ID: 906026430 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:42678054-42678076 |
Sequence | GTTGCAAATGTCTGTACTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906026430_906026432 | 4 | Left | 906026430 | 1:42678054-42678076 | CCTACAGTACAGACATTTGCAAC | No data | ||
Right | 906026432 | 1:42678081-42678103 | GCCAAGGAAACATACTTCAGAGG | No data | ||||
906026430_906026434 | 20 | Left | 906026430 | 1:42678054-42678076 | CCTACAGTACAGACATTTGCAAC | No data | ||
Right | 906026434 | 1:42678097-42678119 | TCAGAGGACATTGTAGAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906026430 | Original CRISPR | GTTGCAAATGTCTGTACTGT AGG (reversed) | Intergenic | ||