ID: 906034458

View in Genome Browser
Species Human (GRCh38)
Location 1:42741652-42741674
Sequence TTGGGACCCACAGGTCGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906034458_906034464 -5 Left 906034458 1:42741652-42741674 CCTGGACGACCTGTGGGTCCCAA 0: 1
1: 0
2: 0
3: 13
4: 119
Right 906034464 1:42741670-42741692 CCCAAGACCAAATGGGGTCTAGG 0: 1
1: 0
2: 2
3: 12
4: 137
906034458_906034467 2 Left 906034458 1:42741652-42741674 CCTGGACGACCTGTGGGTCCCAA 0: 1
1: 0
2: 0
3: 13
4: 119
Right 906034467 1:42741677-42741699 CCAAATGGGGTCTAGGACAGTGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906034458 Original CRISPR TTGGGACCCACAGGTCGTCC AGG (reversed) Intergenic
900313966 1:2048041-2048063 TGGGCACCCACAGGACTTCCTGG - Intergenic
900980936 1:6045757-6045779 TTTGGACCCACAGGTCGAAAGGG - Intronic
901363307 1:8722847-8722869 TTGGTACCCACCGATGGTCCTGG + Intronic
903047412 1:20575218-20575240 TTGGGAGCCACAGCTTGTGCAGG + Intergenic
903687590 1:25143268-25143290 TTGGCAGCCACAGGTCTTTCTGG + Intergenic
905910680 1:41651632-41651654 TTGGAACCCTCAGGGCATCCTGG + Intronic
906034458 1:42741652-42741674 TTGGGACCCACAGGTCGTCCAGG - Intergenic
906099815 1:43253073-43253095 TTGGGATCCACTGGGCTTCCTGG - Intronic
911865523 1:103015723-103015745 TAGGGCCCCCCAGGACGTCCTGG - Exonic
913043058 1:115047773-115047795 TTGGTATCCACAGGGGGTCCTGG + Intergenic
913135297 1:115882593-115882615 TTAGTATCCACAGGTTGTCCTGG - Intergenic
919408495 1:197214482-197214504 TTGGTACCCATGGGTGGTCCTGG + Intergenic
924542788 1:244996889-244996911 TTGGTATCCACAGGAGGTCCTGG - Intronic
1065145638 10:22764946-22764968 TTAAGACCCACAGGTCTTCAGGG + Intergenic
1073511173 10:104043509-104043531 ATGGGACCCCCAGGACCTCCAGG - Exonic
1074783961 10:116822426-116822448 TGTGAACCCACAGGGCGTCCTGG - Intergenic
1075488075 10:122843307-122843329 TTGGTATCCACAGGGGGTCCTGG - Intronic
1083746337 11:64739173-64739195 TGGGGGCTCACAGGTCGTCAGGG - Intronic
1084616361 11:70238954-70238976 TTGGTATCCACAGGAGGTCCTGG + Intergenic
1087176994 11:95105239-95105261 TTGGTATCCACAGGGAGTCCTGG - Intronic
1087443156 11:98210323-98210345 TTGGTATCCACAGGGAGTCCTGG - Intergenic
1087784325 11:102338081-102338103 TTGGGACCAACAGGTTGTTCTGG + Intronic
1089441731 11:118523203-118523225 ATGGGACCCAAGGGTCATCCTGG - Exonic
1090692284 11:129196533-129196555 TTGGTATCCACAGGGTGTCCTGG + Intronic
1091720580 12:2810444-2810466 CTGGGTCCCACAGGTATTCCTGG - Intergenic
1091872195 12:3903130-3903152 CTGGCACCCACAGGGAGTCCTGG - Intergenic
1092457180 12:8654402-8654424 CTGGGACCCCCAGGTCATCAGGG - Intronic
1095177049 12:39104667-39104689 TTGGTACCCACAGGAAGTCCTGG - Intergenic
1095903471 12:47353128-47353150 TTGGTACCCACAGGGGGTCCTGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1100480774 12:94976402-94976424 TTGGCATCCACAGGGTGTCCTGG - Intronic
1101685387 12:107014769-107014791 TTGGTATCCACAGGGGGTCCTGG - Intronic
1102740674 12:115204822-115204844 GTGGGAACCACAGGCAGTCCAGG - Intergenic
1103273843 12:119695451-119695473 TTGGTACCCACAGGAAGTCCTGG - Intronic
1104721004 12:131045218-131045240 TGGAGACCCACAGGTCCTGCGGG - Intronic
1105358354 13:19681079-19681101 GTGGCACACACAGGTCGTCCTGG + Intronic
1107295507 13:38902771-38902793 ATGGGACCCACTGGCTGTCCAGG - Intergenic
1107458093 13:40573502-40573524 TGGGGACCCTCAGGTGGTTCAGG - Intronic
