ID: 906036940

View in Genome Browser
Species Human (GRCh38)
Location 1:42756462-42756484
Sequence TCCAAGCAGCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 1, 2: 3, 3: 89, 4: 742}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906036933_906036940 -3 Left 906036933 1:42756442-42756464 CCCTAGGTGCCCTGCTAATCTCC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG 0: 1
1: 1
2: 3
3: 89
4: 742
906036931_906036940 13 Left 906036931 1:42756426-42756448 CCGGGGTCACATCTTTCCCTAGG 0: 1
1: 0
2: 2
3: 33
4: 159
Right 906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG 0: 1
1: 1
2: 3
3: 89
4: 742
906036934_906036940 -4 Left 906036934 1:42756443-42756465 CCTAGGTGCCCTGCTAATCTCCA 0: 1
1: 1
2: 0
3: 9
4: 144
Right 906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG 0: 1
1: 1
2: 3
3: 89
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906036940 Original CRISPR TCCAAGCAGCAGGAGGAGGA AGG Intronic
900038797 1:439841-439863 TCGGAGGAGCAGGAGGAGTAAGG + Intergenic
900125778 1:1068452-1068474 GGCGAGCAGGAGGAGGAGGAAGG - Intergenic
900345666 1:2209167-2209189 TGCATGCAGCAGGTGGGGGACGG - Intronic
900671745 1:3858683-3858705 GAGAAGCAACAGGAGGAGGAAGG - Intronic
900819941 1:4878963-4878985 TCCCAGCAGCTGATGGAGGATGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900923959 1:5691602-5691624 TCTGAGCAGGAGGAAGAGGAGGG - Intergenic
901060164 1:6468175-6468197 TGCCAGCAGCTGGAGGAGGCTGG + Exonic
901176477 1:7303054-7303076 TCCCAGCAGCACCAAGAGGAAGG - Intronic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901789746 1:11647939-11647961 TCCAAGCAGCTGGGGGAGGGTGG + Intergenic
901965612 1:12863565-12863587 CCCAAGCTGCAGGAGAAGGGGGG - Intronic
901981009 1:13033943-13033965 CCCAAGCTGCAGGAGAAGGGGGG - Intronic
902001078 1:13194987-13195009 CCCAAGCTGCAGGAGAAGGGGGG + Intergenic
902020309 1:13340691-13340713 CCCAAGCTGCAGGAGAAGGGGGG + Intergenic
902173497 1:14631705-14631727 TCCCAGCAGCTGAAGGATGAAGG - Intronic
902282496 1:15384625-15384647 TCCACCGAGCGGGAGGAGGAAGG + Intronic
902840367 1:19070395-19070417 TCCCAGCAGCACCAAGAGGATGG - Intergenic
902844722 1:19100888-19100910 TGAGACCAGCAGGAGGAGGAAGG - Intronic
902921080 1:19666226-19666248 GCCCAGCAGCAGGGGCAGGAAGG - Exonic
903384119 1:22915766-22915788 TCCACGTGGCAGGAGGAGGCAGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903489634 1:23718635-23718657 TCCAGGCAGCAGGAACAGCAAGG + Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904607128 1:31704106-31704128 GCCAGGGAGGAGGAGGAGGAGGG + Exonic
904648574 1:31987166-31987188 TTCTAGCAGCTGGGGGAGGAGGG + Intergenic
904832089 1:33311865-33311887 TCCAGGGAGGAGGAGAAGGATGG + Intronic
905212188 1:36381980-36382002 TCCTGGGGGCAGGAGGAGGATGG - Intronic
905488741 1:38327189-38327211 GCCAGGCAGCAGGAGGAGGTGGG + Intergenic
905525546 1:38635916-38635938 TCCAGTCAGCAGTAGGAAGATGG + Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906952804 1:50348502-50348524 TCCAAGCAGCACTTGGAGGGTGG - Intergenic
907046983 1:51305445-51305467 TCCAGGCAGAGGGAGCAGGAAGG - Intronic
907788582 1:57638481-57638503 TCTAAGCACTAGGAGAAGGATGG - Intronic
908293111 1:62687945-62687967 GCCGAGGAGCAGGAGGAGGCGGG + Intronic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
910132724 1:83927893-83927915 TCCACCCAGCTGGAGGAAGAAGG + Intronic
910430917 1:87159016-87159038 TCTCAGCAGCTGGAGGAGTAAGG - Intronic
911793040 1:102042619-102042641 ACCTAGCAGCAGGAGCAAGAAGG - Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
912496279 1:110094124-110094146 CCCAAGCAGGAAGATGAGGAAGG - Intergenic
912587888 1:110783450-110783472 ACCAAGCAGCAGCAGGAAAAGGG - Intergenic
912816480 1:112832823-112832845 TCCCAGAAGCAAGAGGAGGAAGG + Intergenic
913126160 1:115792414-115792436 TCCAAGCTGCTGGAAGAGCATGG - Intergenic
913219985 1:116651716-116651738 TCCAAGCAGTAGGCTAAGGAAGG + Intronic
913314133 1:117535838-117535860 TCCAAGCCGGAAGAGGATGATGG + Intergenic
914425014 1:147567772-147567794 TCCTAGCAGGGGGAGGGGGAAGG - Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914831842 1:151175994-151176016 TCCCAGCAGCAGGAGGAGCCCGG + Exonic
914851355 1:151316504-151316526 TCCAAGCTACAGGAAGAGGGAGG + Exonic
915101977 1:153507318-153507340 TGGAAGCACCAGGAGGAAGATGG - Intergenic
916034592 1:160910367-160910389 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
916846443 1:168655345-168655367 TCCAATCATCAGTAGGAGAACGG - Intergenic
916890738 1:169109907-169109929 TCCAAGCAGCAGTAGGCAAATGG - Intronic
917100609 1:171441390-171441412 TCCTAGCAGATGGAGGAGGCAGG + Intergenic
917617642 1:176762329-176762351 TCCATCCAGCAGGAGAAGCAAGG - Intronic
918139951 1:181711764-181711786 CCCAAGGAGCAGAAGGGGGAAGG + Intronic
918749699 1:188257601-188257623 ACCAATCAGCAGGACGAGGGTGG - Intergenic
919787580 1:201269657-201269679 TCCACCCAGCAGGAAGAAGAAGG + Intergenic
920658078 1:207891185-207891207 TGCACTCAGCAGGTGGAGGAAGG - Intronic
920920747 1:210295395-210295417 CCCAAGGAGGAGGTGGAGGAAGG - Intergenic
921003527 1:211069015-211069037 TTCTGGCAGCAGGAGGAGAAAGG + Intronic
921070462 1:211654134-211654156 TCCAGGCAGTGGGAGGAGGGGGG + Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921921613 1:220676331-220676353 CTCAAGCAGCAAGAGGAGGTGGG - Intergenic
921970964 1:221148731-221148753 TGCAACCAGCAAGAGAAGGAAGG - Intergenic
922543055 1:226433582-226433604 TCCCAGAAGCCGGAGGAGAAGGG - Intergenic
922700236 1:227755061-227755083 TCCAACCTTCAGGAGGAGGAGGG - Intronic
922742700 1:228023103-228023125 TCCAGGGAGCAGGAGGAGGAGGG - Intronic
923103719 1:230838072-230838094 TCCAGGCAGAAGGTGGAGGCAGG + Exonic
923390603 1:233511341-233511363 GCCAGGGGGCAGGAGGAGGAGGG + Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
923724644 1:236495561-236495583 TCGAGGCAGCAGGTGGAGGAGGG - Intergenic
924796692 1:247297723-247297745 GCCATGCAGCAGGAGCAGCAGGG - Exonic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1063318594 10:5032079-5032101 ACCAATCAGCAGGATGTGGATGG - Intronic
1063449121 10:6139775-6139797 TCCAAGAAGAGTGAGGAGGAGGG - Intergenic
1063769820 10:9184073-9184095 ACCAATCAGCAGGATGTGGATGG + Intergenic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1065214927 10:23439674-23439696 TCGAAGCAGGAGGAGAAGGCGGG - Exonic
1065589994 10:27253734-27253756 TCTGATCAGCAGGAGGAGGCGGG + Intergenic
1066446928 10:35492023-35492045 TCCAGGCAGGAAGGGGAGGATGG - Intronic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1068241027 10:54300830-54300852 ACCAATCAGCAGGATGTGGATGG + Intronic
1069047448 10:63758193-63758215 TCCAAGCTGCAAGGGGAGGCCGG - Intergenic
1070342996 10:75514668-75514690 ACAAAGGAGCAAGAGGAGGAGGG - Intronic
1070343004 10:75514707-75514729 TCCTAGCAGAAGGCGAAGGAGGG - Intronic
1070364530 10:75723491-75723513 GTCATGCAGCAGGAGAAGGAGGG + Intronic
1070724136 10:78776938-78776960 TCCCAGCATCAGAAAGAGGAAGG + Intergenic
1071037320 10:81264150-81264172 ACCAATCAGCAGGATGTGGATGG - Intergenic
1071055415 10:81503572-81503594 TCCAATCAGCAGGATGTGGGTGG + Intergenic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073299489 10:102462114-102462136 TTCCAGCCGGAGGAGGAGGATGG + Intronic
