ID: 906032453

View in Genome Browser
Species Human (GRCh38)
Location 1:42732528-42732550
Sequence GGTGCCAGTGGAGCAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906032453_906032461 -2 Left 906032453 1:42732528-42732550 CCCACCCCTGCTCCACTGGCACC 0: 1
1: 0
2: 7
3: 66
4: 596
Right 906032461 1:42732549-42732571 CCATATAACAGGATTCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 47
906032453_906032463 16 Left 906032453 1:42732528-42732550 CCCACCCCTGCTCCACTGGCACC 0: 1
1: 0
2: 7
3: 66
4: 596
Right 906032463 1:42732567-42732589 CAAGGCTGTGCTGAGTTTCCAGG 0: 1
1: 1
2: 7
3: 39
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906032453 Original CRISPR GGTGCCAGTGGAGCAGGGGT GGG (reversed) Intergenic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900119063 1:1040957-1040979 GGGGCCAGTGGGGCGGGGGCAGG + Intronic
900130591 1:1085557-1085579 GGGGCGAGTGGAGCGGGGCTGGG - Intronic
900156065 1:1203734-1203756 GCTGCCAGGGGAGCAGGGCCCGG + Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900240667 1:1615881-1615903 GGGGCCAGCGGCGCTGGGGTCGG + Intronic
900271968 1:1795245-1795267 GAAGCCAGTGGAGGAGGGCTCGG - Intronic
900428757 1:2592358-2592380 GGTGCCAGCACAGCAGGGGAGGG - Intronic
900428773 1:2592404-2592426 GGCGCCAGTGCATCAGGGGAGGG - Intronic
900428831 1:2592565-2592587 GGTGCCAGTGCATCAGGGGAGGG - Intronic
900464822 1:2820591-2820613 GGGGCCAGGGGTCCAGGGGTCGG + Intergenic
900812894 1:4821438-4821460 AGGGCCAGTGGAGCAGGAATTGG + Intergenic
900958084 1:5900533-5900555 AGTGCCAGGGGAGGAGGGGAGGG + Intronic
901093447 1:6659418-6659440 GGTGCCACTGGAGGAAGGATGGG - Intronic
901681694 1:10916506-10916528 GGTGACAGAGGAGCAGGGTGGGG - Intergenic
901758026 1:11453256-11453278 GGCGACGGTGGAGCAGGGGCAGG - Intergenic
901761804 1:11476835-11476857 GGTGGCAGTGGAGCTGGTGCAGG - Intergenic
902406658 1:16187812-16187834 TGTGTCTGTGGGGCAGGGGTAGG - Intergenic
902715991 1:18273007-18273029 GCTGCTAGTGGAGAAGGGATTGG - Intronic
903021612 1:20399212-20399234 GGTGGCAGTGGCGCAGGGAATGG + Intergenic
903362024 1:22782907-22782929 TGTGCGTGTGGAGCAGGGGCTGG - Intronic
903651185 1:24923295-24923317 GGAGCCTGGGGAGCAGGGGTGGG + Intronic
903873021 1:26450620-26450642 GGTGCAAGTTGGGAAGGGGTAGG + Intronic
904288043 1:29466074-29466096 GGTGGCAGTGGGGTTGGGGTGGG + Intergenic
904835162 1:33331084-33331106 GGTGCCAGTGGAGCCCAGGAGGG + Intronic
905013328 1:34761365-34761387 GGTGGCAGCGGAGGAGGTGTGGG + Exonic
905174710 1:36128121-36128143 GGGGCAGGTGGGGCAGGGGTTGG - Intergenic
905365604 1:37449649-37449671 GGAGACAGTGGAGCAGAAGTGGG + Intergenic
905665416 1:39760634-39760656 GGAGCAGGTGGAGCTGGGGTGGG - Intronic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
906114731 1:43349063-43349085 GGTGCGAGTGGGGCGGGGCTCGG + Intronic
906315330 1:44783365-44783387 GGTGGCAGTGGAGAAGAGCTTGG + Intergenic
907301688 1:53490818-53490840 CGGGCCAGTGGAGCAGGGTTGGG - Intergenic
907371106 1:54004256-54004278 GGGTGCCGTGGAGCAGGGGTTGG + Intergenic
907850832 1:58253305-58253327 GTTGCCAGTGGTGGTGGGGTTGG - Intronic
908724761 1:67163683-67163705 GGAGCAAGAGGAGCAGGGGGAGG - Intronic
909012766 1:70353805-70353827 CGTGCCAGTGGTCAAGGGGTTGG - Intronic
910371739 1:86523846-86523868 GGGGGCTGTGGAGCAGGGGGCGG + Intergenic
910865990 1:91788379-91788401 CATTCCAGTGGAGCAGGGGAAGG + Intronic
912693132 1:111819616-111819638 GGCGGAAGAGGAGCAGGGGTTGG + Intronic
913329186 1:117653173-117653195 GGAGCCAGGGGAGGAGCGGTTGG + Intergenic
914829338 1:151159320-151159342 AGTGCCAGGTGAGCAGGGTTAGG - Exonic
914984162 1:152441997-152442019 GCTGCCAGTGGGGAATGGGTAGG + Intergenic
915063399 1:153205022-153205044 GGTGGCAGTGGTGGTGGGGTTGG - Exonic
915121579 1:153632783-153632805 CGTGCCAGTGGAGCAGAGGAAGG + Intronic
915519135 1:156431057-156431079 GGTGCCAGTGGAATGGGGGGGGG + Intergenic
915596605 1:156899986-156900008 GGCTCTAGGGGAGCAGGGGTGGG - Intronic
915841061 1:159213330-159213352 GGTGCAAGGGGGTCAGGGGTGGG + Intergenic
916534496 1:165690791-165690813 GGTGGCAGTGAAGCTGGGGGAGG + Intronic
917225857 1:172781649-172781671 TGTACCAGTCAAGCAGGGGTTGG - Intergenic
918056772 1:181028359-181028381 GGTGACAGTGGTGGAGGTGTTGG - Intergenic
918186033 1:182128625-182128647 TGTGCCAGTGGAACCAGGGTTGG + Intergenic
918199724 1:182255764-182255786 GGTGCCAGTGTAACAGTGGTGGG + Intergenic
918646561 1:186912473-186912495 AGTATCAGTGGTGCAGGGGTAGG - Intronic
918730992 1:187996061-187996083 GGTGCCAGAGAAGCAGAGGAAGG + Intergenic
919297740 1:195722998-195723020 GGAGCCCGTGGAGCAGGGGGAGG + Intergenic
919746437 1:201011898-201011920 GGAGACAGTGGAGCAGGGGAGGG + Intronic
919970033 1:202569929-202569951 GGAGGCAGTGGGGCAGGGGGAGG + Intronic
920377960 1:205519406-205519428 GGTGACAGGGGAGCAGGCGGTGG - Intronic
920766651 1:208840053-208840075 GGTGCAACTGGAGAAGGGCTGGG + Intergenic
920883100 1:209898833-209898855 GGGCACCGTGGAGCAGGGGTTGG + Intergenic
922096524 1:222447688-222447710 GGTGACCCTGGAGCAGGGATGGG - Intergenic
922193394 1:223339443-223339465 TGAGCCAGCGGGGCAGGGGTGGG + Intronic
922679379 1:227579301-227579323 GGTGCTAGTGGTGCAGGTCTGGG + Intronic
922740433 1:228011249-228011271 GGGGCCAGTCGAGCAGGGCAGGG + Intronic
923026452 1:230208397-230208419 GCTGTGAGTGGAGCAGGTGTAGG + Intronic
923172557 1:231430850-231430872 GGCGCCCTTGGAGCAGGGGGTGG + Intergenic
1063034231 10:2269344-2269366 GGTGTGAGTGGACCAGAGGTGGG + Intergenic
1063699864 10:8373732-8373754 GTTGCCAGGGGCTCAGGGGTAGG - Intergenic
1065056967 10:21855775-21855797 GGTGGCGGTGGGGTAGGGGTGGG - Intronic
1065179177 10:23107744-23107766 GGTGCTAGTGTTGCAGAGGTGGG - Intronic
1066350510 10:34632571-34632593 GATGCCAGAGGAGCTGGTGTTGG - Intronic
1066377052 10:34867073-34867095 GCTGCCAGGGGATCAGTGGTAGG + Intergenic
1067307317 10:45076407-45076429 AGTGACAGTGGAGTAGGGGTTGG + Intergenic
1067343110 10:45419843-45419865 GGTGCCTGTGGAGGAAGGGAGGG + Intronic
1067426533 10:46215462-46215484 GGTGCCACAGGAGCAGGCGGGGG - Intergenic
