2:3185666-3185688 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
925939223 2:8799384-8799406 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
927572235 2:24169812-24169834 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
927800905 2:26098386-26098408 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
928404204 2:31002177-31002199 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
928500055 2:31881892-31881914 CCTCAGCCTCTCAAAAGTCCTGG - Intronic
928792848 2:34979433-34979455 ATGCAGCCTCTCCCAAGTACTGG + Intergenic
928955835 2:36866314-36866336 CCTCAGCTTCTCAAAAGTGCTGG + Intronic
929105431 2:38360530-38360552 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
929155680 2:38786686-38786708 CCTCGGCCTATCCAAAGTGCTGG - Intergenic
929207503 2:39313761-39313783 CCTCGGCCTCCCAAAAGTACTGG + Intronic
929680274 2:43987243-43987265 CCTCGGCCTCCCCTAAGTGCTGG - Intronic
929715529 2:44305676-44305698 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
929721301 2:44371233-44371255 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
929807012 2:45155128-45155150 CCTCAGCCTCTCTCTAATGCTGG - Intergenic
930121088 2:47761373-47761395 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
930626762 2:53707390-53707412 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
931181620 2:59907237-59907259 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
931316660 2:61139422-61139444 CCTCAGCCACTCAAAAGTATTGG + Intergenic
931354901 2:61528173-61528195 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
931440636 2:62287835-62287857 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
931593274 2:63909975-63909997 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
931736206 2:65197070-65197092 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
931784452 2:65606948-65606970 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
932155843 2:69416646-69416668 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
932174585 2:69588011-69588033 CCTCAGCCTCCCTAAAGTGCTGG + Intronic
932189555 2:69729262-69729284 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
932362398 2:71119802-71119824 CCTCAGCCCTTCCAAAGCACTGG - Intronic
932401845 2:71486205-71486227 CCTCATCCTCTTCCAAGTGAGGG + Intronic
932519963 2:72401209-72401231 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
932644441 2:73486797-73486819 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
932652736 2:73576870-73576892 CCTCAGTCTCCCCAAAGTGCTGG + Intronic
932696925 2:73964713-73964735 CCTCAGCCTCTCCTATGTGGAGG + Intergenic
932797123 2:74705814-74705836 CCTCAGCCTCTCAAAAGCACTGG + Intergenic
933520794 2:83369784-83369806 CCTCGGCCTCTCAAAAGTGCTGG + Intergenic
933898912 2:86835496-86835518 CCTCAGCCTCAGCCAAGTTTGGG - Intronic
934741326 2:96725348-96725370 CTTCAGCCTCCCACAAGTGCTGG + Intronic
935441980 2:103109613-103109635 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
935610526 2:105019607-105019629 CCTCAGCCTTCCCAAAGTGCTGG - Intergenic
935667476 2:105525308-105525330 CCCCAGCCTCTCCCCACTCCTGG + Intergenic
935781634 2:106513730-106513752 CCTCAGCCTCAGCCAAGTTTGGG + Intergenic
937182308 2:120007720-120007742 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
937390629 2:121482875-121482897 CCTCAAACTCTCCCCAGGACCGG + Intronic
937485681 2:122312663-122312685 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
937723107 2:125126541-125126563 TCACACCCTCTCCCAAGTTCTGG + Intergenic
938300337 2:130206578-130206600 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
938719893 2:134057477-134057499 CCTCTGCCACCCCCAAGTACAGG + Intergenic
938814504 2:134886496-134886518 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
939321802 2:140632811-140632833 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
939418724 2:141937260-141937282 CCTCAGCCTCTCCCAGTAGCTGG - Intronic
939577127 2:143909312-143909334 ACGCAGCCCCTCCCAAGTGCTGG + Intergenic
940432665 2:153611609-153611631 CCTCAGCCTTCCCAAAGTGCTGG + Intergenic
940910507 2:159205961-159205983 CCTGAGCATCTCACCAGTACTGG + Intronic
941648896 2:168071752-168071774 CCTCAGCCTCTCCCAGTAGCTGG - Intronic
941715908 2:168763124-168763146 CCTCAGCCCCCCCAAAGTGCTGG + Intronic
941903800 2:170702178-170702200 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
941938140 2:171002890-171002912 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
942165190 2:173234500-173234522 CCATGGCCTCTCCCAAGTCCGGG - Intronic
943194787 2:184731823-184731845 CCTCAGCCTTTCAAAAGTGCTGG + Intronic
944176784 2:196838793-196838815 CCTCTGCCTCCCCAAAGTGCTGG - Exonic
944178108 2:196856265-196856287 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
944558994 2:200916367-200916389 CCTCAGCATCCCACAAGTAGCGG - Intronic
944647221 2:201792020-201792042 CCTCAGCCTACCCAAAGTGCTGG + Intronic
944671489 2:201997999-201998021 CCTCAGCCTTCCCAAAGTCCTGG + Intergenic
944744110 2:202638124-202638146 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
944798511 2:203212135-203212157 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
944897560 2:204180634-204180656 GCTCAGCCTGTCCCTAGTCCTGG + Intergenic
945167520 2:206961840-206961862 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
945260580 2:207839681-207839703 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
945347851 2:208739687-208739709 TCTCTGCTTCTCCCATGTACTGG + Intronic
945390515 2:209260312-209260334 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
945448376 2:209965184-209965206 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
945820733 2:214661832-214661854 CCTCACCTACTTCCAAGTACTGG + Intergenic
945859385 2:215103518-215103540 ACTCAGCCTCCCACAAGTGCTGG + Intronic
945961867 2:216143962-216143984 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
946013317 2:216583970-216583992 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
946423848 2:219581464-219581486 CCTTAGCCTCCCCCAAATGCTGG - Intergenic
946680418 2:222209053-222209075 ACTCTGCCTCTCCCAAGCAGAGG + Intronic