1108699245 13:52929804-52929826 TTGGTACCCACAGGGGATCCTGG + Intergenic
1111422354 13:88029654-88029676 TTGGTACCCACAGGAGGTCCTGG + Intergenic
1111825698 13:93264301-93264323 TTGGTAGCCACAGGGGGTCCTGG - Intronic
1113749949 13:112770042-112770064 TTGGAGCCCACAGCACGTCCAGG - Intronic
1113973080 13:114205702-114205724 TGGGGACACACAGGTCTTCTGGG + Intergenic
1116157752 14:41230076-41230098 TTGGGACCCAAGGGTTGTCAAGG - Intergenic
1117626145 14:57640191-57640213 TTGGAACACACAGATCCTCCTGG - Intronic
1118327905 14:64793835-64793857 TTGTGACCCCCAGGTCATCCAGG - Exonic
1119620105 14:76125514-76125536 TTGGGACCCACATGTCAGCCTGG + Intergenic
1124260023 15:28180946-28180968 TTGGTATCCACAGGAAGTCCTGG + Intronic
1124632045 15:31343527-31343549 TGGGGACCCACAGGTGGCCTGGG + Intronic
1128196960 15:65766615-65766637 TTGGAATCCACAGGTGGTCCTGG + Intronic
1128521132 15:68375559-68375581 TTGGCACCTGCAGGTCTTCCTGG + Intronic
1128959696 15:71989407-71989429 TTGGTATCCACAGGGAGTCCTGG - Intronic
1129821525 15:78605372-78605394 GTGGGTCCCACAGGTCCTGCTGG - Intronic
1131187921 15:90291751-90291773 TTGTGAACCACAGGTCCTTCTGG + Intronic
1136053496 16:27670638-27670660 TTGGGAACCACATGTGTTCCAGG + Intronic
1136664884 16:31801828-31801850 ATGGGACCCACCTGCCGTCCAGG - Intergenic
1137596055 16:49724677-49724699 TTGGGGCCCACAGGTCACTCTGG + Intronic
1139046474 16:63066043-63066065 TTGAGACACACAGCTTGTCCAGG + Intergenic
1139198488 16:64949014-64949036 TTGGGAGCCACACGAAGTCCAGG - Intronic
1139666390 16:68459785-68459807 TTGGGACCCAGAAGCCGTCATGG + Intergenic
1141097517 16:81173182-81173204 TTGGGGACCACAGGATGTCCAGG + Intergenic
1141165715 16:81659621-81659643 GTGGGACCCACAGGTGTTGCTGG - Intronic
1143367238 17:6416098-6416120 TTGGGGCCCACACCTCCTCCAGG - Intronic
1143747464 17:9004423-9004445 TTGGGACCCTCGGGTCCGCCTGG + Intergenic
1147442262 17:40454381-40454403 TTGGGAGCCAGAGGTTGTCAGGG - Intronic
1151018880 17:70589584-70589606 TTGGCATCCACAGGGGGTCCTGG - Intergenic
1153146340 18:2037273-2037295 TTGGTATCCACAGGAGGTCCTGG + Intergenic
1153249406 18:3106213-3106235 TTGGTATCCACAGGGGGTCCTGG + Intronic
1154194222 18:12254197-12254219 CTGGGAGCCCCCGGTCGTCCTGG - Intergenic
1156036166 18:32770348-32770370 TGGGGGCCCCCAGGCCGTCCTGG + Exonic
1156265507 18:35484733-35484755 TTGGTACCCATAGGAGGTCCTGG + Intronic
1158162895 18:54506505-54506527 ATGGGGCCCTCAGGTCCTCCTGG + Intergenic
1160714191 19:568263-568285 TTGGGGCCCACACGGCATCCTGG + Intergenic
1163529846 19:17842792-17842814 TTGGCGCCCACAGGTCGGACAGG + Intronic
1164875788 19:31686940-31686962 TTGGTATCCACAGGAGGTCCTGG + Intergenic
1167502991 19:49857807-49857829 TTGGGACCCCCAGATCCTCACGG + Intronic
926335498 2:11859604-11859626 TTGGGACACACAGGGCGACCAGG + Intergenic
927217694 2:20677766-20677788 TTAGTACTCACAGGTCATCCTGG + Intergenic
927281776 2:21315178-21315200 TTGTGACCCACAGGTCCTGCTGG + Intergenic
928982076 2:37146413-37146435 TTGGCATCCACAGGGAGTCCTGG + Intronic
934091982 2:88559459-88559481 TTGGTATCCACAGGGAGTCCTGG + Intronic
936322758 2:111480812-111480834 CTGGGACCTACAGGACTTCCTGG - Intergenic
942172255 2:173299825-173299847 TTGGGGGCCAGAGGTAGTCCAGG + Intergenic
943893311 2:193320059-193320081 TTGGTACCCACAGGAGGTCCTGG + Intergenic
948173890 2:235928384-235928406 TTGGGGCCCATGGGTTGTCCTGG - Intronic