1067437477 10:46288275-46288297 GGTGCCAGGAGTGCAGGGGAAGG - Intronic
1068149267 10:53111672-53111694 GGTGGCAGTGAGGCAGGGGGAGG + Intergenic
1068679408 10:59803584-59803606 GTGGCCAGTGGAGTAGGGGGAGG - Intronic
1068684712 10:59858118-59858140 AGTGCCGGTGCAGCAGGGGTAGG + Intronic
1068919325 10:62465933-62465955 GGTGCAAGTGAAGCATGGGAGGG - Intronic
1069325197 10:67224774-67224796 GCAGCCAGAGAAGCAGGGGTTGG + Intronic
1070813547 10:79310294-79310316 GCTGTCAGAGGAGCAGGGCTGGG - Intronic
1070831381 10:79420069-79420091 GCTGGGGGTGGAGCAGGGGTGGG - Intronic
1071431631 10:85611481-85611503 TGTGTCAGCGGAGCAGGGGAGGG - Intronic
1071666576 10:87564315-87564337 GGTGCCAGTGGTGGTGGGCTGGG - Intergenic
1071974338 10:90939994-90940016 GGCCCCTGTGGAGCAGAGGTGGG + Intergenic
1072232521 10:93425465-93425487 GGTGCCAGTCTAGGTGGGGTTGG - Intronic
1072793766 10:98338448-98338470 TGGGTCAGTGGAGCTGGGGTTGG - Intergenic
1073190423 10:101646910-101646932 AGTCCCAGTGGAGCCGGAGTTGG + Intronic
1073513467 10:104057121-104057143 GGTGGCAGTGGAGGAGGTGGCGG - Exonic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1074423194 10:113327645-113327667 GCAGCCAGTGGAGCAAGGGTGGG - Intergenic
1075305745 10:121365812-121365834 GGAGCCAAAGGAGCAGGGGGTGG - Intergenic
1075504953 10:123013535-123013557 GGGTGCAGTGGAGCAGGGGGTGG + Intronic
1075774094 10:124968428-124968450 GATTCCAGTGAAGCCGGGGTGGG + Intronic
1076037794 10:127215288-127215310 GAGGCCAGTGGACCAGGGGAAGG - Intronic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076329658 10:129654989-129655011 AGTGCCTGTGGAGCAGCAGTGGG + Intronic
1076434029 10:130427345-130427367 GGTGCCTTTGGAGCAGGTGGAGG + Intergenic
1077104599 11:836672-836694 GGAGCCTGGGGAGCCGGGGTGGG + Intronic
1077435120 11:2535240-2535262 GGTGAAAGTGGACCAGGGGCAGG + Intronic
1078089646 11:8256878-8256900 GATGCCAGGGTAGCAGAGGTTGG + Intronic
1078145988 11:8722176-8722198 GATGCCTGAGGAGCTGGGGTGGG - Intronic
1078468121 11:11565364-11565386 GGTGGCAGAGGAGCAGTGGTGGG + Intronic
1079077125 11:17390891-17390913 GGTGGCTTTGGAGCAGTGGTAGG + Intergenic
1079079256 11:17402616-17402638 GGTAGGAGTGGAACAGGGGTGGG - Intronic
1079156697 11:17954665-17954687 AGTGCCATTGGAGCAGGAGCAGG - Intronic
1079333388 11:19551486-19551508 GGTGCAAGTGGATCAGGGACAGG - Intronic
1079418752 11:20265979-20266001 GCTGCCAGTAGATAAGGGGTGGG - Intergenic
1080646271 11:34190248-34190270 GGGGGCAGCGGGGCAGGGGTGGG - Intronic
1081428436 11:42950213-42950235 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1081786360 11:45750558-45750580 GGTGCCAGGGGAGCAGAGCGTGG + Intergenic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1081850838 11:46274183-46274205 AGGGCCTGGGGAGCAGGGGTAGG - Intergenic
1083262761 11:61532088-61532110 GGTGCCAGGGCAGTAGGGGAGGG + Intronic
1083619041 11:64039947-64039969 CGTGCCAGAGGAGCACTGGTGGG - Intronic
1083721612 11:64606450-64606472 GCTGCTGGAGGAGCAGGGGTGGG - Exonic
1083888349 11:65583682-65583704 GTGGCCAGTGGGGCAGGGGCTGG + Exonic
1084044378 11:66560315-66560337 GGTGCCAGGGTTGCAGGGGATGG + Intronic
1084191369 11:67500451-67500473 GGTGGCAGGGAAGCAGGGGGAGG - Intronic
1084831774 11:71775022-71775044 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1085034611 11:73292588-73292610 GGGGGCAGAGGAGGAGGGGTAGG - Intronic
1085452497 11:76643443-76643465 GGGGCCTGTGGAGGAGGGGTAGG - Intergenic
1087762061 11:102111477-102111499 GGCGGGAGTGGAGGAGGGGTGGG + Intronic
1088481667 11:110300970-110300992 GGTGCCGGTGGAGCAGGGGGCGG + Intergenic
1089217197 11:116841588-116841610 GGTGCCTTTGGACCAGAGGTAGG - Intergenic
1089286493 11:117411103-117411125 GGTCCCAGTGGGGAAGGGCTGGG + Intronic
1089616822 11:119699508-119699530 GGGGCCAGAGTTGCAGGGGTGGG - Intronic
1089663842 11:120004051-120004073 GTTGCCAGCAGAGGAGGGGTTGG - Intergenic
1089812758 11:121145034-121145056 GGTGACATTGGAGCAGGGTCTGG + Intronic
1089969235 11:122679125-122679147 GGTGCCACTGGAGCTGAGGTTGG + Intronic
1090214859 11:124953098-124953120 GGAGCCACTGGAGCAAGGTTTGG - Intergenic
1091230471 11:133984774-133984796 GGTGCAAAGGGAGCAGGGGCCGG + Intergenic
1091259516 11:134223761-134223783 GGTGCCGGTGGGGGCGGGGTGGG - Intronic
1091317885 11:134628263-134628285 GGGCACAGTGGAGAAGGGGTGGG - Intergenic
1091584483 12:1808248-1808270 GCTGCCTCTGGAGCAGGGGCTGG + Intronic
1092002957 12:5046009-5046031 GGTGGCAGTGGAGTAGGGAATGG + Exonic
1092137481 12:6159801-6159823 GGTGCCAGTGGAGCAGCGGGCGG - Intergenic
1093583206 12:20807427-20807449 GGTGCTCCTGGAGCAGGGGGCGG + Intergenic
1093652601 12:21661855-21661877 GGGCGCAGTGGAGCAGGGGGCGG - Intronic
1093653860 12:21674040-21674062 GGGCGCAGTGGAGCAGGGGGCGG + Intronic
1095534013 12:43224607-43224629 GGGCGCAGTGGAGCAGGGGATGG - Intergenic
1095958735 12:47820518-47820540 GGTGCCAGTGGGGGAGGGCTGGG - Intronic
1096145819 12:49277819-49277841 GGGGGCTGTGGAGCAGGAGTGGG + Intergenic
1096622442 12:52873013-52873035 GGTGACAGTGGAGAAAGGATGGG + Intergenic
1096766565 12:53895664-53895686 GAGGCCAGAGGAGGAGGGGTAGG - Intergenic
1096782287 12:53998281-53998303 GGGGCCTATGGAGCTGGGGTCGG + Intronic
1096874106 12:54613998-54614020 GGTGGCGGTGGGGCGGGGGTTGG - Intergenic
1097017869 12:56000179-56000201 GGGTGCCGTGGAGCAGGGGTCGG + Intronic
1097035428 12:56120635-56120657 GAGGCCAGTGGGGCAGGGGTAGG + Exonic
1097080219 12:56424841-56424863 GGTGCCAGTGGAGGAGCAGCGGG - Exonic
1097195767 12:57241809-57241831 GGTGCTAGGGTACCAGGGGTGGG - Intergenic
1097664149 12:62461307-62461329 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1098916251 12:76259748-76259770 GGAGTCAGTGAAGCTGGGGTAGG + Intergenic
1099528142 12:83741113-83741135 GGTGCCACTGGAGTATGGGCGGG - Intergenic
1099653437 12:85458201-85458223 GTTGGCAGGGGAGGAGGGGTGGG - Intergenic
1099993517 12:89752474-89752496 GAAGCCAGTTGAGCAGGGGGAGG - Intergenic
1100579905 12:95929127-95929149 GGTGGCAGTGAGGCTGGGGTAGG - Intronic
1100734585 12:97512818-97512840 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1101341023 12:103841601-103841623 GGGGCCAGAGCAGCTGGGGTGGG - Exonic