946735311 2:222748136-222748158 CCTCAGCCTTCCCAAAGTACTGG + Intergenic
946825193 2:223670654-223670676 CCTCAGCCTCCCCAGAGTACTGG + Intergenic
946835796 2:223771083-223771105 CCTCAGCCCCCCCAAAGTGCTGG - Intronic
947510331 2:230747101-230747123 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
947686129 2:232086928-232086950 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
947879543 2:233494614-233494636 CCTCAGCCTCCCCAAAGTACTGG - Intronic
948141446 2:235675303-235675325 CCTCAGCCTCTCCGAATAGCTGG + Intronic
948191726 2:236064338-236064360 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
948419785 2:237850226-237850248 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
948527475 2:238580555-238580577 TCTCAGGGTCTCCCAAGTGCAGG - Intergenic
1169223272 20:3839637-3839659 CCTCAGCCTCCCCAGAGTGCTGG - Intergenic
1169351661 20:4873002-4873024 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1169355290 20:4900119-4900141 CCTCTCCCTCTCCAAAGTGCTGG + Intronic
1169447537 20:5685035-5685057 CCTCAGCCTTCCCAAAGTGCTGG - Intergenic
1169702366 20:8461362-8461384 GCTCAGCCTCTACCACTTACAGG + Intronic
1169791151 20:9412258-9412280 CCTCCTCCTCTCCCAAGTAGTGG + Intronic
1169918710 20:10710034-10710056 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1170634224 20:18090967-18090989 CCTTAGCCTCCCCAAAGTGCTGG + Intergenic
1172008955 20:31835426-31835448 CCTCTGCCTCTCACCAGGACAGG + Intergenic
1172040990 20:32045766-32045788 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1172086036 20:32383555-32383577 CCTCGGCCTCCCACAAGTGCTGG + Intronic
1172102806 20:32495705-32495727 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1172364416 20:34338024-34338046 CCTCATCCTCCCCAAAGCACTGG - Intergenic
1172743868 20:37191515-37191537 CCTCGGCATCCCCAAAGTACTGG - Intronic
1172900323 20:38329960-38329982 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1173219572 20:41120989-41121011 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1173244719 20:41328462-41328484 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1173486816 20:43447188-43447210 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1173489542 20:43468681-43468703 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1173544981 20:43889819-43889841 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1173668726 20:44782525-44782547 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1173863414 20:46298747-46298769 CCCCTGCCTCTCCCAAGCATAGG + Intronic
1174248833 20:49202788-49202810 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1174252118 20:49227615-49227637 CCTCAGCCTCTCAAGAGTGCTGG + Intronic
1174313763 20:49680968-49680990 CGTCAGCCTCCCCAAAGTGCTGG - Intronic
1174442129 20:50564341-50564363 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1174466762 20:50723783-50723805 CCTCGGCCTCTCAAAAGTGCTGG + Intergenic
1174627644 20:51928454-51928476 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1175179073 20:57132314-57132336 CCTCAGCCTCTTCCAGGGCCAGG - Intergenic
1175223014 20:57428365-57428387 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1175551466 20:59820614-59820636 CCTGAGCCTCTCCCCTGCACAGG - Intronic
1175767205 20:61599745-61599767 GCTCTGCCTCTCCCACGCACTGG + Intronic
1175836822 20:62001363-62001385 CCTCAGCCTCTCCTGACTCCTGG + Intronic
1175919476 20:62443727-62443749 CCTCAGCCTCCCCAAAGTATTGG + Intergenic
1176015906 20:62932122-62932144 TCTCAGCCTCCCCAAAGTGCTGG + Intronic
1176057043 20:63154504-63154526 CCTCAGCCACCCCGGAGTACAGG + Intergenic
1176065098 20:63190357-63190379 CCCCTGCCTCCCCCAAGTGCCGG - Intergenic
1176924555 21:14731778-14731800 CCTCGGCCTCCCAGAAGTACTGG + Intergenic
1177247661 21:18550850-18550872 CCTCGGCCTCCCACAAGTGCTGG - Intergenic
1177971958 21:27801100-27801122 CCTCAGCCTCCCCAAAGTGTTGG + Intergenic
1178231232 21:30787211-30787233 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1178268707 21:31169041-31169063 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1178613618 21:34110211-34110233 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1178660965 21:34507267-34507289 CTTCAGCCACTCTCAAGTCCTGG - Intergenic
1178956959 21:37031396-37031418 CCTCAGCCTCCCCAAAGTACTGG + Intergenic
1179207168 21:39292200-39292222 CCTCAGCCTCCCTAAAGTGCTGG + Intronic
1179235062 21:39538516-39538538 ACGCAGCCCCTCCCAAGTGCTGG - Intergenic
1180585165 22:16881890-16881912 CCTCAGCCTCTCCCAGTGGCTGG - Intergenic
1180610544 22:17094234-17094256 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1180684127 22:17651630-17651652 CCTCAGGCTCCCCAAAGTGCTGG + Intronic
1180902376 22:19384067-19384089 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1180978248 22:19863246-19863268 TCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1181569870 22:23762786-23762808 CCCCAGCCTCCCACAAGTGCTGG - Intergenic
1181696851 22:24597422-24597444 CCTTAGCCTCCCCAAAGTGCTGG - Intronic
1181728553 22:24828112-24828134 CCTCAGCTTCTCCCAACTTGAGG - Intronic
1181878450 22:25958410-25958432 CAGCAGCCTCTTCCAAATACTGG + Intronic
1181925512 22:26355476-26355498 CCTCAGCCTCCCACAAGTGTTGG - Intronic
1182439750 22:30356338-30356360 CCACAGCCTTTCCCCAGTAATGG - Intronic
1182633492 22:31706079-31706101 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1182638032 22:31744520-31744542 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1182708380 22:32304389-32304411 CCTCAGCCTCTCAAAAGTACTGG + Intergenic
1182719967 22:32389560-32389582 CCTCAGCCTCCCGAAAGTGCTGG + Intronic
1182739882 22:32560054-32560076 CTGCAGCCCCTCCCAAGTGCTGG + Intronic
1183049503 22:35249307-35249329 CCTCAGCCTCCCCCAAGTACTGG + Intergenic
1183152798 22:36051220-36051242 CCTCACCCTCCCCCAAATACTGG - Intergenic
1184153240 22:42650318-42650340 CCTCAGCCTCCCGAAATTACAGG + Intergenic
1185177021 22:49333730-49333752 CCTCAGCCTCTCCCATTCCCTGG + Intergenic
1185200108 22:49496855-49496877 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1185265235 22:49898637-49898659 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1185391980 22:50567043-50567065 CCTCAGCCTCTCCCAGTAGCTGG + Intergenic
