ID: 906027052

View in Genome Browser
Species Human (GRCh38)
Location 1:42682679-42682701
Sequence CCGCCGATGTGAGGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 3, 1: 0, 2: 1, 3: 6, 4: 59}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906027052_906027069 29 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027069 1:42682731-42682753 GGTGAGGACCGGACAGGGACGGG 0: 1
1: 0
2: 2
3: 15
4: 318
906027052_906027065 18 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027065 1:42682720-42682742 AGAAGGTCATCGGTGAGGACCGG 0: 1
1: 0
2: 0
3: 13
4: 161
906027052_906027068 28 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027068 1:42682730-42682752 CGGTGAGGACCGGACAGGGACGG 0: 1
1: 0
2: 1
3: 16
4: 200
906027052_906027063 8 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027063 1:42682710-42682732 GGCGGGGACAAGAAGGTCATCGG 0: 1
1: 0
2: 0
3: 12
4: 126
906027052_906027059 -8 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027059 1:42682694-42682716 ATCGGCGGCGCCTGCCGGCGGGG 0: 2
1: 1
2: 2
3: 4
4: 96
906027052_906027067 24 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027067 1:42682726-42682748 TCATCGGTGAGGACCGGACAGGG 0: 1
1: 0
2: 1
3: 2
4: 49
906027052_906027058 -9 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027058 1:42682693-42682715 CATCGGCGGCGCCTGCCGGCGGG 0: 3
1: 0
2: 1
3: 7
4: 109
906027052_906027070 30 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027070 1:42682732-42682754 GTGAGGACCGGACAGGGACGGGG 0: 1
1: 0
2: 1
3: 14
4: 202
906027052_906027057 -10 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027057 1:42682692-42682714 ACATCGGCGGCGCCTGCCGGCGG 0: 3
1: 0
2: 1
3: 7
4: 66
906027052_906027064 13 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027064 1:42682715-42682737 GGACAAGAAGGTCATCGGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 110
906027052_906027066 23 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027066 1:42682725-42682747 GTCATCGGTGAGGACCGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 48
906027052_906027060 1 Left 906027052 1:42682679-42682701 CCCGGGCGGCCTCACATCGGCGG 0: 3
1: 0
2: 1
3: 6
4: 59
Right 906027060 1:42682703-42682725 GCCTGCCGGCGGGGACAAGAAGG 0: 2
1: 1
2: 3
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906027052 Original CRISPR CCGCCGATGTGAGGCCGCCC GGG (reversed) Exonic
900191559 1:1354339-1354361 CCGCGGAGGTGAGGCTGCCCCGG - Exonic
902072035 1:13748824-13748846 CCGCCAACGGGAGGCCGCCCGGG - Intronic
903141653 1:21342846-21342868 CGGCTGATGTCAGGCCTCCCTGG - Intronic
904896118 1:33819698-33819720 CTGCCGAGGTGAGGGTGCCCTGG - Exonic
906027052 1:42682679-42682701 CCGCCGATGTGAGGCCGCCCGGG - Exonic
922527736 1:226318656-226318678 CCATGGATGTGAGGCCGCCGAGG + Intergenic
1083856795 11:65396946-65396968 CGGCGGGTGCGAGGCCGCCCTGG + Exonic
1084090331 11:66875443-66875465 CCGCCCCTGTGATGCTGCCCAGG - Intronic
1086959806 11:92970127-92970149 CCTCCGAAGTGCGGCTGCCCAGG + Intronic
1101696187 12:107129608-107129630 CTGCCAATGTGAGGTCGGCCTGG - Intergenic
1105004310 12:132711306-132711328 CCGCCCCTGCGAGTCCGCCCTGG + Intronic
1114073413 14:19132793-19132815 CCGCCGCTGAGAGGCGGCCTGGG - Intergenic
1114088853 14:19267190-19267212 CCGCCGCTGAGAGGCGGCCTGGG + Intergenic
1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1122051888 14:99066404-99066426 CACCCGGGGTGAGGCCGCCCAGG - Intergenic
1122355807 14:101122268-101122290 CCCCCGATGTGTGGCCTCCTGGG + Intergenic
1124159419 15:27255102-27255124 CAGCCGCTGTCAGGCAGCCCTGG - Intronic
