ID: 906036625

View in Genome Browser
Species Human (GRCh38)
Location 1:42754465-42754487
Sequence CTAGTGTTGTCCACTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 4, 3: 4, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906036625 Original CRISPR CTAGTGTTGTCCACTTCCAT AGG (reversed) Intronic