ID: 906032199

View in Genome Browser
Species Human (GRCh38)
Location 1:42730601-42730623
Sequence GCTGCTCGGAAGTCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11342
Summary {0: 1, 1: 0, 2: 9, 3: 416, 4: 10916}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906032199_906032203 8 Left 906032199 1:42730601-42730623 CCTGCTTGAGACTTCCGAGCAGC 0: 1
1: 0
2: 9
3: 416
4: 10916
Right 906032203 1:42730632-42730654 CAGCCACCCGCCAACACGCCTGG 0: 1
1: 74
2: 4277
3: 26047
4: 65057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906032199 Original CRISPR GCTGCTCGGAAGTCTCAAGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr