ID: 906026432

View in Genome Browser
Species Human (GRCh38)
Location 1:42678081-42678103
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906026430_906026432 4 Left 906026430 1:42678054-42678076 CCTACAGTACAGACATTTGCAAC No data
Right 906026432 1:42678081-42678103 GCCAAGGAAACATACTTCAGAGG No data
906026429_906026432 5 Left 906026429 1:42678053-42678075 CCCTACAGTACAGACATTTGCAA No data
Right 906026432 1:42678081-42678103 GCCAAGGAAACATACTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type