1101735491 12:107459936-107459958 GCAGCCAGGGGGGCAGGGGTGGG + Intronic
1102619701 12:114184175-114184197 GGTGACTGTGGGGGAGGGGTAGG - Intergenic
1102986275 12:117280997-117281019 AGGGCCAATGGAGCAGCGGTCGG + Intronic
1103359504 12:120345579-120345601 GGTACCACTGAAGCAGGGGACGG - Exonic
1104380111 12:128299928-128299950 GGTGCCAGTGGAACCGGGGCAGG + Intronic
1104604190 12:130175978-130176000 TGAGCCAGTGGAGACGGGGTGGG - Intergenic
1104893456 12:132151081-132151103 GGGGACAGAGGAGCAGGGCTGGG - Intronic
1106885126 13:34176255-34176277 GGTGACAATGGAGCAGATGTTGG - Intergenic
1107436942 13:40388624-40388646 AGTGCGAGAGGAGCAGGGGCAGG + Intergenic
1107955394 13:45506379-45506401 GATGTCAGAGGAGGAGGGGTTGG + Intronic
1108121534 13:47193250-47193272 CTTGCCTGGGGAGCAGGGGTGGG - Intergenic
1108582929 13:51842177-51842199 GGGGCCACTGGGGCTGGGGTAGG + Intergenic
1108750167 13:53439975-53439997 GGTCGCAGCGGAGCAGGGGGTGG - Intergenic
1110024023 13:70511944-70511966 GGGTCCTGTGGAGCAGGGGGCGG + Intergenic
1110483358 13:76009692-76009714 GGTGGCAGTGGAGGAAGGGCAGG - Intergenic
1110792351 13:79600191-79600213 GGGCGCAGTGGAGCAGGGGATGG + Intergenic
1111747722 13:92291173-92291195 GGGCACAGTGGAGCAGGGGGTGG - Intronic
1112268235 13:97945596-97945618 AGGGCCAGTGGAGCTGGGGGTGG - Intergenic
1112833792 13:103488110-103488132 CGGCCCAGAGGAGCAGGGGTAGG - Intergenic
1113634974 13:111913227-111913249 GGTGCCACTGCGGCAGGGCTGGG - Intergenic
1113879262 13:113614556-113614578 GGTGAGAGTGGATCAGGGGAAGG + Intronic
1113947327 13:114051547-114051569 GGTGTGTTTGGAGCAGGGGTGGG - Intronic
1113968319 13:114167304-114167326 GGTGTCAGTGGAGAAGGGGCCGG + Intergenic
1114031301 14:18583306-18583328 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1114416199 14:22546242-22546264 TGGAGCAGTGGAGCAGGGGTGGG - Intergenic
1114560260 14:23584914-23584936 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
1116826320 14:49676828-49676850 GATGCCAGTTCAGCAAGGGTGGG - Intronic
1118606441 14:67507411-67507433 AGTGGCAGAGGAGCAGGGATAGG + Intronic
1118636529 14:67753255-67753277 TGTGGCACTGGAGCAGGGGCTGG - Intronic
1118925870 14:70189214-70189236 GGTGGCCGCGGGGCAGGGGTTGG - Intergenic
1119745339 14:77039960-77039982 AGTACCAGGGGAGGAGGGGTGGG - Intergenic
1119960379 14:78848932-78848954 GGGGCCACGGGAGCAGGAGTGGG + Intronic
1120034240 14:79678140-79678162 GGGGCCAGTGGAGTAGGGGGAGG - Intronic
1120724619 14:87923834-87923856 GGTGACAGAGGAGGAGGAGTGGG + Intronic
1121075032 14:91060651-91060673 GGCGGCGGTGGAGCAGGGGGCGG - Intronic
1122289827 14:100674589-100674611 CGTCCCAGTGGAGAAGGAGTGGG + Intergenic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122639034 14:103146458-103146480 GGAGACAGGGCAGCAGGGGTAGG + Intergenic
1122652121 14:103231760-103231782 GGTGCCAGTGCAGGAGGGGTGGG + Intergenic
1122718385 14:103708447-103708469 GGTCCCAGTGGTGCAGGGCAGGG - Intronic
1122841434 14:104465812-104465834 AAAGGCAGTGGAGCAGGGGTGGG + Intergenic
1122888695 14:104722975-104722997 GGTGCCAAGAGAGGAGGGGTGGG + Intergenic
1122922710 14:104886566-104886588 GGCCCACGTGGAGCAGGGGTCGG + Exonic
1122937546 14:104967045-104967067 GCTGCCAGGGGAGCAGCTGTGGG - Intronic
1123040072 14:105486831-105486853 GGTGCCGGTGGGGTAGGGCTGGG + Intergenic
1123105013 14:105837220-105837242 GGAGACAGAGGAGCAGGGGAGGG + Intergenic
1202910734 14_GL000194v1_random:114778-114800 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1124216739 15:27813355-27813377 GGTGCCAGTGAAGAAGTGGATGG - Intronic
1124218845 15:27832211-27832233 GGGGCCAGTGGGGTAGGGTTTGG - Intronic
1124715241 15:32053894-32053916 GGTGGCAGTGGACGAGGAGTAGG + Intronic
1125062678 15:35442864-35442886 GGGAGCAGTGGGGCAGGGGTTGG + Intronic
1125112267 15:36047281-36047303 GGGGGCCGTGGAGCAGGGGGCGG - Intergenic
1125487025 15:40118616-40118638 GATGAAAGTGGAGGAGGGGTGGG - Intergenic
1126098626 15:45106513-45106535 AGTGCCAGGTGAGCAGGGGCTGG - Exonic
1127292413 15:57582195-57582217 GGTTGCAGTGAAGCAGGGTTTGG + Intergenic
1127766014 15:62186597-62186619 GGGCACCGTGGAGCAGGGGTGGG + Intergenic
1128115101 15:65100423-65100445 GGTGACAGATGAGCAGGGGTAGG + Intronic
1128257198 15:66205680-66205702 TGTGCCAGCTGAGCACGGGTAGG - Intronic
1128439349 15:67689916-67689938 GTGGCCCGTGGAGCATGGGTTGG - Intronic
1129235455 15:74221267-74221289 GGGGGCAGTGGAGCAGGGGCAGG + Intergenic
1129748711 15:78044101-78044123 GTTGACAGAGGAGAAGGGGTTGG + Intronic
1129986942 15:79926402-79926424 GGGCGCCGTGGAGCAGGGGTCGG - Intergenic
1130563935 15:84979470-84979492 AGAGCCAGGGGAGGAGGGGTGGG + Intergenic
1131102650 15:89705316-89705338 GATGCCGGTGGAGCCAGGGTAGG + Intronic
1131668016 15:94590774-94590796 GGTGCTTGTGGAGAAGTGGTGGG - Intergenic
1132098827 15:99008309-99008331 GGGTCCTGTGGAGCAGGGGGCGG + Intergenic
1132198714 15:99933050-99933072 GGACCCAGTGGTACAGGGGTGGG - Intergenic
1132594315 16:741209-741231 GGTGCAGGGGGCGCAGGGGTTGG + Intronic
1132639994 16:973549-973571 GGAGCCAGTGGTCCGGGGGTAGG + Intronic
1132888811 16:2194426-2194448 GGTGACTCTGGAGCAGGGGCTGG + Intronic
1133018540 16:2955824-2955846 GGGGCCCGTGGAGGAGGGGGTGG + Intergenic
1133028861 16:3000354-3000376 GGTGCCTGGGGAGCAGGGGTCGG + Intergenic
1133044022 16:3076180-3076202 GGGGGCAGTGGGGCAGGGGCAGG - Intronic
1133270226 16:4607769-4607791 GGTGCCTGGGTAGCAGGGGAGGG - Intergenic
1133310777 16:4845497-4845519 GGTCACATTGGAGCAGGGGTGGG - Intronic
1136005701 16:27327308-27327330 GGTGGCAGGGGGGCAGGGGGCGG - Intronic
1136180532 16:28548774-28548796 GGTGTCTGTGGCCCAGGGGTGGG - Intergenic
1136579980 16:31145553-31145575 GGTGGGGGTGGAGCAGGGGGAGG + Intronic
1136606581 16:31338302-31338324 GGTGCCAGTGAGGCTGGGGGAGG + Intergenic
1137368116 16:47878557-47878579 GGTGCCAGGGGAGGAGGGCTAGG - Intergenic
1137665237 16:50245940-50245962 GGTTCTAGGGGAGCTGGGGTGGG + Intergenic
1138105568 16:54285749-54285771 GGAGCCAGGGAAGGAGGGGTTGG - Intronic