949351781 3:3130829-3130851 CCTCAGCCACTCAAAAGTGCTGG - Intronic
949457030 3:4249931-4249953 CCTCGGCCTCCCCCAAGTGCTGG - Intronic
949540635 3:5029346-5029368 CCTCAGCCTCCCCAAAGTGCCGG + Intergenic
949557043 3:5163617-5163639 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
949745993 3:7292779-7292801 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
950041611 3:9923299-9923321 CCTCAGCTTCCCCAAAGTGCTGG - Intronic
950408337 3:12818172-12818194 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
950815018 3:15691877-15691899 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
951550837 3:23873495-23873517 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
951608436 3:24463505-24463527 CCTCAGCCTCCACAAAGTGCTGG + Intronic
951845051 3:27076480-27076502 CCTCAGCCCCTGCAAAGTGCTGG + Intergenic
952365251 3:32668813-32668835 CCTCAGCTTCTGCAAAGTGCTGG - Intergenic
952388999 3:32863930-32863952 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
952694273 3:36247738-36247760 CCTCAGCCTACACCAACTACAGG + Intergenic
952915139 3:38232167-38232189 CCTCAGCCTCCCACAGGTGCTGG - Intronic
953276954 3:41510910-41510932 CCTCAGCCTCCCAAAAGTGCAGG - Intronic
953310563 3:41873801-41873823 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953380866 3:42472025-42472047 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
953912805 3:46901398-46901420 CCTCAACCTCCCCCAGGTGCTGG + Exonic
954043240 3:47906431-47906453 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
954250483 3:49363483-49363505 CCTTAGCCTCTCAAAAGTGCTGG - Intronic
954254204 3:49392594-49392616 CCTCAGCCTTCCACAAGTGCTGG + Intronic
954419838 3:50412958-50412980 CCTCTCCCTGTCCCAAGTCCTGG - Intronic
954635667 3:52069494-52069516 TCCCAGCCTCCTCCAAGTACAGG - Intergenic
954676379 3:52317901-52317923 CCTCCGCCTCACCGACGTACCGG - Intronic
954695553 3:52423034-52423056 CCTCTGCTTCTCCCAGGCACAGG - Intronic
954721187 3:52564947-52564969 CCTCGGCCTCCCCAAAGTACTGG - Intronic
954805777 3:53219415-53219437 CCTCAGCCTCTCCGAATAGCTGG - Intergenic
954937006 3:54335753-54335775 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
955396173 3:58559286-58559308 CCTTAGCCTCCCCAAAGTGCTGG - Intergenic
955734287 3:62020112-62020134 CCCTACCCTCTGCCAAGTACTGG - Intronic
955916946 3:63915934-63915956 CCTCAGCCTCCACGAAGTGCTGG + Intronic
956441137 3:69281182-69281204 CCTCAGCCTCCCAAAAGTGCCGG + Intronic
956620102 3:71213565-71213587 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
956881994 3:73520252-73520274 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
958156590 3:89762607-89762629 TCTCTGCCTCTCCCACATACTGG + Intergenic
958442928 3:94178538-94178560 ACTCAGCCTCCCCAAAGTGCTGG - Intergenic
958620353 3:96550631-96550653 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
959713035 3:109403816-109403838 CCTCAGCCTCAATCAAGTAGTGG + Intergenic
959758517 3:109928542-109928564 CCTCTGCCTCTCAAAAGTTCTGG - Intergenic
959983175 3:112541137-112541159 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
960024622 3:112994171-112994193 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
960126209 3:114000902-114000924 CCTCAGCCTCCCAAAAGTTCTGG + Intronic
960650343 3:119941265-119941287 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
960656746 3:120012935-120012957 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
961327217 3:126116130-126116152 CCTCAGTCTCCCCAAAGTGCTGG + Intronic
961559721 3:127720259-127720281 CCTCAGTCTCACCCCAGTGCTGG - Intronic
961874873 3:130014595-130014617 CCTCAGCCTCTCAAAAGTCTGGG + Intergenic
962243700 3:133773409-133773431 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
962560227 3:136598674-136598696 CCTCGGCCTCCCCAAAGTACTGG + Intronic
963121608 3:141781284-141781306 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
963673707 3:148282182-148282204 CCTCAGCCTTTCCCATGTTGTGG - Intergenic
963968165 3:151397454-151397476 CCTCAGAACCTCCTAAGTACAGG - Intronic
964111023 3:153087684-153087706 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
964461039 3:156928618-156928640 CCTCAGCCTCTGAGAAGTAAGGG + Intronic
964711717 3:159677949-159677971 CCTCAGCATCCCCAAAGTGCTGG + Intronic
964878302 3:161394805-161394827 CCCCTGCCACTCCCAAGAACAGG - Intergenic
965035794 3:163435904-163435926 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
965412506 3:168349564-168349586 CCTTGGCCTCTCCAAAGTGCTGG + Intergenic
965429114 3:168564791-168564813 CCTCAATCTATCCCAAGAACAGG + Intergenic
966172304 3:177095730-177095752 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
966185910 3:177227042-177227064 CCTCAGTCTCTCAAAATTACTGG + Intergenic
966338142 3:178894367-178894389 CCTCGGCCTCTCAAAAGTGCTGG - Intergenic
966516066 3:180821959-180821981 TCTAATCCTCTCCCAAGTCCAGG + Intronic
966759629 3:183405963-183405985 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
966806840 3:183814626-183814648 CCTCAGCCTCCACAAAGCACTGG - Intergenic
967403207 3:189086472-189086494 CCTCAGCCTCCCCAAAATTCTGG + Intronic
967456371 3:189691085-189691107 CCTCAGCCTTTGCAAAGTGCTGG - Intronic
967553705 3:190830719-190830741 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
967719505 3:192800327-192800349 CCTCGGCTTCCCCCAAGTGCTGG + Intronic
968240981 3:197085035-197085057 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
968259298 3:197306873-197306895 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
968778839 4:2563452-2563474 CCTCGGCCTCCCAAAAGTACTGG - Intronic
968837962 4:2979461-2979483 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
969292164 4:6246826-6246848 ATGCAGCCCCTCCCAAGTACTGG + Intergenic
969335724 4:6508801-6508823 ACGCAGCCCCTCCCAAGTGCTGG + Intronic
969403823 4:6975458-6975480 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
969632071 4:8344584-8344606 ACTCAGCCCCTCCCCACTACTGG - Intergenic
970190435 4:13511092-13511114 CCTCAGTCTCTCAAAAGTGCTGG - Intergenic