1170788621 20:19489707-19489729 TCGGGACCCACAGATCCTCAGGG - Intronic
1171198785 20:23224550-23224572 TTGGTATCCACAGGAGGTCCTGG - Intergenic
1172216253 20:33237835-33237857 TTGAGTCCCACAGGTCTTGCAGG + Exonic
1173555453 20:43962306-43962328 ATGGGACTCACTGGTGGTCCTGG + Intronic
1175249342 20:57599450-57599472 TTTGTACCCACAGGGAGTCCTGG - Intergenic
1175603427 20:60293551-60293573 TTGGGAACAACAGGTGGTCGTGG + Intergenic
1176141310 20:63546301-63546323 TTGGCACTCACACATCGTCCTGG - Intronic
1179374582 21:40838457-40838479 TTGGGACCCTCAGGTCATCAAGG + Intronic
1181999309 22:26907215-26907237 TTGGTATCCACAGGGGGTCCTGG - Intergenic
1185144234 22:49121318-49121340 GTGGGACCCAGAGGTCTTCAAGG - Intergenic
949798331 3:7875853-7875875 TTGGTATTCACAGGTGGTCCTGG + Intergenic
949876320 3:8628217-8628239 CTGGGACCCACAGGCAGTGCAGG + Intronic
952177470 3:30880716-30880738 TTGGTATCCACAGGAGGTCCTGG + Intronic
958955774 3:100464713-100464735 TTGGTATCCACAGGGGGTCCTGG - Intergenic
960397947 3:117159873-117159895 TTGGCACCCTCAGGATGTCCTGG + Intergenic
961337278 3:126188383-126188405 TTGGTATCCGCAGGTGGTCCTGG + Intronic
964815284 3:160710728-160710750 TTGGGACCCAAAAGGCTTCCTGG - Intergenic
968309171 3:197668511-197668533 TTGGAAGCCACAGTTCCTCCAGG + Intergenic
968788597 4:2643074-2643096 TTGGGACCCACAGGCAGTTGAGG + Intronic
969070683 4:4535913-4535935 TTGGGACCCAAAGGTTGAGCTGG - Intronic
969323505 4:6427163-6427185 GTGGGGCCCCCAGCTCGTCCTGG - Intronic
969952949 4:10857239-10857261 TTGGGACCCACAGGGGGCCAAGG - Intergenic
971353229 4:25871326-25871348 TTGGGACCCACAGTGGGCCCAGG + Intronic
982240155 4:153292055-153292077 TTGGGACCCACAAGGGTTCCTGG - Intronic
985055330 4:186031037-186031059 TTGGGGTCCACAGGACATCCAGG + Intergenic
988708619 5:33751378-33751400 TTGTGACTCACATGTCCTCCTGG - Intronic
1000234172 5:159342327-159342349 TTGGGACCTACAGGTGAACCAGG + Intergenic
1007938549 6:45755234-45755256 CTGGGAGCCTCAGGTCATCCTGG + Intergenic
1011097176 6:83679240-83679262 TTGGTATCCACAGGGAGTCCTGG + Intronic
1013788008 6:113804251-113804273 TTGGTATGCACAGGTGGTCCTGG - Intergenic
1014473858 6:121848819-121848841 GTTGGACCCACACGTAGTCCTGG + Intergenic
1019643008 7:2114848-2114870 TTGAGGCCCACAGGTAGTTCTGG + Intronic
1020140176 7:5607543-5607565 TTGGGACACGCGGGGCGTCCCGG + Intergenic
1020476484 7:8601102-8601124 TTGGTATCCACAGGAGGTCCTGG + Intronic
1021184135 7:17543074-17543096 TTGGGACTCACAGTTAGACCCGG + Intergenic
1022452366 7:30526433-30526455 TTGTGAGCCACAGGTCCCCCTGG - Intronic
1023941947 7:44774295-44774317 TTGGTATCCACAGGAGGTCCTGG - Intergenic
1034226280 7:149486249-149486271 TTGGAACCCCCAGGCCCTCCTGG + Intronic
1038208681 8:25494556-25494578 TTGGTATCCACAGGAGGTCCTGG + Intronic
1052637510 9:31123254-31123276 ATGGGACCCAGAGGCCATCCAGG - Intergenic
1052704919 9:31983031-31983053 TTGGTATCCACAGGGTGTCCTGG + Intergenic
1052727299 9:32244713-32244735 TTGGGACCCAGAGATGGTGCAGG - Intergenic
1052996520 9:34554136-34554158 TTGGGACCCTCCGATCTTCCAGG - Intronic
1055183075 9:73413643-73413665 TTGAGATCCACAGGAGGTCCTGG - Intergenic
1057913052 9:99035083-99035105 ATGGGACCCCCAGGGCCTCCTGG + Exonic
1058691509 9:107524260-107524282 TTGAGACCCACAGGTCTACAAGG + Intergenic
1189794717 X:44635014-44635036 TTGGTACCCACAGGGCCTGCTGG - Intergenic
1199610294 X:149606910-149606932 TTGGTATCCACAGGGGGTCCTGG - Intronic