1138429892 16:56962023-56962045 GGTGCCTTTGGAGCAGGCATGGG - Exonic
1138678896 16:58671186-58671208 GGTGCCAGTGGAGGAGGACGTGG - Exonic
1139186618 16:64813190-64813212 ATTGACAGTGGGGCAGGGGTTGG - Intergenic
1139357879 16:66378070-66378092 GCTGTCAGAAGAGCAGGGGTGGG - Intronic
1139472652 16:67186504-67186526 GCTGCCTGGGGAGCAGGGATAGG + Intronic
1139521030 16:67482891-67482913 GATGGCAGTGGAGCATGGGAAGG + Intronic
1141617955 16:85220941-85220963 GGGGCCACTGGAGGAGGGGGTGG - Intergenic
1141663509 16:85454011-85454033 GATGCCCGTGGGGCAGGGGGCGG - Intergenic
1141751032 16:85958022-85958044 GGAGGCTGTGTAGCAGGGGTGGG - Intergenic
1141772179 16:86096186-86096208 TGGGGCAGTGGAGCAGGGATGGG - Intergenic
1141874201 16:86810576-86810598 GATGCCAGTGGACCAGTGTTTGG - Intergenic
1141901487 16:86993969-86993991 CTTGCCCGTGGAGCAGTGGTGGG - Intergenic
1142229922 16:88895340-88895362 GGTGCCACTAGACCACGGGTCGG - Intronic
1142317957 16:89361062-89361084 GGTGCCATTGCAGCAGGGGCTGG - Intronic
1143514185 17:7411242-7411264 TTTGGCAGTGGAGCAGGGGCAGG + Intronic
1144779153 17:17799248-17799270 GGTGCCCATGGAGGAGGGGTCGG + Intronic
1144950938 17:18993042-18993064 GGTGCCTGGGGAGGAGGGGTGGG + Intronic
1145114938 17:20200528-20200550 AGGGCCAGTGGAACAGGGATTGG - Intronic
1145889701 17:28405935-28405957 GGTGCCATTGTAGCCGAGGTCGG + Exonic
1146228795 17:31090686-31090708 TGTGCCAGTGGAGATGGGGGTGG + Intergenic
1146625760 17:34434382-34434404 GCGGCCAGTGGAGCAAGGGATGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147166804 17:38597880-38597902 GCTGCCAGTGGACCAGGAGGGGG + Intronic
1147455362 17:40534647-40534669 GTTTCCAGCAGAGCAGGGGTAGG - Intergenic
1148751696 17:49948994-49949016 GGTGCCAGTGGGGCTGAGGAAGG + Intergenic
1148821608 17:50363365-50363387 CCTGCCAGAGCAGCAGGGGTGGG - Intergenic
1149397627 17:56261116-56261138 GGTGCCACTGGCTTAGGGGTGGG - Intronic
1149577248 17:57723126-57723148 GGTGCCATTGGAGAACGGTTGGG - Intergenic
1149592068 17:57837570-57837592 GGTGGCTGGGGAACAGGGGTGGG + Exonic
1149862473 17:60130418-60130440 GGTAGCAGTGGGGCGGGGGTGGG - Intergenic
1150249840 17:63699509-63699531 GGCCCCTGGGGAGCAGGGGTGGG - Intronic
1150484033 17:65531891-65531913 TGGGGCCGTGGAGCAGGGGTGGG - Intronic
1150632165 17:66887411-66887433 GGTGCCAGTGGAGAGGGAGGGGG - Intergenic
1150840462 17:68601318-68601340 GGTGCCAGCGGAGAGTGGGTGGG - Exonic
1151011018 17:70496033-70496055 GGTGCCAGAGGCTGAGGGGTGGG + Intergenic
1151476125 17:74345185-74345207 CGTTCCAGAGGAGCAGGGTTGGG + Intronic
1151782626 17:76257680-76257702 GGGGGCTGTGGAGCAGGGGGCGG + Intergenic
1152199235 17:78935486-78935508 GTTGCCTGGTGAGCAGGGGTTGG - Intergenic
1152267881 17:79306784-79306806 GGTGCCCGTGGAGCTGGGGGTGG - Intronic
1152549293 17:81021328-81021350 GGTGTCACTGGGGCAGGAGTGGG + Intergenic
1152785339 17:82245056-82245078 GGTGCCCGCGGAGCCGGGCTCGG + Intronic
1152855678 17:82663667-82663689 GGTGCCAGCGGGGCTGTGGTCGG - Intronic
1152863524 17:82709382-82709404 GGGGCAGGTGGAGCAGGGGGTGG - Intergenic
1154107224 18:11533582-11533604 CGTGCCACTGGAGCAGGAGCAGG - Intergenic
1154361691 18:13668244-13668266 GGTTCCAGTGGTTCAGGGGCTGG - Intronic
1155715119 18:28932802-28932824 GTTGGCAGTGGGGGAGGGGTTGG + Intergenic
1156229613 18:35140672-35140694 GGTGGCAGTGGTGTTGGGGTGGG - Exonic
1156591232 18:38490952-38490974 GGTGCTGGTGGAACAGGGGCAGG - Intergenic
1157136553 18:45062483-45062505 TGTGTCAGTGGAGAAGGGTTAGG + Intronic
1157402170 18:47397742-47397764 GTTGCCCGGGGAGCAGGGTTGGG - Intergenic
1157416983 18:47511852-47511874 GGTGTCCTTGGAGCAGGGCTGGG + Intergenic
1157439093 18:47696683-47696705 AGTTCTAGTGGAGCAGAGGTTGG - Intergenic
1157513932 18:48297602-48297624 GGTGCTATTAGAGCAGGGCTTGG + Intronic
1157577059 18:48750525-48750547 GGGGCCTGTGGGGCAGGGCTCGG - Intronic
1157582755 18:48782878-48782900 GTAGCCAGTGGAGTGGGGGTGGG - Intronic
1157677817 18:49580138-49580160 GGTGCCAATGAGGCAGGGTTGGG + Intronic
1158402545 18:57133904-57133926 GGTGCCAATGGATCAGAGTTGGG + Intergenic
1159020303 18:63137869-63137891 GGTGCCTGTGGTGCAGGGCAGGG + Intronic
1159143469 18:64424689-64424711 GGTGGCAGTGGGGCTGGGGGAGG + Intergenic
1160176568 18:76600163-76600185 GGGCCCCGTGGAGCAGGGGGTGG + Intergenic
1160722594 19:604070-604092 GGGGCCAAGGCAGCAGGGGTGGG + Intronic
1160811012 19:1012907-1012929 GCTGCCAGATGGGCAGGGGTGGG + Intronic
1160928751 19:1559870-1559892 GGTGGCAGTGCAGCTGGGGCGGG - Intronic
1160928995 19:1560901-1560923 ATTTCCAGTGGGGCAGGGGTGGG - Intronic
1161293135 19:3506421-3506443 GGTGCCAGGAGAGGCGGGGTCGG + Intronic
1161406967 19:4096157-4096179 GGTGCCAGCAGGGCAGGGGCAGG + Intronic
1161696437 19:5771209-5771231 GGGGCCAGTGGGGCTGGGGCAGG - Intronic
1161723033 19:5914205-5914227 GGTGCCTCTGGAGATGGGGTGGG - Exonic
1161975507 19:7606118-7606140 GGGGCCAGTGGTTCATGGGTGGG - Intronic
1162558460 19:11402155-11402177 GGTGGGGGTGGGGCAGGGGTAGG - Intronic
1162933743 19:13970163-13970185 GGAGCCACTGGACCTGGGGTGGG + Exonic
1163084488 19:14969447-14969469 GGTGGCAGTAGAGCTGGGGAGGG + Intronic
1163527999 19:17832887-17832909 GGTGCCAGGGCACCAGGTGTGGG + Exonic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1163664027 19:18594705-18594727 GGTGCGAGTGGAGTGGGGGGAGG + Intronic
1163774156 19:19208238-19208260 GCTGCCAGTGGGGGAGGGGTGGG - Intergenic
1164897647 19:31891139-31891161 GAAGCCAGTGGAGCAGGAGGAGG - Intergenic
1165110676 19:33500323-33500345 CCTGCCAGTGGGGCAGGGCTGGG - Intronic
1165392154 19:35545080-35545102 CGTACCTGTGGAGGAGGGGTCGG - Exonic
1165721052 19:38080025-38080047 GGGGCTTGTGGAGCAGGGGAAGG + Intronic
1166052690 19:40269881-40269903 GGTTCGAGCGGAGAAGGGGTGGG - Intronic
1166360443 19:42250875-42250897 GCTGCCAGTGGGGGAGGGGCAGG + Intronic
1166604338 19:44127121-44127143 GCAGCCAGAGGAGCAGGGGGTGG - Intronic
1166871584 19:45874001-45874023 GGGGCCAGAGCAGCAGGGGGAGG + Intergenic
1166917901 19:46208309-46208331 GGTGCAAGTGGGGCAGGCATGGG - Intergenic
1167006966 19:46782528-46782550 GGTGCCCGTGGGGCAGGAGGTGG - Exonic