970279275 4:14436219-14436241 CCTCTGCCTCCCCAAAGTGCTGG - Intergenic
970638441 4:18036522-18036544 CCTCGGCCTCCCCGAAGTGCTGG - Intergenic
971009949 4:22422943-22422965 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
971109481 4:23567712-23567734 CCTCAGCCTCTCCACAGTGCTGG + Intergenic
971684893 4:29751699-29751721 CCTCAGCCTCCCCAAAGGGCTGG - Intergenic
971772541 4:30915770-30915792 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
972596464 4:40534063-40534085 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
972695449 4:41440781-41440803 CCTCTGCCTCTCCAAAGTGCTGG + Intronic
972716474 4:41651253-41651275 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
972791688 4:42378272-42378294 CCTCAGCCTCCCCAAAATGCTGG + Intergenic
972808664 4:42558923-42558945 CCTCAGCCTCCCGAAAGTGCTGG - Intronic
973286854 4:48428022-48428044 CCTCAGCCTCCCGTAAGTGCTGG - Intergenic
973887444 4:55337380-55337402 CCTCAGCCTCCCCAAAGTGGTGG + Intergenic
973937078 4:55857292-55857314 CCTCAGCCTCTCCCAGTAGCTGG + Intronic
973951942 4:56024885-56024907 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
975123789 4:70758787-70758809 CCTCGGCCTCCCACAAGTGCTGG - Intronic
975679077 4:76857728-76857750 CCTCAGCCCACCCCAAGTGCTGG - Intergenic
975993729 4:80289254-80289276 CCTCGGCCTCCCCAAAGTGCTGG + Exonic
976074774 4:81285169-81285191 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
976241394 4:82960808-82960830 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
976504883 4:85835307-85835329 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
976755676 4:88495296-88495318 CCTCAGCCTCCCCGCAGTGCTGG - Intronic
977380275 4:96264041-96264063 CCTCAGCCTGTCCCTACTGCTGG - Intergenic
978837335 4:113167547-113167569 CCTCAGCCTCCCCAAAGTGCGGG + Intronic
979737533 4:124105437-124105459 GCTCTGCCTCTCTCACGTACGGG + Intergenic
980207057 4:129733376-129733398 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
980648046 4:135670807-135670829 CCACAACATCTCCCAAGAACTGG - Intergenic
980668198 4:135967943-135967965 CCTTGGCCTCTCACAAGTGCTGG - Intergenic
980944807 4:139308864-139308886 CCTCAGCCTCTCCCAAGTGCTGG + Intronic
980956576 4:139434577-139434599 CCTCAGCCTCCCAAAAGTACTGG + Intergenic
981309671 4:143284600-143284622 CCTCAGCTTCCCCAAAGTGCTGG - Intergenic
982005395 4:151058352-151058374 CCTCAGCCTCCCAAAAGTACTGG - Intergenic
982151097 4:152458266-152458288 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
982251740 4:153414010-153414032 CCACCCCCTCTCCCTAGTACTGG + Intronic
982640200 4:157949440-157949462 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
982949076 4:161665355-161665377 CCTCAGCCTCCCCAGACTACAGG + Intronic
983133557 4:164052279-164052301 CCTCACCCTCCCCTAAGTGCTGG - Intronic
983625047 4:169793962-169793984 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
983633879 4:169878341-169878363 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
984647906 4:182239326-182239348 CCTCACCCTCCCAAAAGTACTGG + Intronic
984802548 4:183728373-183728395 CCTCGGCCTCTCAAAAGTGCTGG + Intergenic
984853806 4:184176037-184176059 CCTCAGCCTCCCCAAAATGCTGG + Intronic
985135885 4:186785732-186785754 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
985147969 4:186914024-186914046 CCTCAGCCTCCTCAAAGTGCTGG - Intergenic
985575149 5:670435-670457 TCTCAGACTCGCCTAAGTACAGG - Intronic
985887908 5:2694502-2694524 CCTCTGCCTATCACAAGGACAGG - Intergenic
986070592 5:4278838-4278860 CCTCAGCCTCTCCGAATAGCTGG + Intergenic
986237470 5:5925682-5925704 CCTCATCCTCACCCAGGCACAGG - Intergenic
986685023 5:10268955-10268977 CCTGCTCCTCTCCCAAGTGCTGG - Intergenic
986871636 5:12054127-12054149 CCTCAGCCTCTCAAAATTACAGG + Intergenic
987250729 5:16098515-16098537 CCTCTGCCTCCCCAAAGTGCTGG - Intronic
987334749 5:16888920-16888942 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
987335288 5:16893382-16893404 GCTCAGCCTCTCAAAAGTGCTGG - Intronic
987358488 5:17085427-17085449 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
987742670 5:21929766-21929788 CCTCAGCCCATCCAAAGTGCTGG + Intronic
987943579 5:24574133-24574155 CCTCGGCCTCTCCAAATTGCTGG + Intronic
988027488 5:25715940-25715962 CCTCAGCCTCCCTAAAGTTCTGG + Intergenic
988487625 5:31679758-31679780 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
988514033 5:31889767-31889789 CCTCAGCCTCCCAGAAGTATTGG - Intronic
988522416 5:31958502-31958524 CCTCAGCCTCCCCAAAGTGCCGG + Intronic
988873012 5:35411654-35411676 CCTTAGCCTTCCCAAAGTACTGG - Intergenic
988997449 5:36727776-36727798 CCTCAGCCTCTCCGAATAGCTGG - Intergenic
989071287 5:37514267-37514289 CCTCAGCCTCCCAGAAGTGCTGG + Intronic
989074081 5:37544020-37544042 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
990276296 5:54200642-54200664 CCTCTGCCTAACCCTAGTACAGG - Intronic
990319318 5:54613943-54613965 CCTCGGCCTCTCAAAAGTGCTGG + Intergenic
990405225 5:55483419-55483441 CCTCAGCCTCCCCAAAGTTCTGG - Intronic
990553935 5:56910837-56910859 CCTCTGGCTCTCCCACTTACTGG + Intronic
991056091 5:62322178-62322200 TCTCAGCCTCTCAGAAGTGCTGG + Intronic
991235392 5:64388804-64388826 CCTCAGGCTTTCCAAAGTGCTGG + Intergenic
991337433 5:65564567-65564589 CCTCGGCCTCTCAAAAGTGCTGG + Intronic
991687612 5:69196185-69196207 CCTCAGCCTCCCCAAAATGCTGG + Intronic
991689558 5:69213231-69213253 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
991708721 5:69385382-69385404 CCTCAGCCTCCCCCGAGTAGTGG + Intronic
991709899 5:69398555-69398577 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
992534043 5:77680600-77680622 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
992547470 5:77828126-77828148 CCTCTGCCTCCCCAAAGTGCTGG + Intronic
992818482 5:80469491-80469513 CCTCAGCCTCCCCAAAGTACTGG + Intronic
992844828 5:80735973-80735995 CCTCAGCCTCCCACAAGTGTTGG - Intronic
992964499 5:81986011-81986033 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
993169080 5:84393920-84393942 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
993721513 5:91325793-91325815 CCTCAGCCTTCCCAAAGTGCTGG + Intergenic
993728170 5:91391982-91392004 CCTAGGCCTCCCCAAAGTACTGG + Intergenic