1073332119 10:102677110-102677132 TCCCAGGAGGAGGAGGAGGGAGG + Intronic
1073917055 10:108417776-108417798 TCCAGGGAAAAGGAGGAGGAAGG - Intergenic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1075631667 10:124004207-124004229 TGCCAGCAGCATGAGGAGGCCGG - Intergenic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1075732859 10:124646656-124646678 TCCCAGCAGCAGGAGGAGACTGG - Intronic
1076068092 10:127464700-127464722 TCATAGGAGCAGGAGGAGGATGG + Intergenic
1076671662 10:132124201-132124223 GCAAAGCAGCAGCAGAAGGACGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076965005 11:75752-75774 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1077201700 11:1310617-1310639 TCCCAAAAGCACGAGGAGGAAGG - Intergenic
1077271962 11:1685593-1685615 TCCTGGGAGCAGGAGGAGGGTGG - Intergenic
1077419161 11:2441507-2441529 TCCAAGGAGCTGAAGGGGGATGG - Intergenic
1077610142 11:3638967-3638989 TCAAAGCAGCTGAAGGAGGATGG + Intronic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1080612849 11:33919818-33919840 TCCCAGCAGTAGAAAGAGGAAGG - Intergenic
1081557475 11:44178771-44178793 TCTAGGCAGTAGGAGGAAGATGG - Intronic
1081766822 11:45617083-45617105 TCAAAGCACCATGTGGAGGATGG - Intergenic
1082768635 11:57188185-57188207 CCCAGGCAGCAGGCTGAGGATGG + Exonic
1082791348 11:57348438-57348460 TCACAGCAGGAGGAGGAGGCAGG - Intronic
1082912199 11:58390162-58390184 ACCAATCAGCAGGATGTGGATGG - Intergenic
1083150015 11:60785975-60785997 TGGAAGCACCAGGAGGAGGCTGG + Intronic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1083616345 11:64028414-64028436 TCCACGCTGCAGAGGGAGGAGGG + Intronic
1083975117 11:66112308-66112330 TCCAAGCAGCAGCAGAAGGCAGG - Intronic
1084072536 11:66745418-66745440 TCGAAGCAGCTGGACGTGGAAGG + Intronic
1084087394 11:66860839-66860861 ACTAAGCAACAGGAGGAGGTGGG + Intronic
1084174755 11:67417452-67417474 TCCAAGGACCTGGAGGAAGAGGG + Exonic
1084185083 11:67467316-67467338 CCCCAGCAGCAGGAGCAGGAAGG + Exonic
1084259249 11:67964003-67964025 ACCAATCAGCAGGATGTGGATGG + Intergenic
1084407314 11:68981836-68981858 TGCAAGCGGCAGGAGGAAAAAGG - Intergenic
1084517613 11:69645066-69645088 CCCAAGCAGGTGGAGGAGGTGGG - Intronic
1084687294 11:70704025-70704047 CCCCAGCAGCAGGAGTAGGGCGG - Intronic
1084693824 11:70742228-70742250 TGCCAGCAGAAGGAGGAGGAAGG - Intronic
1085328539 11:75627500-75627522 GCCAAACAGTAGGAGGAGGGAGG + Intronic
1086167150 11:83791854-83791876 CACAAGCTGGAGGAGGAGGAAGG - Intronic
1086484643 11:87285789-87285811 ACCAATCAGCAGGATGAGGGTGG - Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087328679 11:96753515-96753537 GCCAACCAGCAGTAGCAGGATGG - Intergenic
1087893988 11:103567186-103567208 TCCAACCAGCAGGAAGAAGAGGG - Intergenic
1087960235 11:104339406-104339428 ACCAATCAGCAGGATGTGGATGG + Intergenic
1087966415 11:104421765-104421787 ACCAATCAGCAGGATGTGGATGG - Intergenic
1088593158 11:111420440-111420462 ACCAAGGATCAGGAGGAAGAAGG + Intronic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089391337 11:118104070-118104092 CCCAAGCACCAGGGGGAAGAAGG - Intronic
1089499637 11:118924843-118924865 TCCTATCAGCCAGAGGAGGAGGG + Intronic
1089619245 11:119713118-119713140 TCCAAGCAGCCTGTGGGGGAGGG + Intronic
1089677050 11:120097127-120097149 CCCTCGCAGCAGGAGGGGGAAGG + Intergenic
1089682784 11:120128783-120128805 TCCACCCAGCAAGAGCAGGAGGG + Intronic
1089757246 11:120695929-120695951 TCCATGGACCAGTAGGAGGAGGG + Intronic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1089806296 11:121093797-121093819 TCTGATCAGCAGGAGGAGGCAGG - Intergenic
1090144854 11:124310668-124310690 TCCCAGGAACAGGAGGAAGAGGG + Exonic
1090424381 11:126596940-126596962 TTAAAGCAGCAGGAGGAAGCAGG + Intronic
1090993895 11:131847491-131847513 GCCAACCTGCAGGAGGAGGCAGG + Intronic
1091305886 11:134535833-134535855 TAAGAGCAGCAGGAGGAGCACGG - Intergenic
1091333341 11:134748413-134748435 TCCAAGCAGATGGGGGAGGAGGG + Intergenic
1091385904 12:94497-94519 CCCAAGGAGCAGGAGGTGGATGG + Intronic
1091391072 12:126238-126260 TCTAAGCAGCAGATGGAGGTGGG - Intronic
1091789932 12:3266219-3266241 TCCCAGCAGCAGGAGGTGGTGGG + Intronic
1092260478 12:6951045-6951067 TAAAAGCAGCTGGTGGAGGAGGG + Intronic
1092957996 12:13567725-13567747 TCCAGGCAGCAGGAATAGTATGG + Intronic
1093108348 12:15117467-15117489 TCCAAGCAGCAGGAGTTGTAAGG + Intronic
1094320923 12:29182324-29182346 ACCAATCAGCAGGATGTGGAAGG - Intronic
1094339639 12:29396512-29396534 TCCAAGCAGGGAGAAGAGGAAGG - Intergenic
1094535683 12:31320816-31320838 TTCAAGCAGGAGCAGGGGGAAGG + Intronic
1095265112 12:40147267-40147289 TCCAAGCAGCTGGGGGAGAAAGG - Intergenic
1095536913 12:43260259-43260281 GAAAAGCAGCAGGAGGAGAAGGG + Intergenic
1095842533 12:46709874-46709896 TCCCAGCAGAAGAGGGAGGAGGG + Intergenic
1095952972 12:47791479-47791501 TCCAGGGTGCAGGAGGAGGCTGG + Intronic
1096143231 12:49259854-49259876 TCCTGGGAGCAGGAGGAGGCAGG + Intronic
1096279733 12:50242471-50242493 TCCAGGAAACAGGAGGAGGCCGG - Intronic
1096492476 12:52020374-52020396 GCCAGGGAGCAGTAGGAGGAGGG + Intergenic
1096745183 12:53722185-53722207 TACAGGCAGCAGAAGGAGAAGGG + Intronic
1097321790 12:58233733-58233755 TCCAAGGGGCATGAGGAGTAAGG + Intergenic
1097957005 12:65496510-65496532 ACCAAACAACAGGAGGAGGAAGG + Intergenic
1098065808 12:66614856-66614878 TCCAGGCAGAAGGAGTAGCAAGG - Intronic
1098891232 12:76012272-76012294 ACCAAGGAGAAGGTGGAGGAAGG + Intergenic
1099559504 12:84154758-84154780 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1100037506 12:90270901-90270923 AAAAAGCAGCAGGAGAAGGAAGG - Intergenic
1100195374 12:92239099-92239121 TCCAGGTAGAAGGAAGAGGAAGG - Intergenic
1100860698 12:98803374-98803396 TCCAGGGAGCGGGAGAAGGAGGG - Intronic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101446605 12:104741281-104741303 TCCAGGCAGGGGTAGGAGGAGGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101923913 12:108955594-108955616 CCCAAGTGGCAGGAGGAGGCTGG + Intronic
1102167208 12:110816110-110816132 TCCAGGCAGCAAGGGAAGGAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102614541 12:114141979-114142001 TCCAAGAAGCATGAGAATGAAGG - Intergenic
1102766988 12:115442270-115442292 TGCAACCAGCAGGAAGAGCATGG + Intergenic
1102893914 12:116583060-116583082 TCAAAGAAGGAGGAGGAGGGTGG + Intergenic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103324654 12:120112334-120112356 CCCAGGCAGGAGCAGGAGGAAGG - Intronic
1103558883 12:121781799-121781821 TGCAAGCACTAGGAGGAGGGTGG + Exonic
1103793823 12:123490043-123490065 TCCAGGCAGGAGAAGGAGAAAGG - Intronic
1103921928 12:124403673-124403695 TCCAAGCAGATGGAAGAGGAGGG + Intronic
1103973547 12:124687592-124687614 TGCAGGCAGCTGGAGGAAGAGGG - Intergenic
1104021407 12:124994455-124994477 TCAAAGCAGGAGGAGGAGTGGGG - Intronic