1167095186 19:47371553-47371575 GGTGGCAGTAAAGCAGGGCTTGG - Intronic
1167211257 19:48135596-48135618 GGAGCCAGAGGAGCAGTGGGTGG - Intronic
1167255437 19:48425079-48425101 GGCGCAAGTGAAGCAGAGGTGGG - Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167517367 19:49930944-49930966 GGAGCCAGGGGGGCAGGGGCCGG - Exonic
1167643389 19:50693927-50693949 GGGGCCTGTGGGGGAGGGGTAGG + Intronic
1167666192 19:50823836-50823858 GGTGCCAGCAGGGCAGGGGTGGG - Intergenic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168452029 19:56474198-56474220 GGTGCCAGGGCAGGAGGGGAAGG - Intronic
1168697218 19:58410313-58410335 GGAGCTAGTGGAGCAGGTTTTGG + Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925310609 2:2878992-2879014 AGTGCCTGTGGGGCAGGGGATGG - Intergenic
926195262 2:10759932-10759954 GGAGCCAGTAAAGCAGTGGTAGG - Intronic
927928160 2:27027123-27027145 GGTGCCCGAGGGGCAGGGGGTGG - Exonic
928407264 2:31024185-31024207 GGTGACAGTGGTGCAGGTGCTGG - Intronic
929784321 2:44978240-44978262 GGGGCCACTGGAGCAGAGGAAGG + Intergenic
930326149 2:49921425-49921447 GGTGCAACTGGAGCAGTGGTTGG - Exonic
930422882 2:51176465-51176487 GCTGCCAGTGGAACGGGGGAAGG + Intergenic
931047800 2:58376067-58376089 GGTCCTACTGGAGTAGGGGTGGG - Intergenic
932416125 2:71574870-71574892 GTAGCCAGTGGAACTGGGGTAGG + Intronic
933731877 2:85462437-85462459 GTTGCTGGTGGAGCAGGGTTTGG - Intergenic
933937206 2:87216459-87216481 AGTGGCATTGGAGAAGGGGTTGG + Intergenic
934188169 2:89764067-89764089 GGTGCCAGGCATGCAGGGGTGGG + Intergenic
935292554 2:101622512-101622534 GGTGGCAGGGGGGTAGGGGTAGG - Intergenic
935418660 2:102844384-102844406 TGAGCCAGTGCAGGAGGGGTGGG - Intergenic
936355937 2:111749365-111749387 AGTGGCATTGGAGAAGGGGTTGG - Intergenic
936370586 2:111898932-111898954 GGTGCCAGAGGAGGGGGCGTAGG + Intronic
938160306 2:128979451-128979473 GGTGGCTGTTGAGCAGGAGTGGG + Intergenic
938496901 2:131802488-131802510 GGTGATATGGGAGCAGGGGTCGG - Intergenic
938931166 2:136088103-136088125 GGCACCCGTGGAGCAGGGGGCGG + Intergenic
939647019 2:144712555-144712577 GGTGGCAGGGCTGCAGGGGTTGG - Intergenic
941639945 2:167976638-167976660 GGGGCCATAGGAGCAGAGGTTGG - Intronic
941951461 2:171160721-171160743 GGTGCCAGCCGGGCCGGGGTCGG + Exonic
942062753 2:172243003-172243025 GGTACCAAAGGGGCAGGGGTGGG + Intergenic
942113667 2:172706961-172706983 GGTGTCAGTGGAGGCGGAGTGGG - Intergenic
943494702 2:188606427-188606449 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
944325261 2:198396901-198396923 GGAGCCACTGCAGCAGGGCTGGG + Intronic
945188436 2:207163401-207163423 GGAGGCAGAGGAGCAGGGGGAGG + Intronic
946155409 2:217803724-217803746 GGTGGCAGTGCAGCAGGGGAGGG - Exonic
946161837 2:217840253-217840275 AGTGTCAGAGGAGCAGGGGAAGG + Intronic
946165118 2:217858978-217859000 GGTGAGAGTTGAGCAGGGGCTGG - Intronic
947576739 2:231281221-231281243 GGGGGCAGTGGGGCGGGGGTGGG + Intronic
948284778 2:236775074-236775096 GGTGCGAGTGGGGCAGGGTCTGG + Intergenic
948597245 2:239087907-239087929 GGTGCCCTTGGCTCAGGGGTCGG + Intronic
948918044 2:241048235-241048257 GGTGCCATTGGAGCTGGGCGGGG + Intronic
948932646 2:241141943-241141965 GCTGCATGAGGAGCAGGGGTGGG - Intronic
949028327 2:241776625-241776647 TGGGGCAGGGGAGCAGGGGTAGG + Intergenic
1168796368 20:612413-612435 TGTGCCAGTAGAGCTGGGCTTGG + Intergenic
1168973857 20:1949564-1949586 TGTGCCAGAGGTGGAGGGGTTGG - Intergenic
1169194504 20:3675910-3675932 GGTGTGTGTGGGGCAGGGGTAGG - Intronic
1169194882 20:3677702-3677724 GGGTCCAGTGAAGCAGGTGTCGG - Intronic
1169304291 20:4474996-4475018 GGTGGCAGTGAAGAAGGAGTGGG - Intergenic
1170628852 20:18050921-18050943 GGTTACAGTGGAGCAGGGGGAGG + Intronic
1170787089 20:19476995-19477017 GGTGTCAGCTGAGCTGGGGTGGG + Intronic
1171060744 20:21956908-21956930 GGTGGGAGTGGAGCTGGGCTGGG + Intergenic
1171249703 20:23638255-23638277 GGGGCCAGGGGAGGAGGGGAGGG - Intronic
1171403141 20:24892316-24892338 GGTGTCCGTGCAGCAAGGGTGGG - Intergenic
1171940487 20:31324075-31324097 AGTCCCAGTTGAGGAGGGGTAGG - Intergenic
1172697637 20:36833466-36833488 GATGCCTGGGGAGCAGGGGCTGG - Intronic
1172801405 20:37578930-37578952 GGGGCCAGTGAAGCCGGGGAAGG + Intergenic
1173255571 20:41392348-41392370 GGGGCCAGTGCAGCAGGAGAGGG + Intergenic
1173551419 20:43935423-43935445 GGTACCAGTGGAGTTGGGGCGGG + Intronic
1174107534 20:48173240-48173262 GATGCCAGTGGAGAAGGTGGTGG + Intergenic
1174218027 20:48932140-48932162 GGTGACAGAGGTGGAGGGGTTGG + Intronic
1174283213 20:49454178-49454200 GGTACCAGTGGAGCAGCCTTGGG + Intronic
1174390605 20:50216430-50216452 GGGGGCAGTGGAGCTCGGGTGGG + Intergenic
1174398222 20:50260982-50261004 GGTGGCAATGGAGCTGGGGTGGG - Intergenic
1175402580 20:58708853-58708875 GGTGGCACGGGGGCAGGGGTGGG + Intronic
1175874305 20:62222152-62222174 GATGACAGGGGAGGAGGGGTGGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1175988056 20:62774005-62774027 GGGGACAGTGGAGCAGGCCTGGG + Intergenic
1176150522 20:63588604-63588626 GGTGACAATGGCGCAGAGGTGGG + Exonic
1176215625 20:63946373-63946395 AGTGCCTGTGGAGCAGGAGAAGG - Intronic
1176257145 20:64158533-64158555 GGGGCCAGTGGAGCAGGTGGGGG - Intronic
1176322679 21:5349036-5349058 GGTGGCAGTGAAGCTGGGGGTGG + Intergenic
1176382592 21:6120701-6120723 GGTGCTAGAGCAGCAGAGGTAGG + Exonic
1176480333 21:7280656-7280678 GGTGGCAGTGAAGCTGGGGGTGG + Intergenic
1176630087 21:9129475-9129497 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1178291493 21:31372462-31372484 GGTTCCGGCTGAGCAGGGGTTGG - Intronic
1178694343 21:34780285-34780307 TCAGCCAGTGGAGCAGGGTTGGG - Intergenic
1179123328 21:38568991-38569013 TGAGCCAGTGGAGCAGGTGAAGG + Intronic
1179300953 21:40109850-40109872 GGTGGCAGTGAAGCTGGGGGAGG + Intronic
1179441829 21:41400196-41400218 GGTGCCAGGGGACCAGGGGAGGG + Intronic
1179740877 21:43417538-43417560 GGTGCTAGAGCAGCAGAGGTAGG - Exonic
1179888958 21:44326338-44326360 GGTGCCAGTGGGGCTGGGCCTGG - Intronic
1180206002 21:46261028-46261050 GGTGTCAGGGGAGCTGGAGTAGG - Intronic