993742954 5:91562778-91562800 TCACACCCTCTCCCAAGTTCTGG - Intergenic
994176166 5:96713722-96713744 CCTCAGCCTCCCCGAAGTGCTGG - Intronic
995066730 5:107870833-107870855 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
995194853 5:109355006-109355028 CCTTAGCCTGTCCCAGGTAGTGG - Intronic
995519317 5:112986747-112986769 TCTCGGCCTCTCAAAAGTACTGG - Intronic
996004873 5:118407660-118407682 ACTCAGCATCTCCCTAGTCCTGG + Intergenic
996070972 5:119131266-119131288 CCTCACCCTCCCCCAATTCCTGG - Intronic
996260619 5:121462932-121462954 CCTCAGCATCCCCAAAGTACTGG + Intergenic
996447667 5:123574568-123574590 CCTCAGACTCCCCAAAGTGCTGG - Intronic
996987260 5:129582819-129582841 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
997266969 5:132500654-132500676 CGTCAGACTCACCCAAGTATAGG - Intergenic
997284978 5:132671519-132671541 CCTCAGCCCCTGCAAAGTGCTGG - Intergenic
997504360 5:134405032-134405054 CCTTAGCCTCCCCAAAGTGCTGG + Intronic
997804017 5:136895920-136895942 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
997923684 5:138008188-138008210 CCTCAGCCTCTCAAAAGTGCTGG - Intronic
998080483 5:139271168-139271190 CCTTAGCCTCTTCAAAGTGCTGG + Intronic
998087021 5:139334769-139334791 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
998212036 5:140206883-140206905 CCTCAGACTCCCCAAAGTGCTGG + Intronic
998257639 5:140600711-140600733 CCTCAGCCTCTCAAAAGTGCTGG + Intergenic
998257852 5:140602511-140602533 CCTCAGCCTCTGAAAAGTGCTGG - Intergenic
998791592 5:145771603-145771625 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
998898400 5:146824971-146824993 CCTTAGCCTCCCCAAAGTTCTGG + Intronic
999446594 5:151645366-151645388 CCTCAACCTCCCCAAAGTGCTGG + Intergenic
999782463 5:154860555-154860577 TCTCAGCCTCTCAAAAGTGCTGG + Intronic
1000350072 5:160346115-160346137 CCTCAGCCTCCGCAAAGTGCTGG - Intergenic
1000601867 5:163284719-163284741 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1000901748 5:166919628-166919650 CCTCAGCCTCCCAAAAATACTGG + Intergenic
1001009668 5:168086289-168086311 CCTCAGTCTCTGCCAAGAAGTGG + Intronic
1001343270 5:170866423-170866445 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1001393291 5:171398034-171398056 CCTCGGCCTCCCACAAGTGCTGG + Intronic
1001615894 5:173043347-173043369 CGTCAGCCTCCCCAAAGTGCTGG + Intergenic
1001620222 5:173077641-173077663 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
1002035187 5:176463141-176463163 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1002133300 5:177094176-177094198 CCACAGCCTCTCCCAGCTCCAGG - Intronic
1002366426 5:178716143-178716165 CCTCAGCCTCCCCAAAGCGCTGG + Intronic
1002371448 5:178758204-178758226 CCTTAGCCTCCCGAAAGTACTGG - Intergenic
1002485054 5:179529540-179529562 CCTGAGCCTCCCCAAAGTGCTGG + Intergenic
1002614724 5:180444113-180444135 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1002634661 5:180601179-180601201 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1002722879 5:181274323-181274345 CCTCAGCCTCCCCAAAGTGTTGG - Intergenic
1002893675 6:1361079-1361101 CCTCAGCCTCCCAAAAGTACTGG + Intergenic
1003208337 6:4035715-4035737 TCTCAGCCTCCCCAAAGTGCTGG - Intronic
1003283859 6:4717180-4717202 CCTCAGCCTCTTTAAAGTACTGG - Intronic
1003683774 6:8281054-8281076 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1003877931 6:10454568-10454590 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1003913976 6:10768325-10768347 CCTCAGCCTCCCACAAGTGCTGG - Intronic
1004202414 6:13561439-13561461 CCTCAGCCTCTCCCGAGTATAGG - Intergenic
1004300438 6:14452787-14452809 CCTCACCCTCTCTTAAGTTCTGG + Intergenic
1004618132 6:17309846-17309868 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1004655445 6:17655702-17655724 CCTCAGCCTTCCCAAAGTACTGG + Intronic
1005218523 6:23560015-23560037 CCCCAGCCCCTCCCAAGTGCTGG + Intergenic
1005626404 6:27666463-27666485 CCTCAGCCCTCCCCAAGTAGCGG - Intergenic
1005752151 6:28893604-28893626 CCTCAGCCTCACCCAAGTGCTGG + Intergenic
1005763910 6:28992002-28992024 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1005950745 6:30629492-30629514 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1006340716 6:33445114-33445136 CCTCAGCCTCCACCAAGTGAGGG - Intronic
1006375864 6:33671343-33671365 CCTCAGCCTCCTCCTAGCACAGG + Intronic
1006478511 6:34273397-34273419 CCTCTGCCTGTCCCAGGCACAGG + Intergenic
1006524987 6:34596561-34596583 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1006540292 6:34734554-34734576 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1006551087 6:34823783-34823805 CCTCAGCCTCCCCAAAGCCCTGG + Intronic
1007560493 6:42804270-42804292 CCTCAGCCTCCCAAAAGTTCTGG + Intronic
1007595399 6:43048115-43048137 CCCCAGCCTCTCCCCAGAGCAGG + Intronic
1007891651 6:45299662-45299684 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
1008154415 6:47996216-47996238 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1008816222 6:55570021-55570043 TCTCAGCCTCAGCCAAGTCCTGG - Intronic
1009843128 6:69102060-69102082 CCTCAGCCTCTCCGAGTTGCTGG - Intronic
1010053900 6:71541223-71541245 GCTCAGACTCTTCCAACTACTGG + Intergenic
1010351657 6:74882075-74882097 CACCAGCCTCTCCTGAGTACAGG + Intergenic
1010354313 6:74912451-74912473 TCTCTGCCTCTCTCATGTACTGG + Intergenic
1010423121 6:75696725-75696747 CCTCTGCCTCCCCAAAGTACTGG + Intronic
1010439031 6:75871874-75871896 CCTCAGCCTTCCCAAAGTGCTGG - Intronic
1010694374 6:78952168-78952190 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1011004206 6:82625314-82625336 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1011516046 6:88154827-88154849 CCTCGGCCTCCCACAAGTGCTGG + Intronic
1011730523 6:90258022-90258044 CCTCAGCCTCCCAAAAGTGCCGG + Intronic
1012584279 6:100903788-100903810 CCTCTGCCTCCCACAAGTGCTGG + Intergenic
1012875916 6:104725940-104725962 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1012906685 6:105074955-105074977 CCTCAGCCTCCCAGAAGTGCTGG + Intronic
1012911575 6:105123648-105123670 CCTCAGCCTCCCAAAATTACAGG + Intronic