1104088088 12:125493873-125493895 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088141 12:125494040-125494062 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088162 12:125494108-125494130 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088184 12:125494177-125494199 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088219 12:125494280-125494302 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088362 12:125494707-125494729 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088406 12:125494828-125494850 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088420 12:125494862-125494884 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088454 12:125494964-125494986 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088565 12:125495307-125495329 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104093911 12:125538821-125538843 TCCGAGCAGCAGGGTGATGATGG - Intronic
1104350256 12:128039105-128039127 TCCCAGGATCAGGAGGAGGTAGG - Intergenic
1104480431 12:129103172-129103194 TCCAGGCTGGAGGAAGAGGAGGG + Intronic
1105038573 12:132944157-132944179 TCCGGAAAGCAGGAGGAGGAAGG - Intronic
1105274553 13:18906954-18906976 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1105283187 13:18981777-18981799 GCCAGGGAGCAGAAGGAGGATGG + Intergenic
1105592976 13:21811541-21811563 TCAGGGCAGGAGGAGGAGGAGGG + Intergenic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106099109 13:26679254-26679276 AGCAGGCAGGAGGAGGAGGAGGG - Intronic
1106234933 13:27853561-27853583 TCCAGCCAGCGGGAGGAGAAGGG + Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1107170216 13:37332401-37332423 ACCAAACAGCAGGACGAGGGTGG + Intergenic
1107182034 13:37472312-37472334 ACCAATCAGCAGGAGGTGGCTGG - Intergenic
1107362612 13:39636671-39636693 ACAAAGGAGAAGGAGGAGGAGGG - Intergenic
1107765698 13:43732123-43732145 GCCAAGTAGGAGGAGGAGTAAGG - Intronic
1107790934 13:44001666-44001688 ACCAATCAGCAGGATGTGGATGG + Intergenic
1108021898 13:46136177-46136199 TCCCAGAAGCAGGAGGCAGAAGG - Intronic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108729770 13:53222738-53222760 GACCAGTAGCAGGAGGAGGATGG + Intergenic
1109145518 13:58774049-58774071 ACCAATCAGCAGGATGTGGATGG + Intergenic
1110391664 13:74981606-74981628 TCCAAGCAGAGGCAGGAAGAAGG - Intergenic
1110405056 13:75141735-75141757 TCCAAGCAGAGGGAATAGGAAGG + Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110751281 13:79119270-79119292 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1110940163 13:81340365-81340387 ACCAATCAGCAGGATGTGGATGG - Intergenic
1112191488 13:97182297-97182319 TCAAAGCAGCAGGTGGACGAAGG + Intergenic
1112302100 13:98239894-98239916 TCCCAGCAGGTGAAGGAGGAGGG + Intronic
1112391279 13:98986636-98986658 TCTAGGCAGCAGGATGAGAAAGG - Intronic
1112624444 13:101088010-101088032 ACCAAGCAGAAAGAGGAAGAAGG - Intronic
1113254746 13:108495313-108495335 TCCTGGGAGCAGGAGGAGAAGGG - Intergenic
1113886124 13:113659131-113659153 TCCGAGCACCAGGACGTGGAGGG + Intergenic
1114458492 14:22872317-22872339 ACCAAGGAGGAGGAGGAGGAGGG - Exonic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1115060736 14:29186843-29186865 ACCAATCAGCAGGATGTGGACGG + Intergenic
1115717579 14:36123370-36123392 TCCAAGCTACAGGAGGAAGTTGG - Intergenic
1116151995 14:41153816-41153838 ACCAAGCAGCAGGATGTGGGGGG - Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1117183506 14:53216866-53216888 ACCAATCAGCAGGATGTGGATGG - Intergenic
1117732855 14:58741117-58741139 TCAAAGCAGGAGGGGGAAGAGGG + Intergenic
1118101788 14:62614082-62614104 TCCAGGAACCAGCAGGAGGAAGG + Intergenic
1118468645 14:66054683-66054705 TCAGAGCAGCAGGAAGAGAAAGG - Intergenic
1118807424 14:69250336-69250358 TCTAGGGAGCAGCAGGAGGATGG - Intergenic
1119408036 14:74410948-74410970 TCAAAGCAGCTGAAGGAGGAAGG - Intronic
1119495813 14:75077944-75077966 GCTAAGCAGCAGGAGGCAGAAGG + Exonic
1119674880 14:76546222-76546244 GCCAACCAGCAGGAGGTGGAGGG - Intergenic
1119756850 14:77125593-77125615 CACCAGCAGCAGGAGAAGGACGG - Intronic
1120637335 14:86968300-86968322 TCCTTACAGCAGGAGGAAGATGG - Intergenic
1121078371 14:91088036-91088058 TCCAAGGAGGAGGAGGAGCTGGG + Intronic
1121126003 14:91407089-91407111 CCCACCCAACAGGAGGAGGACGG + Intronic
1121518449 14:94569619-94569641 TCCAAGCAGGAGGATGTGGCAGG + Exonic
1121552738 14:94814643-94814665 TCCCAGCAGCATGAGGATGGAGG + Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1122324038 14:100872039-100872061 TCCATGGAACAGGAGGTGGAAGG - Intergenic
1122357385 14:101131892-101131914 CCTAAGCAGAAGTAGGAGGAGGG - Intergenic
1122771701 14:104100598-104100620 TCCAGGGAGCAGCAGGAAGAAGG - Intronic
1122807795 14:104269339-104269361 TCCAAGCAGAAGGATTCGGAAGG - Intergenic
1123028469 14:105439583-105439605 TCCAACCAGGAGGAGGAGAAGGG - Intronic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124604036 15:31157648-31157670 TCCAAGCAGCAGGCTGCTGAGGG + Intronic
1124706844 15:31973676-31973698 CCCAAGCAGCAAGAGAAGGAAGG + Intergenic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1124955817 15:34359662-34359684 ACCCAGCAGCAGGTGCAGGATGG + Exonic
1125560666 15:40630485-40630507 GCCAAACAGCAGGAGGTGAATGG + Intronic
1126038534 15:44569596-44569618 GCCAAGCTCCAGGAGGAGAAGGG + Intronic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1126482557 15:49142177-49142199 TCAAAGCAGTAGGAGTAGAAAGG + Intronic
1126897357 15:53273273-53273295 CCAAAGCACCAGGAGAAGGAGGG - Intergenic
1126944868 15:53808553-53808575 TCCCAGCTGCAAGAGGAGGTAGG - Intergenic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127730967 15:61801660-61801682 TCCTGGAAGCATGAGGAGGAGGG - Intergenic
1127843691 15:62851167-62851189 TCGAAGCAGCAGTAGCAGCAGGG + Intergenic
1128145529 15:65330581-65330603 TCCAGGCAGCAGGATGGGGCCGG + Exonic
1128304874 15:66591809-66591831 GCCAGGCAGCAGCAGGAAGAGGG - Intronic
1129255174 15:74330300-74330322 GCCCAGCAGGAGGAGGAAGAGGG + Exonic
1129450497 15:75648547-75648569 GCCCAGGAGCAAGAGGAGGAAGG + Exonic
1129672635 15:77615811-77615833 GCCCAGCACCAGCAGGAGGATGG + Exonic
1130305335 15:82709444-82709466 TCCAGGCCGCAGGAGGGGGCCGG + Intronic
1130520435 15:84657460-84657482 TGGAAGCACCAAGAGGAGGAAGG - Intronic
1130943718 15:88534427-88534449 TTCAAGCAGCAGGAGAACCAGGG - Intronic
1131082280 15:89546710-89546732 TCCAAGCAGAAAGAGCAGTATGG - Intergenic
1131546864 15:93322832-93322854 TCCAAGCAGCGGAAGTAGCATGG - Intergenic
1132087852 15:98922688-98922710 ACCAAGTAGCAGGTGGAGGGTGG - Intronic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1132240267 15:100252483-100252505 GCCAGGAAGCAGGAGGAGCACGG + Intronic
1132352131 15:101146438-101146460 TCCAGGCAGGAAGAAGAGGAAGG - Intergenic
1132353157 15:101153106-101153128 CCCAGACAGCTGGAGGAGGAAGG - Intergenic
1132443117 15:101887764-101887786 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1132570535 16:642122-642144 CCCACGCAGCAGCAGGTGGAGGG + Exonic
1133191924 16:4140130-4140152 TCCAGGCAGAAAGAAGAGGAAGG - Intergenic
1134212467 16:12289245-12289267 CCCATGCAGCAGGAGGAGAAGGG + Intronic
1135196583 16:20399732-20399754 TTCAAGCAGGAGCTGGAGGAGGG - Intronic
1135414459 16:22258142-22258164 TCCAAGTAGCAATGGGAGGATGG - Intronic
1135920628 16:26645909-26645931 TCCAGGCAGCAGCGGGAGAAGGG + Intergenic
1136357854 16:29758007-29758029 TCCAACCAGTGGGTGGAGGATGG - Intergenic
1136366523 16:29811688-29811710 TCCAAGGGGCAGGAGGAGCTGGG - Intronic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137949646 16:52771493-52771515 TGCCAGCCACAGGAGGAGGAGGG + Intergenic