1180455414 22:15510364-15510386 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1180998444 22:19976914-19976936 GGGGTCAGTGGGGCAGGGGCAGG + Intronic
1181000351 22:19985232-19985254 GGTGCAAGAGGAGCAAGGATGGG - Intronic
1181014371 22:20060832-20060854 GAGGCCAGGGCAGCAGGGGTGGG - Intronic
1181120939 22:20668493-20668515 AGTGCCCCTGGGGCAGGGGTAGG + Intergenic
1181318279 22:21985270-21985292 GGTCAGAGTGGAGCTGGGGTTGG - Intergenic
1181782706 22:25204747-25204769 GGTGTGAGTGAAGCAGGGGAGGG - Intronic
1182053014 22:27327709-27327731 GAGGCCAGTGGAGCTGGAGTAGG + Intergenic
1182143795 22:27984441-27984463 GGGGCCTGTGGAGGAGGGGGTGG - Intronic
1182364316 22:29767590-29767612 GGTGACAGTGGAGTAGAGGTGGG + Intronic
1183248717 22:36713165-36713187 GGTGCAAGTGAAGGAGGTGTTGG + Intergenic
1183269245 22:36850353-36850375 GGAGCAAGTGGCACAGGGGTTGG + Intergenic
1183504428 22:38201493-38201515 GGTGGCAAGGGAGCAGAGGTAGG + Intronic
1183584750 22:38746434-38746456 GGTGGCAGGGGAGCGGGGGAGGG + Intronic
1183724055 22:39578665-39578687 GGGAGCAGTGGAGCAGGGCTGGG - Intronic
1184404770 22:44293518-44293540 GATGTCAGTGGTGCTGGGGTGGG + Intronic
1184667788 22:45997715-45997737 GGTTCCAGTGGTGGAGGGGGTGG - Intergenic
1185272581 22:49935811-49935833 GGTCCAGGAGGAGCAGGGGTAGG + Intergenic
949770046 3:7568920-7568942 GGCACCGGTGGAGCAGGGGGCGG - Intronic
950068911 3:10136468-10136490 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
950658221 3:14450512-14450534 GGGGCTAGGGGTGCAGGGGTAGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951851139 3:27141186-27141208 GGTGCAAGTGGAGACGGAGTTGG - Intronic
952245878 3:31592126-31592148 GGTGCCAGGGGCGGAGGGGAAGG - Intronic
952834911 3:37594266-37594288 GGAGCAAGTGGAGCTGGGGAGGG + Intronic
954036427 3:47853440-47853462 GGTGCCAGGGCAGCAAGGGTGGG - Intronic
954376127 3:50195074-50195096 GGAGCCTGAGGAGCTGGGGTGGG - Intronic
954409589 3:50364634-50364656 GGTGGGAGTGGAGGTGGGGTGGG + Intronic
954443567 3:50534708-50534730 GGAGTGAGTGGATCAGGGGTTGG - Intergenic
954898442 3:53997250-53997272 GGTGCCAGTGGAAAAGGAGACGG - Intergenic
955208456 3:56918508-56918530 GGTAGCAGTGGAGCAGGGAGGGG + Intronic
955210336 3:56934793-56934815 GGGTGCAGTGGAGCAGGGGGTGG - Intronic
955712223 3:61792310-61792332 GGTGCCTGTGGAGCTGAGGTGGG - Intronic
955976779 3:64487497-64487519 GGGGGCAGTGGGGCAGGGGTGGG - Intergenic
956952645 3:74299773-74299795 GGTGCCAATGGTGCAGGTGGTGG - Intronic
957016472 3:75069883-75069905 GCAGCCAGAGGAGCAGGGGGTGG - Intergenic
957919654 3:86731626-86731648 GCTGCCCGTGGGGCAGGGCTTGG - Intergenic
958579865 3:96004397-96004419 GGAGACAGTGTGGCAGGGGTGGG - Intergenic
959542018 3:107550743-107550765 GGTGACATTGGAGCAGGGTATGG + Intronic
960243584 3:115374506-115374528 AGTGCCAGTGGAGCTGGTGCAGG - Intergenic
961370047 3:126423432-126423454 AGAGCCAGAGGGGCAGGGGTGGG - Intronic
961576163 3:127838121-127838143 GGGGGCAATGGTGCAGGGGTTGG + Intergenic
961666884 3:128498055-128498077 GGTGCCCGTGCAGAAGAGGTGGG + Intergenic
961756345 3:129129278-129129300 GGAGCGAGTGGAGCAGGTGGAGG + Intronic
962180355 3:133199975-133199997 GGTGGCAGTGAGGCTGGGGTAGG - Intronic
963744202 3:149109684-149109706 GGTGGCTGTGGAGCAGGGGACGG - Intergenic
964422845 3:156522420-156522442 GGTGCCAGTGGTGATGAGGTGGG - Intronic
965271074 3:166617856-166617878 GGTGGCAGTGAGGCTGGGGTAGG + Intergenic
965644575 3:170866878-170866900 GTTGCCTGTTGAGCCGGGGTGGG - Intronic
966624212 3:181999091-181999113 TGTGCCAGGGGTGCAGGGGTAGG + Intergenic
967984715 3:195086389-195086411 TGTTCCAGGGAAGCAGGGGTAGG - Intronic
968078889 3:195833366-195833388 GGGGCCAGTGGAGGAGGGTGAGG + Intergenic
968504116 4:964144-964166 AGAGCGAGTGGAGCTGGGGTGGG + Intronic
968652690 4:1766489-1766511 GGTGCCAGTCGAGGAGGGAGGGG + Intergenic
968654509 4:1772756-1772778 GGTGGGAGTGGAGCAGGCTTGGG - Intergenic
969407595 4:7004318-7004340 CCTGGCAGTGAAGCAGGGGTGGG - Intronic
969662867 4:8540570-8540592 GGTTCCGGTGGGGCAGGGGCGGG + Intergenic
970323759 4:14901629-14901651 GCTGTCTGTGGGGCAGGGGTTGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970673117 4:18418370-18418392 GGCGCCGGCGGAGCAGGGGGCGG + Intergenic
971824682 4:31605664-31605686 GGAGCCAGAGCAGCAGGAGTAGG - Intergenic
972164302 4:36263849-36263871 GGTTGAAGTAGAGCAGGGGTGGG + Intergenic
973982431 4:56317265-56317287 GCAGCCAGTGGAGCTGGTGTTGG + Intronic
974857344 4:67476575-67476597 GCTGCCAGTGGAACTGGGGGAGG + Intronic
975622131 4:76306477-76306499 GCGGCCAGGGGCGCAGGGGTCGG - Intronic
975689408 4:76949593-76949615 GGGGCCAGTGGAGCTGGGCTCGG + Intergenic
976171065 4:82304799-82304821 GTTGCCAGGGGATCAGGGGAGGG + Intergenic
976304748 4:83548701-83548723 GGTGCCGCTGGAGCAGGGCATGG - Intronic
976615056 4:87068168-87068190 ATTGCCAGTGGAGTGGGGGTGGG + Intronic
976646819 4:87395978-87396000 GGGCGCCGTGGAGCAGGGGTTGG + Intergenic
980075539 4:128289119-128289141 GGAGACATTAGAGCAGGGGTTGG + Intergenic
980628643 4:135406947-135406969 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
980670862 4:136004944-136004966 GGTGCGGGTGGGGCAGGGGGAGG + Intergenic
981288267 4:143045205-143045227 AGTGCCACTGCAGCAGGGGCTGG + Intergenic
981598048 4:146449439-146449461 GGAACAAGAGGAGCAGGGGTTGG + Intronic
981809664 4:148759498-148759520 GGAGCAAGAGGAGGAGGGGTTGG + Intergenic
982770208 4:159390283-159390305 GGCGCCATTGGAGCAGGGGGTGG - Intergenic
983790834 4:171795272-171795294 GGTACCAGTGAAGCAGGGGTGGG + Intergenic
984238769 4:177193228-177193250 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
984650273 4:182263253-182263275 GGTGACAGTGGATAAGTGGTGGG + Intronic
985366448 4:189236634-189236656 GGGCGCCGTGGAGCAGGGGTTGG - Intergenic
985483751 5:137238-137260 GGTGCCAGGGGCTCAGGGGCAGG + Intergenic
986000445 5:3627019-3627041 AGTGTCACTGGAGCAGGGCTGGG + Intergenic
986161914 5:5237676-5237698 AGAGTCAGTGAAGCAGGGGTGGG + Intronic
986295684 5:6436180-6436202 GGTGCCTCTGGTGGAGGGGTGGG + Intergenic