1012933773 6:105344239-105344261 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1013079473 6:106799958-106799980 CATCAGCCTTTCCCAAATAATGG - Intergenic
1013175170 6:107670342-107670364 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1013521846 6:110940751-110940773 CCTCAGCCTGCCCAAAGTGCTGG - Intergenic
1013572998 6:111448734-111448756 CCTCAGCCTCTCCAGTGTATGGG + Intronic
1014259035 6:119195079-119195101 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1014554387 6:122828428-122828450 CCTCAGCCTCTCCAAAATGTTGG - Intergenic
1014819629 6:125972838-125972860 CCTCAGCCTCACACAAGTTCTGG + Intronic
1015645847 6:135387130-135387152 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1015687427 6:135880682-135880704 CCTCTGCCTCTCTCAACTTCAGG - Intronic
1016508535 6:144813435-144813457 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1016825172 6:148381884-148381906 CCTCTGCCTCCCCAAAGTGCTGG + Intronic
1016956650 6:149633478-149633500 CCTCAGCCTCCCTAAAGTGCTGG - Intronic
1016967319 6:149731015-149731037 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1016967570 6:149733000-149733022 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1017096722 6:150811519-150811541 CCTCAGCCTTTCCAAAGTGTTGG + Intronic
1017255107 6:152324542-152324564 CCTCAGCCCCCGCCAAGTGCTGG - Intronic
1017274835 6:152554050-152554072 GCTGAGCCTCTCCCCAGGACTGG - Intronic
1017381776 6:153839548-153839570 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1017636775 6:156451824-156451846 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1019294763 7:267860-267882 CCTCAGCCTCCCCAAAATGCTGG + Intergenic
1019351290 7:555208-555230 CCTCAGCCCCTCCCCAGAGCGGG - Intronic
1019485369 7:1286937-1286959 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1019785415 7:2973947-2973969 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1019810501 7:3161922-3161944 CCTCAGCTTCACCAAAGTGCTGG - Intronic
1019825786 7:3283142-3283164 CCTCAGCCTCACGAAAGTGCTGG + Intergenic
1019933748 7:4240889-4240911 CCTCAGCCCCTCCCTAACACGGG - Intronic
1019985561 7:4652878-4652900 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1020215247 7:6185333-6185355 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1020869704 7:13612012-13612034 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1021209261 7:17825016-17825038 CCTCAGCCTCCCAAAAGTTCTGG + Intronic
1021707743 7:23384638-23384660 CCTCTGCCTCCCCAAAGTGCTGG - Intronic
1021991059 7:26142109-26142131 CCGCAGCCCCTCCCAAGTGCTGG - Intergenic
1022505740 7:30907875-30907897 CCTCAGCCACACCCAAGGTCTGG + Intergenic
1022559373 7:31333489-31333511 ACTCAGCCACTCCCAGGTGCTGG - Intergenic
1023213001 7:37828807-37828829 CCTCAGCCTACCCAAAGTGCTGG + Intronic
1023316351 7:38941572-38941594 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1023329685 7:39101322-39101344 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
1023338671 7:39196506-39196528 CCTCAGACTCTCAAAAGTGCTGG - Intronic
1023462065 7:40409203-40409225 CCTTGGCCTCTCCAAAGTGCTGG + Intronic
1023944725 7:44794744-44794766 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1024167858 7:46752407-46752429 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1024262368 7:47582044-47582066 CCTCAGGCTCCCCCAGGTACTGG - Exonic
1024595015 7:50925284-50925306 CCTCAGCCTCCCCAAAGTGTTGG + Intergenic
1025021511 7:55484005-55484027 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1025081330 7:55986106-55986128 CTTCAGCCTCCCCAAAGTGCTGG - Intronic
1025135622 7:56409438-56409460 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1025174298 7:56789744-56789766 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1025697506 7:63786678-63786700 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1025745192 7:64236532-64236554 CCTCAGCCTCCACAAAGTGCTGG - Intronic
1025867074 7:65392784-65392806 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1026030613 7:66789920-66789942 CCACATCCTCTTCCAAGTGCTGG - Intronic
1026251901 7:68678621-68678643 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1026365854 7:69647604-69647626 CCTCAGCTTCCCCTAAGTGCTGG + Intronic
1026472214 7:70703242-70703264 CCTCAGCCTCCCAAAAGTTCTGG - Intronic
1026626471 7:71996975-71996997 CCTTGGCCTCCCCAAAGTACTGG - Intronic
1026766280 7:73161915-73161937 CCTCAGCCTATCACAGGCACAGG + Intergenic
1026782285 7:73276787-73276809 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1027023047 7:74829629-74829651 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1027042753 7:74971611-74971633 CCTCAGCCTATCACAGGCACAGG + Intronic
1027064878 7:75115681-75115703 CCTCAGCCTCCCAAAAGTTCTGG + Intronic
1027080889 7:75230746-75230768 CCTCAGCCTATCACAGGCACAGG - Intergenic
1027207510 7:76113308-76113330 CCACATCCTCTTCCAAGTGCTGG + Intergenic
1027258055 7:76443851-76443873 CCTCTGCCTCTCCCGGGTTCAGG - Intergenic
1027280791 7:76608180-76608202 CCTCTGCCTCTCCCGGGTTCAGG + Intergenic
1027295318 7:76763896-76763918 TCACACCCTCTCCCAAGTTCTGG - Intergenic
1027346439 7:77264507-77264529 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1027569273 7:79843442-79843464 CCTGACCCTCTTCCATGTACTGG + Intergenic
1028389663 7:90300899-90300921 CCTCAGCCTCTGCCAAGTGTTGG + Intronic
1028543608 7:91973123-91973145 CCTCAGCCTCCCCAAAATACTGG - Intronic
1028847664 7:95500314-95500336 CCTCAGCCTCCCCAAAGTTCTGG - Intronic
1029131135 7:98332130-98332152 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1029175573 7:98662232-98662254 CCTGAGCCTCTCACATGCACGGG + Intergenic
1029329868 7:99843714-99843736 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1029349778 7:100004884-100004906 CCTCAGCCTCCCTAAAGTGCTGG - Intergenic
1029389142 7:100263319-100263341 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1029566572 7:101342509-101342531 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1029653214 7:101907867-101907889 CCTCAGCCTCCTCAAAGTGCTGG - Intronic
1029666941 7:102001591-102001613 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1029727636 7:102417869-102417891 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1030024782 7:105312885-105312907 CCTTGGCCTCCCCCAAGTGCTGG + Intronic
