ID: 906025184

View in Genome Browser
Species Human (GRCh38)
Location 1:42667379-42667401
Sequence CGAGATCACCACAGGTAGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906025184_906025189 17 Left 906025184 1:42667379-42667401 CCAAGCTACCTGTGGTGATCTCG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 906025189 1:42667419-42667441 GTCCAGACAAAGACTGAATCAGG 0: 1
1: 0
2: 2
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906025184 Original CRISPR CGAGATCACCACAGGTAGCT TGG (reversed) Exonic
903656421 1:24951298-24951320 AGAGAGCACCCCAGGGAGCTGGG - Intronic
904884614 1:33726668-33726690 GGTGACCACCACAGGGAGCTGGG + Exonic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906025184 1:42667379-42667401 CGAGATCACCACAGGTAGCTTGG - Exonic
911732492 1:101305607-101305629 AGAGATCACCACTGGGAGCTTGG + Intergenic
917170552 1:172168508-172168530 CCAGATTACCACAGGGTGCTTGG + Intronic
917581631 1:176384438-176384460 CCTCATCCCCACAGGTAGCTGGG + Intergenic
917750751 1:178051231-178051253 CCGGATCACAACAGGAAGCTGGG - Intergenic
923270968 1:232354693-232354715 CGAGAACCCCTCAGGTGGCTGGG + Intergenic
1063119030 10:3091652-3091674 TAAGAACACAACAGGTAGCTGGG + Intronic
1087199123 11:95327988-95328010 AGAGATCTCTACAGGTACCTTGG + Intergenic
1093474148 12:19536099-19536121 AGAGATCAACACACGAAGCTTGG + Intronic
1103342025 12:120225861-120225883 GGAGATCAGGACAGGCAGCTGGG - Intronic
1117572848 14:57065626-57065648 CTAGCTCAACACAGATAGCTGGG + Intergenic
1121344588 14:93126164-93126186 AGAGGGCACCAGAGGTAGCTGGG - Intergenic
1122316790 14:100830196-100830218 CAAGACCACCCCAGGCAGCTGGG - Intergenic
1130605526 15:85313113-85313135 AGGGAGCACCACAGGGAGCTGGG - Intergenic
1139373811 16:66484517-66484539 GGAGAACACCCCAGGTACCTGGG + Intronic
1143604965 17:7978158-7978180 AGAGATCTTCCCAGGTAGCTGGG - Intergenic
1143772468 17:9177446-9177468 GGAGGTCACCAAAGGTTGCTCGG - Intronic
1150244608 17:63665005-63665027 CAAAATCTCCACAGGCAGCTGGG + Intronic
1162537654 19:11272984-11273006 CCAAAACACAACAGGTAGCTGGG + Intergenic
925878448 2:8331402-8331424 GGTGATCCCCATAGGTAGCTTGG - Intergenic
931669520 2:64634575-64634597 CGTGATCACCACAGTGAGCTTGG - Exonic
948260827 2:236603454-236603476 AGGGAGCACCTCAGGTAGCTGGG - Intergenic
1177352891 21:19967862-19967884 CCAGCCCACCACCGGTAGCTAGG + Intergenic
964177565 3:153842952-153842974 CAAAATTACCACAGGTATCTTGG + Intergenic
965759702 3:172062520-172062542 GGAGGTCAAGACAGGTAGCTTGG - Intronic
975795266 4:78000364-78000386 CCAGACCACCACAGGTTCCTGGG - Intergenic
984385724 4:179054889-179054911 GGAGATCACAACTGATAGCTGGG + Intergenic
991470091 5:66958794-66958816 CGAGAGCATCACAGGGAGGTGGG + Intronic
992877386 5:81070202-81070224 CGGGCTCACCACTGGCAGCTGGG + Intronic
1010658785 6:78544468-78544490 CTGGAGCATCACAGGTAGCTGGG + Intergenic
1013480585 6:110549607-110549629 CGGGGTCACCACAGGGAGCCTGG + Intergenic
1015916409 6:138222023-138222045 AGAGGTCACAACAAGTAGCTGGG - Intronic
1016751688 6:147637152-147637174 CCAGATCACTCCAGGTAGCAGGG + Intronic
1032428075 7:131837876-131837898 CAAGATCTCTTCAGGTAGCTTGG + Intergenic
1033900765 7:146136241-146136263 AGAAATCACCACATGTAGCATGG + Intronic
1045704019 8:104899282-104899304 CAATATCACCACAGGTATCGGGG - Intronic
1046575607 8:116024948-116024970 CCAGATCATGACAGGAAGCTTGG + Intergenic
1047244884 8:123133031-123133053 CAACATCAGAACAGGTAGCTGGG - Intronic
1048198230 8:132350448-132350470 GGTGATTACAACAGGTAGCTTGG - Intronic
1052937338 9:34103737-34103759 AGAGATCCCCTCAAGTAGCTGGG - Intronic
1186361914 X:8851188-8851210 CTAGATCAGCTCAGGTAGCAAGG + Intergenic
1188470054 X:30528405-30528427 CCAGATAACCAAAGGTAGATGGG - Intergenic
1196256302 X:113522954-113522976 TGAGATCACCATATGTACCTTGG - Intergenic
1196394578 X:115245462-115245484 CGAGATCAGCACGGGTAACGTGG - Intergenic