986671822 5:10149632-10149654 GGTGCCAGTATACCATGGGTGGG - Intergenic
990090474 5:52040409-52040431 GGTGTTAATGGAGTAGGGGTAGG + Intronic
990438793 5:55822335-55822357 GGGGACAGGGGACCAGGGGTTGG + Intergenic
990528407 5:56650857-56650879 GAAGCAAGTGGAGCAGGGGGTGG - Intergenic
991427128 5:66503563-66503585 GGGCGCAGTGGAGCAGGGGGTGG - Intergenic
992504868 5:77376876-77376898 AGTGCTAGTGTAACAGGGGTGGG + Intronic
993022330 5:82606057-82606079 GGTGGCAGTGGTGAAGGGGCTGG - Intergenic
994172093 5:96668966-96668988 GGTGCTACTGGAGGAGGGGGTGG + Intronic
996237652 5:121152043-121152065 AGTGGGAGGGGAGCAGGGGTTGG - Intergenic
996665933 5:126060167-126060189 GGTGGCAGTGGGACAGGGGTGGG - Intergenic
996804748 5:127441806-127441828 GGTGCCAGTGGAGTGGGGTGGGG - Intronic
997103694 5:130995226-130995248 GGTGCCTGTGGAGCCGGCCTTGG - Intergenic
997356370 5:133265516-133265538 GGGGCCTCTGGGGCAGGGGTGGG + Intronic
997615173 5:135241130-135241152 GTTGTCAGTGGGCCAGGGGTGGG + Intronic
998388809 5:141773893-141773915 GGTGTGAGTGGGGCAGGGATGGG + Intergenic
999182674 5:149681116-149681138 GGTGCTTGTGGAGCAGGGGAGGG - Intergenic
999406750 5:151313275-151313297 GGTGTCCTTGCAGCAGGGGTTGG + Intergenic
999438105 5:151580175-151580197 GTTGACAGTGGAGCTGGGGTTGG - Intergenic
999875931 5:155805724-155805746 GGTGCCAGTGGAGAGGAGGCGGG + Intergenic
1000244377 5:159437093-159437115 GGTCCCTGAGGAGCAGGGATAGG + Intergenic
1001135303 5:169097820-169097842 TGTGCCTGGGGAGCAGGGTTTGG - Intronic
1001992792 5:176132478-176132500 GGTGCTGGTGGGGCAGGGGTGGG + Intergenic
1002318312 5:178359931-178359953 GAGGTCCGTGGAGCAGGGGTGGG + Intronic
1002460617 5:179371797-179371819 GGGGCCTGGGGAGCAGGGGCTGG - Intergenic
1002776659 6:333726-333748 GGGGCAGGTGGGGCAGGGGTGGG - Intronic
1003267383 6:4577869-4577891 GCTGCCTCTGGAGCTGGGGTGGG - Intergenic
1003908181 6:10720918-10720940 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
1004559251 6:16731774-16731796 AATGCCAGTGTAGGAGGGGTGGG - Intronic
1004806668 6:19210677-19210699 GCTGTCAGTGGAGCACAGGTGGG + Intergenic
1005561480 6:27045561-27045583 GGTGCCCGTGGAGTAGGGGGCGG - Intergenic
1005887521 6:30108121-30108143 AGTTCCAGAGGAACAGGGGTTGG + Exonic
1006127999 6:31852344-31852366 GGGGGCCGTGGAGCAGGGGGTGG - Intergenic
1006416556 6:33907610-33907632 AGTGCCTGTGGAGCTGGGGTGGG + Intergenic
1006866072 6:37209961-37209983 GGGGCCAGTGCGGCAGGGGAGGG + Intergenic
1006912399 6:37571920-37571942 GGTGCAAGGGCAGCAGGGGCTGG - Intergenic
1007079416 6:39088279-39088301 GGGGCCGGGGGAGCGGGGGTTGG - Intergenic
1007621786 6:43219924-43219946 GGTGCAAGTTGATCAGGGTTTGG + Intronic
1007825807 6:44599885-44599907 GATGCCAGGGGTGCAGGGGAGGG - Intergenic
1009039785 6:58162416-58162438 TGTACCAGTGGAGGAGAGGTTGG - Intergenic
1009215681 6:60917263-60917285 TGTACCAGTGGAGGAGAGGTTGG - Intergenic
1009686811 6:66970013-66970035 GTTGCCAGAGAAGCAGGGGAAGG + Intergenic
1010655065 6:78502675-78502697 CTTGCCAGTGGGGCAGTGGTGGG + Intergenic
1013313224 6:108917249-108917271 GGGGCCAGAGAAGCGGGGGTAGG - Intronic
1014788522 6:125644781-125644803 GGCACCAGTGGAGCAGGGGGTGG - Intergenic
1016007955 6:139108474-139108496 GGTGTCGGTGGAGCAGGGGCGGG - Intergenic
1017103099 6:150865740-150865762 CGTGCCAGGGGAGCAGGCGGCGG - Exonic
1018430462 6:163717644-163717666 GGAGGCAGAGAAGCAGGGGTGGG + Intergenic
1019722080 7:2578655-2578677 GGTGTCAGTGGAGAAGGGTTTGG - Intronic
1019886294 7:3908935-3908957 GGTGACACTGGAGTTGGGGTGGG + Intronic
1020448212 7:8292311-8292333 GTTTCCTGTGGAGCAGAGGTGGG - Intergenic
1021433259 7:20585226-20585248 TGTGGCAGTGGAGCTGGGGAGGG - Intergenic
1021686720 7:23193764-23193786 GGTGCCGGTGGAGCAGGGGGTGG + Intronic
1022842302 7:34176363-34176385 GGTGTCAGTGGAGGCTGGGTGGG - Intergenic
1023425375 7:40030394-40030416 GTTGCCAGAGTTGCAGGGGTGGG - Intronic
1023582045 7:41693567-41693589 GCTGCCTGTGAAGAAGGGGTGGG - Intronic
1023800071 7:43826394-43826416 GGTGCCAGTGGGCAAGGGATGGG + Intergenic
1023912827 7:44567597-44567619 GGTGCGAGGGATGCAGGGGTTGG - Intronic
1023991586 7:45132045-45132067 GCTGCCAGGGATGCAGGGGTGGG - Intergenic
1026020469 7:66701066-66701088 CCTGGCAGTGGGGCAGGGGTGGG + Intronic
1026420779 7:70234924-70234946 TATTCCAGTGGAGCAGTGGTGGG + Intronic
1026591184 7:71696994-71697016 GGAGCCAGTGGAGACAGGGTGGG + Intronic
1026879812 7:73901293-73901315 CCTGGCAGTGGGGCAGGGGTGGG - Intergenic
1027233092 7:76283119-76283141 GGGGCCGGTGGCGCAGGGCTGGG + Intronic
1027674524 7:81142067-81142089 GGGCCCCGTGGAGCAGGGGGCGG - Intergenic
1028774378 7:94660796-94660818 GGTGGCAGGGGGGCAGGGGTGGG + Intronic
1028993822 7:97077843-97077865 TGTGCCTGTGGAGGTGGGGTAGG - Intergenic
1029114946 7:98232003-98232025 GGTGCCAGGGGAGGAGGGCGGGG + Intronic
1029143541 7:98429363-98429385 GTTGCCTATGGAGCAGTGGTGGG + Intergenic
1029273948 7:99393247-99393269 GGTGCTAGTGGAGCCTGGGAGGG + Intronic
1029507540 7:100971409-100971431 GGGGGCAGGGGAGCTGGGGTGGG + Intronic
1029903978 7:104071986-104072008 CCTTCCAGTGGAGCAGGGCTTGG + Intergenic
1031513698 7:122677435-122677457 GGTGCCTGAGGAGGACGGGTGGG + Intronic
1031930234 7:127678043-127678065 TGTGCCAGTAGAACAGGTGTTGG - Intronic
1031999197 7:128253916-128253938 GGAGTCACTGGAGCAGGGTTGGG + Intronic
1032431951 7:131869590-131869612 GGTGACAGTGGAGGAGGGGAAGG - Intergenic
1032686096 7:134235272-134235294 AGTGTCAGTGGAGCTGAGGTAGG - Intronic
1032794117 7:135263803-135263825 GGTGCCAGTGGAGGGTGGGACGG + Intergenic
1033210767 7:139458561-139458583 GTTGCCAGTGCAGCGGGGGATGG - Intronic
1033473304 7:141667899-141667921 GGTGGCAGAGGAGTAGGCGTGGG - Intronic
1033949971 7:146772780-146772802 GGTGGCGGGGTAGCAGGGGTTGG + Intronic
1034366296 7:150551480-150551502 GGTGCCAGTGGAGACAGGGCTGG - Intergenic
1034536412 7:151728451-151728473 GGTGACAGAGCAGCAGGGGCTGG + Intronic
1034976868 7:155454087-155454109 GGGGCGCGGGGAGCAGGGGTGGG - Intergenic
1035063501 7:156088325-156088347 GCTGCCAGTGGAGCAGGGAGGGG + Intergenic