1030168723 7:106580390-106580412 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1030321016 7:108167525-108167547 ATTCAACCTTTCCCAAGTACCGG + Intronic
1031313709 7:120231349-120231371 CCTTAGCCCCTCCAAAGTGCTGG - Intergenic
1031679653 7:124655574-124655596 CCTCAGCCTCCCCAAAGAGCTGG - Intergenic
1032036219 7:128523329-128523351 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1032073323 7:128823336-128823358 CCTCAGCCTGCCCAAAGTGCTGG + Intergenic
1032157639 7:129482034-129482056 CCTCAGCCTCCCCTGAGTAGAGG - Intronic
1032190121 7:129760252-129760274 CCTCAGCCTCTCTTAAGTGCTGG + Intergenic
1033033866 7:137852314-137852336 CCTCAGCCTCTCCCAGTGACTGG - Intergenic
1033065767 7:138152506-138152528 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1033164630 7:139029251-139029273 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
1033338332 7:140472168-140472190 CCTCAGCCTCCCAAAGGTACTGG - Intronic
1033711512 7:143951000-143951022 CCTCGGCCTCCCCAAAGTACTGG + Intergenic
1033842589 7:145393194-145393216 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1033928506 7:146494082-146494104 CCTCGGCCTCCCAAAAGTACTGG - Intronic
1034124740 7:148661404-148661426 TCTCAGCCTCTCAAAAGTGCTGG + Intergenic
1034241548 7:149615131-149615153 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1034401709 7:150865991-150866013 CCTTGGCCCCTCCAAAGTACTGG - Intergenic
1034424325 7:151006754-151006776 CCTCAGCCCCTCCCAAGGGCAGG + Intronic
1034575027 7:151989263-151989285 CCTCAGCCTCCCCCAAGAGCTGG + Intronic
1034781233 7:153884727-153884749 CCTCGGCCTCCCCAAAGTGCTGG - Intergenic
1034785713 7:153924355-153924377 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1035148432 7:156844072-156844094 CCTCGGCCTCCCAAAAGTACTGG - Intronic
1035162189 7:156959350-156959372 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1035873836 8:3165680-3165702 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1035995358 8:4540451-4540473 CCTCAGCCTCCCCTAAGTCCTGG - Intronic
1036094965 8:5713732-5713754 ACTCAGCCCCTCCCAGGTCCTGG - Intergenic
1036125337 8:6057056-6057078 CCTCAGCCTCTCAAAAGTGCTGG + Intergenic
1036196711 8:6723468-6723490 CCTCAGCCTCCCCAAAGCACTGG + Intronic
1036653151 8:10658705-10658727 CCTCAGTCTCTCCCCATCACCGG - Intronic
1036741792 8:11369466-11369488 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1037342073 8:17856624-17856646 CCTCAGCCTCTCCCAGTAGCTGG - Intergenic
1037488846 8:19377129-19377151 CCTTAGCCTCTCAAAAGCACTGG - Intronic
1037515514 8:19627571-19627593 CTTCAGCCTCTCTTAAGTTCTGG - Intronic
1037606357 8:20440998-20441020 CCTCAGCCCCTCCCACGTGCTGG + Intergenic
1037698576 8:21250803-21250825 CCTCGGCCTCCCCTAAGTGCAGG - Intergenic
1037944846 8:22982369-22982391 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1038024167 8:23574212-23574234 CCTCGGCCTCCCCAAAGTGCTGG - Exonic
1038330500 8:26604505-26604527 CCTCAGCCTCTCTCAAGATGAGG - Intronic
1038790362 8:30662995-30663017 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1039059050 8:33559052-33559074 CCTCAGCCTCTCCAAAGTACTGG - Intronic
1039511718 8:38097382-38097404 CCTCAGCCTCCCAAAAGTGCTGG + Intergenic
1039832235 8:41224459-41224481 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1039971157 8:42322799-42322821 CCTCAGCCTCCCCAAATTGCTGG - Intronic
1039996056 8:42534064-42534086 CCTCAGCCTCCCCAAAGTGTTGG - Intronic
1040012210 8:42671428-42671450 CCTCAGCCTCTTCAAAGTGCTGG + Intergenic
1041064984 8:54074023-54074045 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1041308088 8:56484497-56484519 CCTCAGCCTCTCAAAAGTGCTGG + Intergenic
1041525722 8:58803381-58803403 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1042153437 8:65814829-65814851 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1042202432 8:66292079-66292101 CCTCAGCCCCAGCCCAGTACAGG - Intergenic
1042216803 8:66436164-66436186 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1042341429 8:67684135-67684157 CCTCAGTCCCTGCAAAGTACTGG + Intronic
1042515621 8:69655655-69655677 CCTCATCCTCCCCAAACTACTGG + Intronic
1042520268 8:69704149-69704171 CGTCAGCCTCCCCCAAGTGCTGG + Intronic
1042831547 8:73034380-73034402 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1042865218 8:73350801-73350823 CCTCAACCTCTCAAAAGTGCTGG + Intergenic
1042891179 8:73611930-73611952 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1044656190 8:94550967-94550989 CCTCAGCCTCACCAAAGTGCCGG + Intronic
1044977548 8:97680320-97680342 CCTCAGCCCCTCCAAAGTGCTGG + Intronic
1045271366 8:100664608-100664630 CTTCAGCCTCACCGAAGTGCTGG + Intergenic
1045458237 8:102403294-102403316 TCTCAGCCTCTCCAAGGTGCTGG - Intronic
1046567740 8:115922288-115922310 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1046736377 8:117780512-117780534 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1046745750 8:117874323-117874345 CCTCAGCCTTCCCAAAGTGCTGG - Intronic
1046932985 8:119859467-119859489 CCTCAGCCTCCCCTAAGTGCAGG + Intergenic
1047764264 8:127977480-127977502 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1047774988 8:128062667-128062689 CCACATCCTCCCCCAAGTAATGG - Intergenic
1048344948 8:133569582-133569604 CCTCAGCCTCTGCCAATATCTGG - Intronic
1048801981 8:138202499-138202521 CCTCAGCCTCTCAAAAGTAGTGG + Intronic
1050227741 9:3479880-3479902 CCTCAGATTCACCCAAGTATAGG + Intronic
1050326399 9:4501987-4502009 TCTGAGCCTCTCCCCATTACTGG + Intronic
1050705523 9:8392273-8392295 CCTCAGCCTCCCCAAAGTGTCGG - Intronic
1051168373 9:14291232-14291254 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1051414202 9:16821696-16821718 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1051623645 9:19077808-19077830 CCTCGGCCTCCCCAAAGTACTGG - Intronic
1051634590 9:19170148-19170170 CCTCGGCCTCTCAAAAGTGCTGG + Intergenic
1052013453 9:23438294-23438316 CCCCAGTCTCTCCCATGTTCTGG + Intergenic
1053196451 9:36122913-36122935 CCTCATCATTTCCCAGGTACAGG + Exonic
