ID: 906026430

View in Genome Browser
Species Human (GRCh38)
Location 1:42678054-42678076
Sequence GTTGCAAATGTCTGTACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906026430_906026432 4 Left 906026430 1:42678054-42678076 CCTACAGTACAGACATTTGCAAC No data
Right 906026432 1:42678081-42678103 GCCAAGGAAACATACTTCAGAGG No data
906026430_906026434 20 Left 906026430 1:42678054-42678076 CCTACAGTACAGACATTTGCAAC No data
Right 906026434 1:42678097-42678119 TCAGAGGACATTGTAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906026430 Original CRISPR GTTGCAAATGTCTGTACTGT AGG (reversed) Intergenic