ID: 906026434

View in Genome Browser
Species Human (GRCh38)
Location 1:42678097-42678119
Sequence TCAGAGGACATTGTAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906026433_906026434 -8 Left 906026433 1:42678082-42678104 CCAAGGAAACATACTTCAGAGGA No data
Right 906026434 1:42678097-42678119 TCAGAGGACATTGTAGAGAAAGG No data
906026430_906026434 20 Left 906026430 1:42678054-42678076 CCTACAGTACAGACATTTGCAAC No data
Right 906026434 1:42678097-42678119 TCAGAGGACATTGTAGAGAAAGG No data
906026429_906026434 21 Left 906026429 1:42678053-42678075 CCCTACAGTACAGACATTTGCAA No data
Right 906026434 1:42678097-42678119 TCAGAGGACATTGTAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906026434 Original CRISPR TCAGAGGACATTGTAGAGAA AGG Intergenic