1054453331 9:65415392-65415414 CCTCAGCCTCCCACAAATGCAGG - Intergenic
1054774422 9:69112971-69112993 CCTCACCCTCCCCAAAGTGCTGG - Intergenic
1054978144 9:71172149-71172171 CTTCAGCCTCCCCTAAGTGCTGG + Intronic
1055153082 9:73026593-73026615 CCTCAGCCTCCCCGAAGTGCTGG - Intronic
1055285841 9:74727130-74727152 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1055288440 9:74756591-74756613 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1055540758 9:77302621-77302643 CCTCAGCCTCTCAAAAGTGCTGG + Intronic
1055544300 9:77351532-77351554 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1055607924 9:77990470-77990492 CCTCAGCCTTTTCCAAGTGCTGG + Intronic
1056469359 9:86890389-86890411 CCTCTGCCTCCTCCAAGTTCAGG + Intergenic
1056492854 9:87125023-87125045 CCTCAGCTTCTCTGAAGTTCAGG + Intergenic
1056532738 9:87501268-87501290 CCTCAGCCTCCCAAAAGTGCTGG - Intronic
1056621001 9:88214525-88214547 CCTCGGCCTCCCCAAAGTGCCGG + Intergenic
1057045885 9:91886123-91886145 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1057069020 9:92079903-92079925 CCTCAGCCTCCCCAAAGTGCTGG + Intronic
1057249046 9:93484822-93484844 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1057279734 9:93701090-93701112 CCTCAGCCTCCAAAAAGTACTGG + Intergenic
1057345666 9:94248400-94248422 CCTCAGCCTTCCCAAAGTGCTGG + Intergenic
1057533740 9:95877567-95877589 CCTAAGCTTCCCCAAAGTACTGG - Intronic
1057601461 9:96461904-96461926 CCTCAGCCTCCCCAAAGTGCTGG - Intronic
1057661595 9:97008532-97008554 CCTCAGCCTCTCAAGAGTGCTGG - Intronic
1057901737 9:98954163-98954185 CCTCTGCCTCTCCCATCTCCTGG - Intronic
1058043906 9:100335448-100335470 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1058565831 9:106284161-106284183 CTGCTGCCTCTCCCAAGTCCTGG + Intergenic
1058682612 9:107453236-107453258 CCTCAGCCTCCCGAAAGTGCTGG + Intergenic
1059231384 9:112724743-112724765 CCTCAGCCTCTCAAAAGTGCTGG + Intergenic
1059231873 9:112728123-112728145 CCTCAGCCTCACCAAAGTGCTGG - Intergenic
1060242588 9:121917216-121917238 CCTCGGCCTCTCAAAAGCACTGG - Intronic
1060314926 9:122500334-122500356 TCTCTGCCTCTCTCACGTACTGG + Intergenic
1060413970 9:123417977-123417999 CCCCAGCCCCTCCCAGGTCCTGG - Intronic
1060465280 9:123898576-123898598 CCTCAGCCTCCCAAAATTACAGG + Intronic
1060600225 9:124872343-124872365 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1060660194 9:125400921-125400943 GCCCAGCCTCTCCCAAGCCCGGG + Intergenic
1060948969 9:127588591-127588613 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1061062309 9:128256741-128256763 CCTCAGCCTCCCAAAAGTGCTGG + Exonic
1061068063 9:128291252-128291274 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1061235920 9:129342623-129342645 CCTCAGCCTCTGCCAGGTTCCGG - Intergenic
1061516107 9:131091446-131091468 CCTGAGCCTCTCCCCAGCTCAGG - Intronic
1061600551 9:131667238-131667260 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1062086637 9:134652569-134652591 CCTCGGACTCCCCCAACTACAGG - Intronic
1062362910 9:136195979-136196001 CCCCTGCCTCTCCCAGGGACAGG + Intergenic
1062738582 9:138152929-138152951 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1185488921 X:504396-504418 CCTCAGCCTCCCCAAAGTGCTGG + Intergenic
1185530743 X:816481-816503 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1185560331 X:1056004-1056026 CCTCGGCCTCCCCAAAGTGCTGG + Intergenic
1185592888 X:1289376-1289398 CCTCAACCTCCCCAAAGTGCTGG + Intronic
1185820462 X:3198090-3198112 CCTCAGTCTCTCAAAAGTGCTGG - Intergenic
1186345633 X:8689445-8689467 CCTCGGCCTTTCCAAAGTGCTGG - Intronic
1186780272 X:12905135-12905157 CCTCGGCCTCTACAAAGTGCTGG + Intergenic
1187050808 X:15694117-15694139 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1187477382 X:19624077-19624099 CCTCAGCCTCCCCAAAGTGTTGG + Intronic
1187707579 X:22023546-22023568 CATCAGCATCTCCCAAGAGCTGG + Intergenic
1188378121 X:29458028-29458050 CCTCAGCCTCCCCAAAGTACTGG + Intronic
1188594737 X:31885358-31885380 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1189825892 X:44916894-44916916 CCTCAGCCTCCCCAAAGTGTTGG + Intronic
1190727878 X:53202931-53202953 CCTCAGCCTCTCCGAATAGCTGG + Intronic
1190861438 X:54348419-54348441 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1191791665 X:64977749-64977771 CCTCAGCCTCCCAAAAGTGCTGG + Intronic
1193078492 X:77381472-77381494 CCTCAGCCTCCCCAAAATACTGG - Intergenic
1193080301 X:77399935-77399957 CCTCAGCCTCCCACAAGTGCTGG + Intergenic
1194260079 X:91684541-91684563 CTTCTGCCTCTCTCATGTACTGG - Intergenic
1194296491 X:92132357-92132379 CCTCGGCCTCACCAAAGTGCTGG - Intronic
1194837642 X:98700385-98700407 CCTCAGCCTCTCCCACTTCAAGG - Intergenic
1195394880 X:104399755-104399777 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1196026131 X:111043037-111043059 CCTCAGCCTCACAAAAGTGCTGG - Intronic
1196279879 X:113811835-113811857 CCTCAGCCTCTCCCAGTAGCTGG - Intergenic
1196388525 X:115186108-115186130 CCTCGGCCTCTCAAAAGTGCTGG - Intronic
1198094152 X:133361961-133361983 CCTCAGACTCCCCAAAGTGCTGG - Intronic
1198162795 X:134024178-134024200 CCACATCCTCTGCTAAGTACTGG - Intergenic
1198215224 X:134549442-134549464 CCTCGCCGTCTCCCAAGTCCCGG - Intergenic
1198630651 X:138634325-138634347 CCTCGGCCTCCCCAAAGTGCTGG + Intronic
1198922797 X:141749619-141749641 CCTCAGCCTCACCAAAGTACTGG - Intergenic
1198975602 X:142332708-142332730 TCTCAGCCTGTCTCACGTACTGG - Intergenic
1199816445 X:151401988-151402010 CCTCAGCCTTCCCAAAGTGCTGG + Intronic
1200160257 X:154003808-154003830 CCTCAGCCCCCCCAAAGTACTGG - Intergenic
1200359300 X:155585972-155585994 CCTCGGCCTCCCCAAAGTGCTGG - Intronic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic
1200578774 Y:4923600-4923622 CTTCTGCCTCTCTCATGTACTGG - Intergenic
1200770342 Y:7119256-7119278 CCTCAGCCTCCCCAAAGTGCTGG - Intergenic
1201277765 Y:12314628-12314650 CCTCACCCTCTAACAAGTCCAGG - Intergenic
1201357654 Y:13113935-13113957 CCTCACCCTCTAACAAGTCCAGG - Intergenic
1201619497 Y:15940280-15940302 CCTCAGCCTCCCAAAAGTGCTGG - Intergenic
1201800884 Y:17954034-17954056 CCTCAGCCCCCCCAAAGTGCTGG + Intergenic