1125759151 15:42085193-42085215 CCGCCCATGTGGGGTCTCCCTGG + Intronic
1127855874 15:62953274-62953296 CCGTCGGTGTGAGGCCGCCCAGG - Intergenic
1132642964 16:986201-986223 CGGCTTATGGGAGGCCGCCCTGG + Exonic
1133284168 16:4682939-4682961 CCCCTGAGGTGAGGCCCCCCCGG + Exonic
1134043945 16:11087918-11087940 CCCCCGCTGTGCAGCCGCCCTGG + Intronic
1137617396 16:49855932-49855954 CCCCCCAAGGGAGGCCGCCCCGG - Intronic
1138316923 16:56078243-56078265 CCTGCGATGTGAGGATGCCCTGG - Intergenic
1139459456 16:67110136-67110158 CTGCCGCAGGGAGGCCGCCCGGG + Exonic
1142111697 16:88335415-88335437 CTGCAGAAGTAAGGCCGCCCTGG - Intergenic
1142123216 16:88397211-88397233 CCGCCAATGAGAGGCTTCCCTGG - Intergenic
1144687925 17:17238295-17238317 CCCCTGAGGTGTGGCCGCCCCGG + Intergenic
1152716259 17:81902202-81902224 CCGCAGATATAAGGCGGCCCAGG + Exonic
1160453398 18:78979950-78979972 CCCGCGATGTGAGGCGGCGCCGG + Intergenic
1160698534 19:495817-495839 CCGCCCCTGTGCGGCCGCCCGGG + Intronic
1161232141 19:3179674-3179696 CCGCCGAGTTGAGGACGGCCAGG - Exonic
1162412469 19:10514768-10514790 CCGACAACGTGAGGCTGCCCAGG + Exonic
1164010138 19:21194884-21194906 CCGCCTTTGTGAGGCCCCCAGGG - Exonic
1165448314 19:35868776-35868798 CGGCCGAGGTGAGGCCGGGCCGG + Exonic
1166292509 19:41872105-41872127 CAGCCCGTGTGTGGCCGCCCTGG - Exonic
1166702741 19:44891527-44891549 CCGCCGCTGGGAGGCAGCCTGGG + Exonic
1167098843 19:47391658-47391680 CCGCGGAAGGGAGGCCGGCCTGG - Intergenic
928174433 2:29024345-29024367 CCGCCGAGGTGAGGACCACCAGG - Exonic
938487336 2:131724146-131724168 CCGCCGCTGGGAGGCGGCCTGGG - Intronic
946284770 2:218694628-218694650 CTGCAGAGGTGAGGCCCCCCAGG + Exonic
1180064333 21:45405127-45405149 CCGCCGCTGGGAGGCCGGGCAGG - Intronic
1180491855 22:15855146-15855168 CCGCCGCTGAGAGGCGGCCTGGG - Intergenic
1182297082 22:29315983-29316005 CCCCCGGAGTCAGGCCGCCCGGG + Intronic
1184872826 22:47251757-47251779 CTGCTGCTGTGAGGCCTCCCAGG + Intergenic
1185156437 22:49196009-49196031 CCCCCGATGTGAGGTCACACAGG + Intergenic
955687626 3:61562384-61562406 CCGCCGAGGGGATGCGGCCCCGG + Intronic
961486905 3:127223012-127223034 CTGCCGATGTGAGCGAGCCCAGG + Intergenic
967809450 3:193744657-193744679 CCGTCGCTGTGAGGCTGGCCCGG + Intergenic
968121763 3:196130861-196130883 CCGGCGATGTGAGGCCTTCCTGG - Intergenic
968511433 4:997510-997532 CCGCGGCTGAGCGGCCGCCCGGG - Intronic
968514085 4:1009268-1009290 CCGCCTCTGTGAGGCCTGCCCGG + Intergenic
969308218 4:6337505-6337527 CAGCCTGTGAGAGGCCGCCCTGG - Intronic
985694953 5:1335014-1335036 GCGCCTGGGTGAGGCCGCCCTGG - Intronic
988683015 5:33502183-33502205 CCGCCGCTGGGAGGCGGCCTGGG + Intergenic
1002853467 6:1017142-1017164 CAGCCGATGTGAGGTGGCCCAGG + Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1012703850 6:102496583-102496605 CCGCCAACATGAGGCTGCCCTGG + Intergenic
1022400113 7:30028600-30028622 CCGAGGATGTGAGGCGGGCCGGG + Exonic
1026166409 7:67913854-67913876 CCTCCAATGTGAGGAAGCCCAGG - Intergenic
1032198770 7:129804863-129804885 GCGCAGATGTGAGGCCTTCCTGG + Intergenic
1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1057007523 9:91573682-91573704 CTGCCACTGTGAGGCCTCCCCGG + Intronic
1058912538 9:109534194-109534216 CTGCTGATGTGAAGCCTCCCGGG + Intergenic
1059208428 9:112487308-112487330 CTGCCGACGAGCGGCCGCCCGGG - Intronic
1061886022 9:133591497-133591519 CAGCCAATGTGAGCCCTCCCTGG + Intergenic
1187468774 X:19549859-19549881 CAGCCGATTTGAGGACACCCTGG - Intronic
1191846558 X:65551542-65551564 CGGCGGGTGTGAGGCCGCCCTGG - Intergenic
1192181801 X:68920806-68920828 CCGCGGGTGTCAGGCCACCCAGG + Intergenic