1138341877 16:56295378-56295400 TCCCAGCAGCACAAGGAGGTAGG - Intronic
1138348685 16:56335136-56335158 TCCAAGGAGGAGGAGGAGGTGGG + Intronic
1138435029 16:56993578-56993600 TCCCACCAGCTGGAGGGGGAGGG + Intronic
1138743172 16:59334014-59334036 ACCAATCAGCAGGATGTGGATGG - Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139760866 16:69183930-69183952 TCCATGAAGCTGGAGGAGGTGGG + Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140219392 16:73032974-73032996 GCCAGGCAGCAGGAGCAGGATGG + Intronic
1140334742 16:74094771-74094793 TCCAGGCAGAAGGAGCAGCAAGG - Intergenic
1141163986 16:81648034-81648056 TGGAAGCAGCAGGGGGAGGGTGG - Intronic
1141609622 16:85174049-85174071 TCCAGGCAGCTGGTGGAAGAGGG - Intronic
1141660261 16:85437551-85437573 ACCAAGGAGAAGGACGAGGAGGG + Intergenic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1141877311 16:86834715-86834737 TCTAAGCTGCAGGAGGACAAGGG + Intergenic
1141946623 16:87315212-87315234 TCCAAGCTGCAGTAGGAGCTGGG - Intronic
1142621305 17:1167231-1167253 TCCAAGCAGGAGGTGGAGCTGGG - Intronic
1142967529 17:3590703-3590725 TCCAGTCAGCAGGGGGAGGCAGG + Intronic
1143215822 17:5224086-5224108 GACATGCAGCAGGAGGGGGAAGG + Intronic
1143491751 17:7289270-7289292 TCCAGGCAGCAAGTGGGGGATGG + Intronic
1143769349 17:9158150-9158172 TCCAAGAAGCAGGGGAGGGAAGG + Intronic
1143942456 17:10556778-10556800 TACAGGCATCAGCAGGAGGAAGG - Intergenic
1144324472 17:14165532-14165554 TCCAAGGAGCAGGAGAGAGATGG - Intronic
1144778201 17:17795376-17795398 TTCAAGCAGGAGGAGGTGGGTGG + Exonic
1145247552 17:21279680-21279702 TTCAAGCAGCAGGAGTCGTATGG + Intergenic
1145916428 17:28576715-28576737 CCCAGGTAGCAGGACGAGGATGG + Intronic
1145917150 17:28581401-28581423 CCCAGGTAGCAGGACGAGGATGG - Intronic
1146635487 17:34501310-34501332 CCCCTGCAGCAGCAGGAGGAAGG + Intergenic
1146664059 17:34685185-34685207 TCCAAGAAGGAGGGGGAGGAGGG - Intergenic
1146956539 17:36939369-36939391 ACCAGGGAGCAGGAGGAAGAGGG + Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147317861 17:39629392-39629414 TCCCAGCCGCAGGAGGGAGAGGG + Intronic
1147904598 17:43814481-43814503 TTCCAGTAGCAGGAGGAGGTTGG - Intronic
1147917981 17:43900115-43900137 GGCAGGGAGCAGGAGGAGGAAGG - Intronic
1148436943 17:47692733-47692755 ACCCAGCAGGAGGAGGAGGAAGG + Intergenic
1148716157 17:49717628-49717650 GCCAGGCTCCAGGAGGAGGAGGG + Exonic
1148899396 17:50865521-50865543 TCCTCGGAGAAGGAGGAGGAAGG + Intronic
1148969907 17:51470688-51470710 ACCAATCACTAGGAGGAGGAGGG + Intergenic
1149055989 17:52366494-52366516 TCCAAGCAGAAGGAAGAGAATGG + Intergenic
1149525089 17:57349183-57349205 TCCCAGTAACAGGAGAAGGAAGG - Intronic
1150653519 17:67024899-67024921 GCCACCCAGCAGGAGCAGGATGG - Exonic
1150778415 17:68100164-68100186 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1151382209 17:73733706-73733728 TGCAAGCAGCAGTGGGAAGAAGG - Intergenic
1151515510 17:74592497-74592519 GCCAAGGAGCAGGAGGAGCCAGG + Exonic
1151987356 17:77552549-77552571 TCCAAGAGGAAGGAGGAGCATGG - Intergenic
1152008683 17:77697612-77697634 CCCAGGCAGCTGGGGGAGGAGGG + Intergenic
1152010421 17:77709816-77709838 TCCAAGGAGCAGCAGGAGAGAGG + Intergenic
1152021947 17:77784414-77784436 TCCAAGCAGATGGAGGAGCTAGG + Intergenic
1152373078 17:79902541-79902563 TCCAGGAAGCAGGGGGTGGAAGG - Intergenic
1152418082 17:80175874-80175896 GCCAGGAAGCAGGAGGAGGGTGG - Intronic
1152606947 17:81296119-81296141 TCCAGGCTGCTGGGGGAGGACGG + Intergenic
1152807255 17:82362010-82362032 GACAAGGAGCAGGAGGAGAAAGG - Exonic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1153003950 18:480920-480942 CCCAAGCAGCAGGAGCAGCCAGG - Intronic
1153449074 18:5206381-5206403 TCCAGGCAGGAGGAAGAGCATGG - Intergenic
1153712450 18:7813542-7813564 TCCAAGCAGGATGAATAGGAAGG - Intronic
1153854928 18:9136610-9136632 ACCAAGCGGCAGGCGGCGGAGGG - Intronic
1154466238 18:14644203-14644225 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1155185569 18:23383874-23383896 TCCAAGGAGCGGCAGGATGATGG + Intronic
1155206197 18:23560331-23560353 TCCAGGGAGCAGGAGGAGGTGGG + Exonic
1155824266 18:30419532-30419554 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
1155928709 18:31684751-31684773 GCCAAGCAGCGGCGGGAGGAGGG + Intronic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1156113040 18:33750485-33750507 TCCATGAAGCAGGGGAAGGAGGG - Exonic
1156298087 18:35810642-35810664 TCCAGGCATCAGCAGGGGGAGGG + Intergenic
1156460362 18:37318279-37318301 GATAAGCGGCAGGAGGAGGAGGG - Intronic
1156523791 18:37746892-37746914 GCCAAGCAGCTGGAGGTGGTGGG + Intergenic
1157224483 18:45850078-45850100 TCCTGGGAGCAGGAGGAGGCAGG - Exonic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157304478 18:46507231-46507253 GCCAGGCAGCAGAAGGAAGATGG + Intronic
1157513610 18:48295813-48295835 GCCCAGCAGCAGCAGGAGGGGGG + Intronic
1157565537 18:48676771-48676793 GCCAAGCAGAAGAACGAGGAAGG - Intronic
1157692337 18:49693686-49693708 TCCAGGCAGCAGGGAGAGGCAGG + Intergenic
1157818457 18:50748381-50748403 TTCAAGCAGTAGGAGGAGGCAGG - Intergenic
1158568306 18:58574545-58574567 GCCACGCAGCAGGAGGTGGGTGG + Intronic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159167829 18:64725233-64725255 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1159260352 18:66005334-66005356 ACCAATCAGCAGGATGTGGATGG - Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1159704170 18:71666066-71666088 TGCCAGCAGAAGGATGAGGAGGG + Intergenic
1159951264 18:74486121-74486143 AGCAAGCAGCAGGAGGCAGAAGG - Intergenic
1160476141 18:79190036-79190058 TCCCCGCAGCAGCAGCAGGAGGG + Intronic
1160511518 18:79455902-79455924 TCCACACAGCAGCAGGCGGAGGG + Intronic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1160641810 19:145382-145404 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1161466272 19:4432370-4432392 CCCTAGCAGCAGGACGAGGCAGG + Intronic
1161633012 19:5368696-5368718 TGCTAGGAGCATGAGGAGGATGG - Intergenic
1162792047 19:13068259-13068281 TGCAAACAGCAGAAGGAAGAGGG + Intronic
1163104764 19:15116795-15116817 CCCAGGCAGAAGGAGGTGGAGGG - Intronic
1163286606 19:16352343-16352365 CCCGAGGAGGAGGAGGAGGAAGG - Intergenic
1163575509 19:18109108-18109130 TCCAAGCAGCAGGAACAGCTTGG + Intronic
1163759839 19:19130208-19130230 GGCCAGCAGCAGGAAGAGGAAGG + Exonic
1164240648 19:23385217-23385239 ATCAAGCTGCAGGGGGAGGAGGG - Intronic
1164411376 19:28008610-28008632 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1164570073 19:29367861-29367883 TTAAAGCAGAAGGAGGAGGCGGG - Intergenic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1164840271 19:31387901-31387923 TCCAGGCGACAGGAGGAGGTGGG - Intergenic
1165761563 19:38324537-38324559 TCCAGCCAGCAAGAGGAGGGAGG + Intronic
1165893284 19:39127335-39127357 TCCCAGCAGAAGGAACAGGAAGG - Intronic
1165925989 19:39326683-39326705 ACCAAGGAGGACGAGGAGGAGGG + Intergenic
1166348641 19:42182869-42182891 TCCAAAGACCAGGAGGAGGCTGG + Intronic
1166567932 19:43776447-43776469 TCAGATCAGGAGGAGGAGGAGGG + Intronic
1166649617 19:44562876-44562898 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1166671959 19:44715726-44715748 AACAAGCAGCACTAGGAGGATGG + Intergenic