1035685003 8:1517450-1517472 GCTCTCAGTGGAGCAGGGGGTGG - Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1036754380 8:11462747-11462769 GCTGCGAGTGGGGTAGGGGTGGG - Intronic
1037665282 8:20963742-20963764 GGTCTCATTGGAGCAGGGCTAGG + Intergenic
1038425959 8:27463933-27463955 AGTGCCCGTGGAGAAGAGGTGGG + Exonic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1040386274 8:46916895-46916917 GGTGACAGTGGAGGTGGTGTTGG - Intergenic
1040581729 8:48704102-48704124 TGTGCCAGAGGAGGCGGGGTAGG - Intergenic
1040723169 8:50350246-50350268 GGCTCCGGTGGAGCAGGGGGCGG - Intronic
1041279313 8:56195541-56195563 GGTGCCAGAGAGGCTGGGGTAGG + Intronic
1041828252 8:62123165-62123187 GGTGGGAGTGGGGCAGGGGGTGG - Intergenic
1042188142 8:66157215-66157237 GGGGCAGGTGGAGCAGGTGTGGG + Intronic
1044091580 8:88008837-88008859 GGTGGAAGTAGAGGAGGGGTTGG + Intergenic
1045036144 8:98178012-98178034 AGTGCCAGAGTAGCAGGGGCTGG + Intergenic
1047807229 8:128373150-128373172 GGTGCCAGTGTTGCTGGTGTTGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048136030 8:131747145-131747167 GGTGGGAGGGGAGCATGGGTTGG + Intergenic
1048575992 8:135690490-135690512 GGCGCTAGTGGAGCAGGGAGCGG + Intergenic
1048602309 8:135931205-135931227 GGTGCCAGGGAAGAAGGGGCAGG + Intergenic
1048795867 8:138149367-138149389 GGTGCTAGAGAAGCAGGGGAAGG - Intronic
1048926944 8:139279971-139279993 GCTACAAGAGGAGCAGGGGTTGG - Intergenic
1049667447 8:143852557-143852579 GCAGCCAGTGGAGCAGGGCCAGG + Intergenic
1049682087 8:143923832-143923854 GGAGCGAGCGGAGCAGGAGTCGG - Exonic
1049705496 8:144040290-144040312 GGTGGCAGTGGAGCTGAGGAGGG - Exonic
1049709640 8:144057748-144057770 GGAGGCAGGGGAGCAGGAGTAGG + Intronic
1051102288 9:13535289-13535311 TGTTCCAGTGGGGCAGTGGTGGG + Intergenic
1052956014 9:34253874-34253896 GGTGCTAGGGGGACAGGGGTGGG - Exonic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053336076 9:37273009-37273031 AGTTTCAGTAGAGCAGGGGTTGG + Intronic
1056535080 9:87519816-87519838 GGTGTCAGTGAAGTAGGGGTGGG + Intronic
1057260469 9:93580200-93580222 GGTGCCAGTGAAGAAGGGCTGGG - Intronic
1057572990 9:96218343-96218365 GGTGCCGGCGGGGCAGGGGATGG - Intergenic
1059420874 9:114191412-114191434 GGTGGCAGGGGAGTAGGGGTAGG - Intronic
1059434569 9:114268193-114268215 GTTTCCACTGGAGCAGGGCTGGG + Intronic
1059434594 9:114268327-114268349 GTTTCCACTGGAGCAGGGCTGGG + Intronic
1059852905 9:118363925-118363947 GGTGCCAGTGGAGGGTGGGAGGG - Intergenic
1060294109 9:122331598-122331620 AGTGGCAGTGAGGCAGGGGTTGG + Intergenic
1061130602 9:128705851-128705873 GGTGCCACTGGCGCACGTGTGGG - Exonic
1061230567 9:129313490-129313512 GGAGCCACAGGAGCTGGGGTGGG - Intergenic
1061256997 9:129459210-129459232 GGTGCCCGTGCAGAGGGGGTAGG + Intergenic
1061402824 9:130377806-130377828 GGCGCCAGTGGGCCAGGGGTGGG + Intronic
1061445337 9:130634244-130634266 GGGCCATGTGGAGCAGGGGTAGG - Intronic
1061544796 9:131298492-131298514 GGGGCTAGTGGGGTAGGGGTGGG - Intronic
1061922062 9:133787831-133787853 GGGGCCAGGGCTGCAGGGGTGGG - Intronic
1061942811 9:133892159-133892181 GAGGCCAGTGGTGCAGGGGAGGG + Intronic
1062024094 9:134332509-134332531 GCTGCCTGTGGAGGAGGGGTGGG + Intronic
1062088666 9:134662455-134662477 GGTGCCAGTGGAGCTGGCCTAGG + Intronic
1062146166 9:134991065-134991087 GGGCACAGTGGAGCAGGGGGCGG + Intergenic
1062286981 9:135777735-135777757 GGAGCCAGAGGAGCTGGGGGTGG - Intronic
1062294253 9:135815571-135815593 GCTGCCCTTGGAGCAGGCGTGGG - Intronic
1062463019 9:136669706-136669728 GGGGCCTGTGGAGCAGGTGAGGG + Exonic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062628208 9:137452467-137452489 GGTGCCCCTGGGGCTGGGGTGGG - Intronic
1203752922 Un_GL000218v1:97160-97182 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1185664777 X:1757023-1757045 GGTTACAGTGGATAAGGGGTTGG - Intergenic
1186707406 X:12156295-12156317 GCTGGCAGTGGAACAGAGGTAGG - Intronic
1186806672 X:13146675-13146697 GAAGCCAGTAGAGCAGGGGAAGG - Intergenic
1187219280 X:17308154-17308176 GCGGCCAGAGGAGCAGGGGGTGG - Intergenic
1187487210 X:19715913-19715935 GGTGCCAGGGGCTCAGGGGGTGG + Intronic
1189198955 X:39175467-39175489 GGTGCCAGAGGAGCAATGGCTGG + Intergenic
1190023837 X:46903999-46904021 GGTGCCACTGGGTGAGGGGTTGG - Intergenic
1190053386 X:47168652-47168674 GGTGACAGTGAAGCAGGGGCAGG + Intronic
1190439476 X:50463203-50463225 GGTGGCAGAGAAGGAGGGGTGGG - Intronic
1190511120 X:51175407-51175429 GGTGACAGAGGAGAGGGGGTAGG - Intergenic
1190925303 X:54898299-54898321 GGTGTCAGTGAAGCAGGGAAGGG + Intergenic
1191633436 X:63350639-63350661 CGAGCCAGTGGAGCAGTGGAAGG - Exonic
1192486189 X:71528840-71528862 GTTGCCAGTGGGGCTGGGGGCGG + Intronic
1192780828 X:74292612-74292634 GGCTCCAGTGGGGCGGGGGTGGG - Intergenic
1192805401 X:74504396-74504418 GGTGCCTCTGTAGTAGGGGTGGG - Intronic
1193036579 X:76957838-76957860 AATGCCAGTGCAGCAGGGGGTGG + Intergenic
1193423112 X:81308290-81308312 GGCTCCAGTGGGGCAGTGGTGGG + Intergenic
1193785689 X:85757428-85757450 GGTGGCAGTGAGGCTGGGGTAGG - Intergenic
1194890445 X:99372104-99372126 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1195172385 X:102281742-102281764 AGAGACAGTGGACCAGGGGTCGG - Intergenic
1195186479 X:102405352-102405374 AGAGACAGTGGACCAGGGGTCGG + Intronic
1195197796 X:102516557-102516579 GGAGCCAGAGGAGCCGAGGTTGG - Intronic
1195347233 X:103962810-103962832 GGAGCCAGAGGGGCTGGGGTTGG + Exonic
1195360209 X:104076031-104076053 GGAGCCAGAGGGGCTGGGGTTGG - Intergenic
1196717329 X:118824091-118824113 GGTGACTGTGAGGCAGGGGTAGG + Intronic
1196741558 X:119029842-119029864 GGCGCCAGTGGAGCAGGGGGTGG - Intergenic
1197376752 X:125690612-125690634 GGCGCCCATGGAGCAGGGGGCGG + Intergenic
1197407099 X:126066028-126066050 AGTGCCAGTGGAGCATGGGAGGG - Intergenic
1197713182 X:129686914-129686936 GGTGCCAGTGGGGATGGGCTAGG - Intergenic
1200088825 X:153624954-153624976 GGTGCCAGAGGACAAGAGGTTGG + Intergenic
1201166564 Y:11214730-11214752 GGTTCCAGAGGCGCAGGAGTGGG - Intergenic
1201543992 Y:15140518-15140540 GTTGCCTGTGGAGAAGAGGTGGG + Intergenic