1166944687 19:46389814-46389836 TGCAGGAAGCAGGAGCAGGAAGG - Intronic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167790579 19:51676589-51676611 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1168135798 19:54350506-54350528 TCCAAATAGGAGAAGGAGGAGGG + Intergenic
925141713 2:1555075-1555097 TCCAGGCAGAAGCAGGAGGTCGG + Intergenic
925530173 2:4850541-4850563 TCAAGGCAGCCGGAGGAGGCAGG + Intergenic
925930930 2:8707276-8707298 TCCAGGCTGAAGCAGGAGGATGG - Intergenic
927137305 2:20106357-20106379 TCCAATCAGCAGGATGTGGGTGG - Intergenic
927743898 2:25598200-25598222 TCCAGGTAGAAGAAGGAGGAAGG - Intronic
928097685 2:28414499-28414521 TCCAAGCAGCAGAATGAGCCAGG + Exonic
928311837 2:30217716-30217738 GCCCAGCAGGAGGTGGAGGAGGG + Intergenic
928493194 2:31804406-31804428 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
928641287 2:33302587-33302609 TCCCAGCAGCAGGAGGATATGGG - Intronic
928645832 2:33351783-33351805 TCCAAGATGCAGGAGGATGCAGG - Intronic
929949320 2:46394070-46394092 TCTAAGCAGGAGGAGGTGGACGG + Intergenic
930700743 2:54456465-54456487 GCCGAGGAGCGGGAGGAGGACGG + Exonic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931442391 2:62299444-62299466 TGCCAGGAGGAGGAGGAGGAGGG + Intergenic
931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG + Intronic
932169734 2:69543059-69543081 TCCAGGGAGCAGGAAGAAGATGG + Intronic
932388316 2:71359369-71359391 TCCAAGAACAAGGAGGAGAAGGG + Intronic
932983397 2:76697959-76697981 ACCAATCAGCAGGATGTGGATGG - Intergenic
933548872 2:83749025-83749047 ACCAATCAGCAGGATGTGGATGG + Intergenic
933632244 2:84671645-84671667 GCCAAGCAGCAGGAAGGGGTGGG - Intronic
935148951 2:100417017-100417039 TCCAAGGAGCATGCAGAGGAAGG - Intronic
936012006 2:108930909-108930931 TCCAACCATCATGAGGATGAGGG + Intronic
936108467 2:109645748-109645770 TCCAAGCAGCTCTAGGAGGTAGG - Intergenic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
936388368 2:112050880-112050902 TCTAAGAAGGAGGAGGAGGAAGG - Intergenic
937216654 2:120317447-120317469 TGGAAGCAGCAGGTGGAGGTGGG + Intergenic
938146010 2:128835443-128835465 GCCAAGCAGCAGCAGGAGAGGGG - Intergenic
938197003 2:129337257-129337279 TTTAACCAGCAGGTGGAGGATGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938653593 2:133408640-133408662 TCCCACCAGCAGGAGTAGGAGGG - Intronic
939095319 2:137827352-137827374 TCCAGGTACCAAGAGGAGGATGG + Intergenic
939229863 2:139410898-139410920 ACCAATCAGCAGGATGTGGATGG + Intergenic
940253720 2:151707508-151707530 TACAAGTAGGAGGAGGAGGATGG + Intronic
941526412 2:166611525-166611547 ACCAATCAGCAGGATGTGGATGG - Intergenic
942199454 2:173556371-173556393 TGCAAACAGGAGGAGGAGGAAGG - Intergenic
942342641 2:174964337-174964359 TCCTAGAACCAGGAGGAGAAAGG + Intronic
942560147 2:177211376-177211398 TCAAAGCAACAGGAGGAGTCTGG + Intergenic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
944544417 2:200784818-200784840 TCCAAGGAGAAGGAAGAGCATGG - Intergenic
945080100 2:206079835-206079857 TCCCAGGAGTTGGAGGAGGAGGG - Intronic
945234836 2:207624845-207624867 TCGAAGCAGCCGATGGAGGAGGG - Intronic
945451717 2:210002411-210002433 TCCAAACAGCACAAGAAGGAAGG + Intergenic
945930819 2:215853302-215853324 TCCAAGCAGTGGGAGAAGGGTGG + Intergenic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947399052 2:229714349-229714371 TCCGAGCAGCAGCAGCAGCAGGG + Exonic
947622685 2:231600928-231600950 TCCCAGCGGCTGGAGGAGCAAGG - Intergenic
947831653 2:233145832-233145854 ACCATGCAGCAGGTGTAGGAGGG + Intronic
947910965 2:233800436-233800458 TCCAGGCAACTGGAAGAGGAAGG - Intronic
948257841 2:236580921-236580943 CCCCAGCAGCAGGAAGAAGATGG + Exonic
948502773 2:238407106-238407128 CCCGAGGAGGAGGAGGAGGAGGG + Intergenic
948770970 2:240251085-240251107 CCCAAGCAGCCGGCGGAGAAGGG + Intergenic
948901426 2:240958585-240958607 TCCAGGCAGCAGCAGGCGGCTGG - Intronic
1168734708 20:122013-122035 TCCAAACAGGAGGAAGTGGAAGG - Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168865816 20:1085618-1085640 TCCAGGCAGGAGGAGGAGGTAGG + Intergenic
1169200197 20:3705537-3705559 TCGAAGCAGTAGGAGGTGGAGGG + Intronic
1169680555 20:8207904-8207926 TAAAAGCTGCAGGAGGAGAAAGG - Intronic
1170978852 20:21192053-21192075 TCCAAGGAGCAGGATCAGGACGG + Intronic
1171271707 20:23823438-23823460 TCCAACCAGGAGGAGGGGGCTGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171370190 20:24657406-24657428 TCAGACCAGCAGGAGGCGGAGGG + Intronic
1172298861 20:33833703-33833725 TCCAAGCAGCAGGAAAAGAGAGG - Intronic
1172604256 20:36204000-36204022 TCCTGGCAGCAGGAGGGGGAAGG - Intronic
1172624079 20:36337431-36337453 TCCAAGCAGCTGGGGAAGGCGGG + Intronic
1173236171 20:41247662-41247684 TACAAGCCACAGGAGAAGGATGG - Intronic
1173381999 20:42553833-42553855 ACCAAGCAGCAGTAGCAGGATGG + Intronic
1174386686 20:50191583-50191605 TGCAAGCGGAAGGAGGAGGCCGG + Exonic
1174703837 20:52635967-52635989 TCCAGGCAGCAGAAAGAGAAAGG - Intergenic
1174761481 20:53210868-53210890 TCCAGGCAGCAGGATGACAAAGG + Intronic
1175183490 20:57164850-57164872 TCCCAGGACGAGGAGGAGGAAGG + Intergenic
1175264216 20:57692730-57692752 TCCAGGCAAGAGGAGGTGGACGG - Intronic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1175995966 20:62812534-62812556 TCCAGGAAGGTGGAGGAGGAAGG + Exonic
1176070543 20:63224054-63224076 TCCACGCAGCAGAGGGAGCAGGG - Intergenic
1176085347 20:63293258-63293280 TCCCAGGAGTAGGAGGAGGTGGG + Exonic
1176131926 20:63499828-63499850 TCCCAGCAGCAGCCGGAGGTCGG - Intergenic
1176215812 20:63947241-63947263 TCCACACAGCAGGATGAGCATGG - Intronic
1176219714 20:63964157-63964179 TCCAAGAAGCAGGAGGGGCCAGG - Exonic
1176385576 21:6137346-6137368 TCCGGGCAGCCTGAGGAGGAGGG - Intergenic
1176519137 21:7811985-7812007 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1176660400 21:9629736-9629758 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1176808350 21:13514393-13514415 CCCAGGCACCAGCAGGAGGAGGG + Intergenic
1177371128 21:20205169-20205191 ACCAATCAGCAGGATGTGGATGG + Intergenic
1177637751 21:23807832-23807854 TCCAATCAGCAGGACGTGGGTGG + Intergenic
1178166875 21:29988568-29988590 TCAGAGCAGCAGGAATAGGAGGG + Intergenic
1178653165 21:34441998-34442020 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1179057092 21:37946206-37946228 GCCAAGCAGCAGGAGGTGAGTGG + Intergenic
1179586521 21:42376952-42376974 TCCAAAGAGGAGGAGGAGTAGGG + Intronic
1179737897 21:43400906-43400928 TCCGGGCAGCCTGAGGAGGAGGG + Intergenic
1179781188 21:43702137-43702159 ACCAGGCAGCAGGGGAAGGAAGG + Intergenic
1180141554 21:45896337-45896359 TCCATGCATCAGCAGGCGGATGG - Exonic
1181181484 22:21071489-21071511 GCCAAGCAGCAGCAGCAGCAGGG + Intergenic
1181235603 22:21446078-21446100 TGCAAGGAGGAGGAGGAGAACGG + Exonic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1181533437 22:23530079-23530101 TACAAGTACCATGAGGAGGAAGG + Intergenic
1181619325 22:24077751-24077773 CCCAATCAGCATAAGGAGGATGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1182018458 22:27060783-27060805 TCCAAGCAGGGGGACAAGGATGG + Intergenic
1182307648 22:29381889-29381911 TCCAAGCAGAAGGATCAGCAAGG - Intronic
1182442406 22:30372083-30372105 GCCCAGCAGCTGCAGGAGGAAGG + Exonic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183147533 22:36008342-36008364 TCCAAGCAAAAGAAGGGGGAGGG + Intronic
1183248435 22:36711429-36711451 GCAAAGCAGGAAGAGGAGGAAGG + Intergenic
1183850768 22:40585395-40585417 TCCAGGGGGAAGGAGGAGGAGGG + Intronic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1183940001 22:41288668-41288690 TCCTATCAGCTGGATGAGGACGG - Intergenic
1184048268 22:41985956-41985978 GCAAAGCAGGAGGAGGAGGTAGG - Intronic
1184235780 22:43182330-43182352 TCCCAGCTGGAGGAGGAGGCGGG + Intronic
1184629615 22:45765540-45765562 GCCAAGGTGCAGGTGGAGGAGGG - Intronic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1184712762 22:46262876-46262898 TCCGAGCAGCCGCAGGCGGAAGG + Exonic
1184782802 22:46657551-46657573 TCCAGGCAGAGGGAGGAGGCAGG - Intronic
1184821305 22:46910874-46910896 TCCAGGCAGCGGTAGGAGTACGG + Intronic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1184981215 22:48097150-48097172 TCCAGGCAGCAGGAGTGGCAGGG - Intergenic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
1185373200 22:50470229-50470251 ACGAGGCAGCAGGTGGAGGAAGG + Intronic
949535225 3:4989916-4989938 TCCAAGCAGGAGAAGAAGGAGGG + Intergenic
949562764 3:5218047-5218069 TTCCAGGAGCATGAGGAGGAAGG - Exonic
949829455 3:8198332-8198354 ACCAACTAGCAGGAGGGGGAAGG - Intergenic
950170065 3:10832914-10832936 TCCAAGCTGCTGAAGTAGGAAGG + Intronic
950439907 3:13004530-13004552 TCCAAGGAGAGGGAGGAGGGAGG - Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950669384 3:14517024-14517046 TACAAGCAGCCCAAGGAGGAGGG + Intronic
950712724 3:14824425-14824447 GACAAGTAGCAGGCGGAGGAAGG - Intronic
950866220 3:16191241-16191263 TTCCCGCAGCAGGAGGAAGAAGG - Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952740342 3:36728545-36728567 TCCCAGGAGGAGGGGGAGGAGGG - Intronic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
953606788 3:44417698-44417720 ACCCAGCAGCTGGGGGAGGAAGG + Intergenic
953721178 3:45356542-45356564 TCCAAGCGACAGAAAGAGGAAGG + Intergenic
953836266 3:46347940-46347962 TCCAAGAAGTAGGAGTAGGAAGG - Intergenic
953847744 3:46441825-46441847 TCCAAACTGCAGCAGGAAGATGG + Intronic
954249510 3:49357360-49357382 GCCAAGCAGCCGGGGTAGGAGGG + Exonic
955108535 3:55924619-55924641 TCCAAGCAGAAGGTGGAGTGAGG + Intronic
955154017 3:56397906-56397928 TCCAGGCAGCAGAAGAAGGGGGG + Intronic
955352052 3:58200900-58200922 TCCAGGGAGGGGGAGGAGGAAGG - Intronic
955423924 3:58768074-58768096 TCCAAGGAGAAGGGGGAGGAGGG - Intronic
956179253 3:66501647-66501669 TCCAGGCTGCTCGAGGAGGAAGG - Intergenic
956290577 3:67655568-67655590 ACCAATCAGCAGGATGAGGGTGG + Intergenic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
958932028 3:100217458-100217480 TCCAAGAAGTAGGAGGAGGGTGG + Intergenic
959918662 3:111847054-111847076 TCCTTGCAGGAAGAGGAGGAAGG + Intronic
960047388 3:113211478-113211500 TGCGAGGAGGAGGAGGAGGAGGG - Exonic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961077585 3:123996337-123996359 TCCAAGCAGCAGGTGGGACAGGG - Intergenic
961142593 3:124567612-124567634 TCACAGCAGCAGGTGGTGGAGGG + Intronic
961306993 3:125964943-125964965 TCCAAGCAGCAGGTGGGACAGGG + Intergenic
961494054 3:127277853-127277875 TCCAAGAAGCAGGAAGTAGAGGG - Intergenic
961966854 3:130914054-130914076 ACTAAGGAGGAGGAGGAGGAGGG - Intronic
962304509 3:134273556-134273578 TCGCAGCAGGAGGAAGAGGAGGG - Intergenic
963020903 3:140872394-140872416 ACCAATCAGCAGGATGAGGGCGG + Intergenic
963248249 3:143082749-143082771 GCCAAGGAGGAGGAGGATGAAGG - Intergenic
963844808 3:150144395-150144417 TCCAGGCATCAGGAAGAAGAAGG + Intergenic
964032463 3:152153314-152153336 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
964310643 3:155387844-155387866 TCCAAGCAGCTGTAGCAGGGTGG - Intronic
965701179 3:171460425-171460447 TCCACTCAGCAGGGGGAGGGTGG + Intergenic
967214738 3:187200380-187200402 TCGAAGCAAGAGGAGGAGGTAGG - Exonic
967244257 3:187470320-187470342 GACAAGCAGCCTGAGGAGGAGGG + Intergenic
967828953 3:193902471-193902493 TCCCAGCAGGAGCAGGAGGGAGG - Intergenic
967865139 3:194183902-194183924 ACCAAGCAGGAGAAGGAGGTGGG + Intergenic
969860534 4:10032308-10032330 TCCAGGCAGAAGGAGCAGCAAGG + Intronic
969916321 4:10495056-10495078 AGCAAGCAGGAGGAGAAGGAAGG + Intronic
970359358 4:15292951-15292973 TCCAAGCAGGAGGAAGAGGTAGG + Intergenic
970447911 4:16139616-16139638 TCCAGGATGCATGAGGAGGATGG + Intergenic
970490920 4:16572873-16572895 TCCAAGAAAGAGGAGGCGGAGGG + Intronic
971244693 4:24917301-24917323 GCCAGGCAGCAGGGGGTGGAAGG + Intronic
972567821 4:40285013-40285035 TGGACGCAGCAGGAGGAGGCAGG + Intergenic
972582159 4:40404556-40404578 ACCAAGCAGCAGGAGAGGGATGG - Intergenic
972715230 4:41639537-41639559 ACCAAGCAGCAGGGAGGGGAAGG - Intronic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
975845446 4:78520158-78520180 TGGAAGCAGTAGGAGGAGGTAGG - Intronic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
976933951 4:90604920-90604942 ACCAATCAGCAGGATGTGGATGG + Intronic
978828176 4:113049624-113049646 GGAAAGCAGGAGGAGGAGGAGGG - Intronic
980088368 4:128416010-128416032 TACAAGGAGCAGGAGGGAGACGG - Intergenic
981011100 4:139925922-139925944 TGCAAGAAGAAAGAGGAGGACGG + Intronic
981370684 4:143955516-143955538 TCCAAGCATCTAAAGGAGGAAGG - Intergenic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
982041550 4:151402285-151402307 TCCAAGCAGGAAGAAGTGGATGG + Intergenic
982525823 4:156476834-156476856 TCCAAGCAAGAGAAGGATGAGGG + Intergenic
982728324 4:158928588-158928610 ACCAAGCAGCAGGATGTGGGTGG + Intronic
982773734 4:159421291-159421313 ACCAATCAGCAGGATGTGGATGG + Intergenic
982893503 4:160886169-160886191 ACCAATCAGCAGGATGTGGACGG - Intergenic
983656871 4:170092100-170092122 ACCAATCAGCAGGATGTGGATGG + Intergenic
984589021 4:181595801-181595823 TCCAAGTAGAAGGATGAGCAAGG - Intergenic
985011638 4:185588606-185588628 AACAAGGAGGAGGAGGAGGAGGG - Intronic
985414957 4:189726681-189726703 TTAAAGCAGCAGTAGGAGGCAGG + Intergenic
985657010 5:1137532-1137554 TCCAGGCAGGTTGAGGAGGAGGG - Intergenic
986008092 5:3684791-3684813 TCCCAGCAGGCCGAGGAGGAAGG - Intergenic
986191728 5:5502706-5502728 ACCAAGCAGGAGGAGGAAGGTGG + Intergenic
986227419 5:5828622-5828644 TGCAAGTAGCATGAGGACGATGG - Intergenic
986299999 5:6470921-6470943 TCCCATCAGCAGCAGGAGGCTGG + Intronic
986634597 5:9808904-9808926 CCCATGGAGCAGGAGGAGCAGGG + Intergenic
986648921 5:9945002-9945024 CCCAAGCAGAAGGTGGAGCACGG - Intergenic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
987945661 5:24605342-24605364 TCCAATCAGCAGTAGAGGGAGGG + Intronic
988235237 5:28535378-28535400 TACTAGAAGCTGGAGGAGGAAGG + Intergenic
988636500 5:32989991-32990013 TGCACGCAGCAGGAGGAATAAGG - Intergenic
989003331 5:36783348-36783370 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
989496729 5:42117427-42117449 ACCAATCAGCAGGATGAGGGTGG + Intergenic
990217469 5:53550109-53550131 TCCAAGGACCTGGAGAAGGATGG + Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990958919 5:61372579-61372601 TCCAAAAAGCGGGAAGAGGAAGG - Intronic
991323336 5:65401447-65401469 TCCCAGCAGCAGAAGGGGAAAGG - Intronic
992260296 5:74963455-74963477 TCCAGGCAGAAAGAGGAAGAAGG - Intergenic
992905874 5:81345141-81345163 TCTAAGCAACAGGAGGATAAGGG + Intronic
993502866 5:88681581-88681603 TCCCAGCAGCGGGTAGAGGAGGG + Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
993828795 5:92727468-92727490 TCCAGGCAGCAGGAGGAGGAGGG - Intergenic
994616833 5:102114711-102114733 TAGAAGCAGCAGGAGGTGGAGGG + Intergenic
994954548 5:106511134-106511156 ACCAATCAGCAGGACGTGGATGG + Intergenic
995182106 5:109238979-109239001 TTCAAGCAGCAGGAGTGGGAGGG + Intergenic
995837326 5:116411531-116411553 ACAAGCCAGCAGGAGGAGGAAGG - Intronic
995854694 5:116578718-116578740 TGAAAGCAGCATGAGGAGCAAGG - Intergenic
996119879 5:119659344-119659366 TCTAAGGAGAAGGAGGAGAATGG - Intergenic
996621684 5:125512520-125512542 TCCAGTCAGCAGGAAGAAGATGG - Intergenic
996752101 5:126899188-126899210 TCCATGAAGAATGAGGAGGACGG + Intronic
996770465 5:127080331-127080353 TCCAGGCAGCAGGAGTAGCAGGG + Intergenic
996815705 5:127570345-127570367 ACCAATCAGCAGGATGAGGGTGG + Intergenic
997091162 5:130860272-130860294 GTCAAGCAGCAGTAGGATGAGGG - Intergenic
997512963 5:134465923-134465945 TCGGAGCAGGACGAGGAGGAGGG - Intergenic
997879056 5:137573638-137573660 TCCAACCAGCATGAGGAGTATGG - Intronic
998092988 5:139381820-139381842 TCCACACAGCAGGAGCAGGTGGG - Intronic
998451146 5:142235594-142235616 GCAAAGGAGCAGGAGGAGGGGGG - Intergenic
999052195 5:148534686-148534708 TGCAAGCAGAAGGAGTAGGTGGG - Intronic
1000058759 5:157633950-157633972 TGCAAGAAGAAGGAAGAGGAAGG + Intronic
1000178277 5:158780374-158780396 TCAAAGCAACAGAAGGAGGGAGG + Intronic
1000968023 5:167682703-167682725 GCCACGCAGCAGGAGGTGAATGG - Intronic
1001763895 5:174229767-174229789 TCTAAACAGCAGTATGAGGAAGG - Intronic
1001776359 5:174331916-174331938 GCCAGGCAGCTGGAGGAGGCAGG + Intergenic
1001942858 5:175753085-175753107 TCCAGGGAGGAGGAGGAGGCAGG + Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002735050 5:181379102-181379124 TCGGAGGAGCAGGAGGAGTAAGG - Intergenic
1002749476 6:95020-95042 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1002844888 6:937364-937386 GACAAGGAGGAGGAGGAGGATGG - Intergenic
1002850886 6:995512-995534 GCCAGGGAGGAGGAGGAGGACGG + Intergenic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1003466347 6:6383544-6383566 TGCATTCAGGAGGAGGAGGAAGG - Intergenic
1003770029 6:9290076-9290098 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1003957309 6:11175609-11175631 TCCAAGCAGAAGTAGGAGTAAGG - Intergenic
1004748977 6:18541198-18541220 TACACGGGGCAGGAGGAGGAGGG + Intergenic
1005759951 6:28958884-28958906 ACCAATCAGCAGGATGTGGATGG + Intergenic
1005925759 6:30444222-30444244 TCAGTGGAGCAGGAGGAGGAAGG - Intergenic
1006081844 6:31572396-31572418 TCCAGGCAGCAGGTGCAGGAGGG - Intronic
1006416697 6:33908581-33908603 CCCAAGCAGCAGGCTGAGCAGGG + Intergenic
1006449149 6:34096020-34096042 TCCCAACAGCAGCAGCAGGAGGG + Intronic
1006748642 6:36362920-36362942 TCCAAGATGAAGCAGGAGGATGG - Intronic
1006981957 6:38154277-38154299 TCCACGCAGCAGGCAGAGGAGGG - Exonic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1008254179 6:49276131-49276153 ACCAATCAGCAGGATGTGGATGG + Intergenic
1008465195 6:51822346-51822368 TCCAAGGAGGACAAGGAGGATGG - Intronic
1009685496 6:66950261-66950283 ACCAATCAGCAGGATGTGGATGG + Intergenic
1010716783 6:79239344-79239366 TTTAAGCAGCAGGAGCAAGAAGG - Intergenic
1011460737 6:87600700-87600722 TCAAATCAGCGGGAGAAGGATGG + Intronic
1011879799 6:92011099-92011121 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1011931941 6:92724512-92724534 GCCAATCAGCAGGATGTGGATGG + Intergenic
1013648515 6:112169584-112169606 TCCAAAGATCAGGAAGAGGAAGG + Intronic
1014300845 6:119679531-119679553 GCCAAGAAGCAAGAGCAGGATGG + Intergenic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015200526 6:130574901-130574923 TCCAGGCAGAAGAAGGAGAAGGG - Intergenic
1015718475 6:136216088-136216110 GATAGGCAGCAGGAGGAGGAAGG + Intergenic
1015957539 6:138614245-138614267 TCCCAGCAGGAAGAAGAGGAAGG - Intronic
1016217310 6:141618821-141618843 ACCAATCAGCAGGATGTGGATGG + Intergenic
1016779598 6:147943471-147943493 GCAAAGGAGGAGGAGGAGGATGG - Intergenic
1017325212 6:153134339-153134361 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1017382323 6:153844940-153844962 TCAGATCAGCAGGAGGAGGCAGG - Intergenic
1017534256 6:155329636-155329658 TCCAAGCAGCAGGATCCTGATGG + Intergenic
1017778395 6:157697319-157697341 TCCAAGGAACAGGTGGAAGAAGG - Intergenic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018901463 6:168053872-168053894 CCCAAGCAGGAGGAGGAGGCCGG - Intergenic
1019006005 6:168796589-168796611 TCCATGAAGCTGGAGGATGAAGG + Intergenic
1019062340 6:169265481-169265503 TGCCAGCTTCAGGAGGAGGAGGG - Intergenic
1019080047 6:169424330-169424352 TCAAAGCAGGAGGAGGAGGCGGG + Intergenic
1019239309 6:170651419-170651441 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1019553533 7:1617100-1617122 TCCAGGCTGGGGGAGGAGGAAGG - Intergenic
1020252411 7:6480087-6480109 TCTAAGCAACAGGGGAAGGAGGG + Intronic
1020421006 7:8005385-8005407 TGAAAGCAGCAAGAGGAGGAGGG + Intronic
1020559315 7:9710160-9710182 TGCAAACAGCAGGAGGCTGAAGG - Intergenic
1021137157 7:16979330-16979352 TCCAGGCAGCTGGAAGTGGAAGG + Intergenic
1021139440 7:17005847-17005869 TCCAAGAAGGAGGAGGAGAAGGG - Intergenic
1021336290 7:19406774-19406796 CCCAAGCAGCTGAAGGAGGCTGG + Intergenic
1021567521 7:22029572-22029594 ACCAAGCAGCAGGATGTGGGTGG + Intergenic
1021570722 7:22062398-22062420 TTCAACCAGCAAGGGGAGGAAGG + Intergenic
1021746039 7:23742241-23742263 GCCAAGCAGCATGAGCAAGAAGG + Intronic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1024185675 7:46945874-46945896 TCCAGGCAGAGGGAGGAGGAGGG + Intergenic
1024430802 7:49285864-49285886 CCCCAGCACCTGGAGGAGGAAGG + Intergenic
1024466040 7:49712084-49712106 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1024895669 7:54259252-54259274 ACCAAGATGTAGGAGGAGGACGG + Intergenic
1026491593 7:70868523-70868545 TCCAGGGGGCAGGAGAAGGATGG + Intergenic
1026678977 7:72451074-72451096 ACCAGGCAGAAGAAGGAGGAGGG + Intergenic
1026968815 7:74455538-74455560 TCTAAGCAGGAGGAGGTGGCTGG + Intronic
1027182387 7:75949977-75949999 TCCCAGAAACAGGAGGAGGGAGG - Intronic
1027423524 7:78040321-78040343 TCCAAGCAGAGCGAGGATGAGGG + Intronic
1027856251 7:83515466-83515488 TCTAAGCAGCATGGGAAGGATGG - Intronic
1028018114 7:85740099-85740121 TCCAGACAGCAGGAAAAGGATGG - Intergenic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1029309130 7:99644935-99644957 CCCACCCAGCAGGAGCAGGATGG + Intergenic
1029451389 7:100643280-100643302 TCCAAGCAGGAATATGAGGAGGG - Exonic
1029474567 7:100775468-100775490 GCCAAGCATGAGAAGGAGGAAGG + Exonic
1030217256 7:107057121-107057143 TTCAAGCAACAGAGGGAGGAAGG - Intronic
1030366888 7:108656732-108656754 ACCAATCAGCAGGATGTGGATGG - Intergenic
1030507002 7:110437197-110437219 TACAAAAAGCAGGAGGAAGAAGG + Intergenic
1032124941 7:129186958-129186980 TGAGAGCAGCACGAGGAGGATGG + Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032668546 7:134062833-134062855 TCAATGCAGCAGGAAGATGAAGG - Intronic
1034129929 7:148706335-148706357 TCCAAGCAGCAGAAAGCTGAGGG - Intronic
1034859231 7:154581880-154581902 TTCTAGCAGCAGGAGAAGGCAGG - Intronic
1034900951 7:154907549-154907571 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1034960629 7:155362205-155362227 CCCAAGGAGCTGCAGGAGGAGGG + Intronic
1035508461 8:155189-155211 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1035843554 8:2838985-2839007 TCCTAGTAGCTTGAGGAGGAGGG - Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1035950792 8:4018474-4018496 CACAAGGAGCAGGTGGAGGAAGG + Intronic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1037189012 8:16099694-16099716 TCCAAACAGCAGAAAGCGGATGG + Intergenic
1037263726 8:17036451-17036473 ACCAATCAGCAGGATGTGGATGG - Intronic
1037811109 8:22087336-22087358 ACCAATCAGCAGGATGAGGGTGG + Intergenic
1037862492 8:22415811-22415833 TCCAAGAAGGACCAGGAGGAGGG + Exonic
1037890555 8:22621811-22621833 CCCCAGCAGCAGGTGCAGGAAGG + Intronic
1037946103 8:22990601-22990623 TCCCAGAAGGAGGAGGAAGAGGG + Intronic
1039059900 8:33565252-33565274 TCCGACCAGCAAAAGGAGGAAGG + Intronic
1039097952 8:33907205-33907227 ACATGGCAGCAGGAGGAGGAGGG - Intergenic
1039448222 8:37649184-37649206 TCCAAGCAGGAGGAGGAACGTGG + Intergenic
1039466389 8:37788160-37788182 TCCAGGCAGGAGGAGGGGTAGGG - Intronic
1040551416 8:48440352-48440374 GCCAAGTAGCAGGAGGCAGAGGG - Intergenic
1040817157 8:51520424-51520446 TCCACGCCGCACCAGGAGGAGGG + Intronic
1041068664 8:54105164-54105186 ACCAATCAGCAGGATGTGGATGG + Intergenic
1041628341 8:60056585-60056607 TCCCAGCAGCAGCTGTAGGAAGG - Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042948640 8:74179044-74179066 ACCAATCAGCAGGATGAGGATGG - Intergenic
1043054517 8:75420786-75420808 GCCAGGCAGCAAGAGGAGAAAGG + Intronic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1044532492 8:93323391-93323413 TCCAGGCAGCAGGAGCAGTCAGG - Intergenic
1044864313 8:96555061-96555083 TCCAAGCAGAGGGAAGTGGATGG - Intronic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1046359037 8:113126657-113126679 GAAAAGCAGAAGGAGGAGGAAGG + Intronic
1046661081 8:116949302-116949324 ACCAATCAGCAGGATGAGGGTGG - Intergenic
1046789555 8:118306479-118306501 TCCAAGCCACAGGAAGAAGAGGG - Intronic
1047034176 8:120916380-120916402 TCCAATCAGCAGGAGGGGGCAGG - Intergenic
1047192983 8:122695464-122695486 GCCAGGGAGCAGGAGGATGAGGG + Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1049543019 8:143216987-143217009 TTCAGCCAGCAGAAGGAGGAAGG - Intergenic
1049675974 8:143889320-143889342 GCCAAGCAGCAGGAGCTGCAGGG - Intergenic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1051595641 9:18822012-18822034 TTCAAGCAGCAGGGAGAGCATGG + Intronic
1051898054 9:22009092-22009114 CCCAAGCCGCAGAAGGACGACGG - Exonic
1051955480 9:22687929-22687951 ACCAATCAGCAGGACGTGGACGG + Intergenic
1052098624 9:24415091-24415113 TGCAGACAGCAGAAGGAGGAAGG - Intergenic
1052347594 9:27425974-27425996 TTCACCCAGCAGAAGGAGGAGGG + Intronic
1052837283 9:33260891-33260913 TCTAACCAACAGGAGCAGGAGGG + Intronic
1052959402 9:34281930-34281952 TCCCACCAGCAGTATGAGGATGG - Intronic
1053052515 9:34973600-34973622 TCTAAGCAGCAGGAAGAAGGGGG - Intronic
1056117019 9:83450577-83450599 TCCAAAGAGGAGGAGGAAGAAGG - Intronic
1056475055 9:86945754-86945776 CCCAAGCAGCAGCAGCAAGATGG + Exonic
1056672245 9:88640175-88640197 TCTAAGCAGCTGGAGGAGAGAGG + Intergenic
1056715925 9:89028040-89028062 TTAAGGCAGTAGGAGGAGGATGG + Intronic
1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG + Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057729590 9:97597102-97597124 TTCAAGCAGCAGATGGAGGTTGG + Intronic
1057796141 9:98159541-98159563 GCCAAGCAGAAGGAGAGGGACGG - Intronic
1059015087 9:110506737-110506759 TCCAAGCAGGGGAAGGAGGGAGG + Intronic
1059043942 9:110843873-110843895 TCGACACAGCTGGAGGAGGAGGG - Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059891341 9:118808867-118808889 ACCAATCAGCAGGATGTGGATGG - Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060221478 9:121766282-121766304 CCCAGGCAGGAGGAGGAGCAGGG - Intronic
1060960878 9:127679711-127679733 TCTAGGCAGCAGGAGGTAGATGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061133855 9:128722507-128722529 GCCCAGCACCAGGAGCAGGAAGG + Exonic
1061475713 9:130864668-130864690 TCCAGGTAGTAGGAGGAAGAAGG + Intronic
1061483968 9:130911008-130911030 ACCAAGCAGCAGGATGTGGGTGG + Intronic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1062325623 9:136011154-136011176 TCCGGGCAGGAGGAGCAGGAAGG + Exonic
1062759517 9:138331710-138331732 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203599964 Un_KI270748v1:2482-2504 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203637970 Un_KI270750v1:131579-131601 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1185559771 X:1050591-1050613 TCCCAGCAGCAGGGGAAGAAAGG + Intergenic
1185856926 X:3544496-3544518 TCCGCGCAGCAGGGTGAGGATGG + Intergenic
1186177642 X:6942046-6942068 TCCAAAAGGCAGGAGGAGGGAGG + Intergenic
1186264559 X:7818532-7818554 TGCAAGAAGGAGGAGAAGGAGGG + Intergenic
1186829734 X:13378707-13378729 GCCAAGCAGCCGGGGTAGGAGGG + Intergenic
1186893815 X:13986560-13986582 TCTGGGCAGCAGGAGGAGAAAGG + Intergenic
1187025757 X:15433978-15434000 AGAAAGCAGGAGGAGGAGGAAGG + Intronic
1187070674 X:15884584-15884606 TGCAAACAGCAGGAGGAGAAAGG + Intergenic
1187834362 X:23416142-23416164 TCCAAGGAGCAGGAAGAGGTGGG - Intergenic
1188766272 X:34095816-34095838 ACCAATCAGCAGGATGTGGATGG - Intergenic
1189209953 X:39276358-39276380 ACCAATCAGCAGGATGTGGATGG + Intergenic
1189446549 X:41085866-41085888 GCCAAGGAGGAGGAGGAGGCGGG + Exonic
1191641646 X:63433643-63433665 TCAGAGGAGGAGGAGGAGGAGGG + Intergenic
1191841750 X:65518238-65518260 GCCCAGCAACAGGAGGAGCAGGG - Exonic
1191904380 X:66073435-66073457 TCAAAGCATCAGGAGCAGGCAGG + Intergenic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193422329 X:81296194-81296216 GACAAGCAGCAGTAGGAGGATGG + Intronic
1194118019 X:89926660-89926682 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
1194250136 X:91564202-91564224 ACCAATCAGCAGGATGTGGACGG + Intergenic
1195439163 X:104882651-104882673 ACCAATCAGCAGGACGTGGATGG + Intronic
1195552759 X:106186802-106186824 ACCAATCAGCAGGATGTGGATGG - Intronic
1196126746 X:112109467-112109489 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1197281770 X:124545250-124545272 TCAAACCAGGAGGAGGAGAAGGG + Intronic
1197424065 X:126273268-126273290 TGCAACCAGCAGCAGGAGGCTGG - Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1199541003 X:148957931-148957953 TCCAAGCAGCATGGGGATCATGG - Intronic
1199988312 X:152968511-152968533 TGAAAGAAGCAGGAGGAGCAGGG + Intronic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1200569100 Y:4805451-4805473 ACCAATCAGCAGGATGTGGACGG + Intergenic
1200668416 Y:6056963-6056985 TCAAAGCAGGAGGAGGGGGTAGG + Intergenic
1200744871 Y:6895064-6895086 GCCTAACAGCAGGAGGAGAAGGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201480063 Y:14428976-14428998 ACCAATCAGCAGGATGTGGATGG + Intergenic
1201496793 Y:14597397-14597419 ACCAATCAGCAGGATGTGGATGG - Intronic
1202338301 Y:23832838-23832860 GCCTAACAGCAGGAGGAGAATGG - Intergenic
1202532465 Y:25837233-25837255 GCCTAACAGCAGGAGGAGAATGG + Intergenic