ID: 906038636

View in Genome Browser
Species Human (GRCh38)
Location 1:42768886-42768908
Sequence TCTCAAATACAGATTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906038636 Original CRISPR TCTCAAATACAGATTGTATT GGG (reversed) Intronic
901164623 1:7209357-7209379 TCTCAAATGCAAATTGTATTTGG + Intronic
905639326 1:39577507-39577529 TCTCAAATCTTTATTGTATTTGG - Intergenic
906038636 1:42768886-42768908 TCTCAAATACAGATTGTATTGGG - Intronic
908031795 1:60008460-60008482 TCTCAAAATCTGACTGTATTTGG + Intronic
908654937 1:66378423-66378445 TCTCAAAAAAAGATATTATTTGG + Intergenic
909717160 1:78723056-78723078 TCTAAAATGAAGAATGTATTTGG + Intergenic
910838222 1:91536653-91536675 TCTCAAAATGAGGTTGTATTAGG - Intergenic
912623665 1:111190497-111190519 TCTCACATAAAGTTTGGATTTGG + Intronic
913082651 1:115403160-115403182 TCTCAAACTCAGTTTGTAGTTGG + Intergenic
913149120 1:116022806-116022828 TCTCAATTTCACATTGAATTTGG - Intronic
915394734 1:155574384-155574406 ACTAAACTACAGATTTTATTTGG - Intergenic
916569252 1:166010368-166010390 TCTTAAATACAGTTTGTCTCAGG + Intergenic
916943723 1:169702848-169702870 TCTCATATACAGATAGATTTTGG + Intronic
917330258 1:173873076-173873098 TCTAAAATACAGATTATTATGGG + Intronic
917987147 1:180332300-180332322 TCTGAAGAACAGATTGTAGTGGG - Intronic
918533638 1:185550653-185550675 TCTTAAATACAGATAGGACTTGG + Intergenic
918769005 1:188528964-188528986 TCTCAAAAAAGGATTGTATCAGG - Intergenic
918793570 1:188861917-188861939 TCTAAAATACAGATTATTTCAGG - Intergenic
919026904 1:192183869-192183891 TCTCAAAAGCAGATGCTATTAGG - Intronic
919373759 1:196764880-196764902 TTCCTAATACAGATCGTATTAGG - Intergenic
919379021 1:196831857-196831879 TCTCAAATAAAGCTTCTGTTTGG - Exonic
919380201 1:196849560-196849582 TTCCTAATACAGATCGTATTAGG - Intronic
920519291 1:206611787-206611809 TCACAAATGGAGATTGTGTTTGG - Intronic
921725801 1:218521998-218522020 TCTAAAATTCAAATTGAATTGGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922382975 1:225051750-225051772 TTTCAATTACAGATTGTATGAGG - Intronic
923435859 1:233967166-233967188 TCTGAAATTCACATTTTATTGGG + Intronic
923476678 1:234339977-234339999 TCTCTCAGACAAATTGTATTAGG + Intergenic
1063647903 10:7904210-7904232 TCTCAAATAGAGACTGTCTTGGG + Intronic
1063738303 10:8787955-8787977 TCTCAAACCCAGATTGTATGGGG - Intergenic
1065540580 10:26762424-26762446 TCTCAGATACTGATTGTCTGGGG + Intronic
1066585845 10:36934339-36934361 TCTCAAATGCATCTTTTATTTGG + Intergenic
1067664199 10:48259929-48259951 TCTCAGATACCTACTGTATTAGG + Intronic
1068873292 10:61968724-61968746 TCTCATATACAGTGTGTTTTAGG + Intronic
1069104160 10:64362204-64362226 TCTTATATACAGAATCTATTTGG - Intergenic
1069619435 10:69827539-69827561 TCTAGAATACAAATTGTATCAGG - Intronic
1071106178 10:82098501-82098523 CCTCTAACACAGATTGTATGTGG - Intronic
1073427801 10:103466563-103466585 TCACACATAAACATTGTATTAGG - Intergenic
1073724825 10:106218159-106218181 TTGCAGATAAAGATTGTATTAGG - Intergenic
1074022951 10:109603450-109603472 TTTCAAATAAAGAATGTAATTGG + Intergenic
1074456197 10:113597491-113597513 TCTTAATAACAGAATGTATTTGG - Intronic
1075358090 10:121802049-121802071 TTACAAACACAGATTCTATTGGG - Intronic
1076463760 10:130664450-130664472 TCTAAAATTCAAATTGAATTGGG - Intergenic
1078823203 11:14903892-14903914 TGTCAAATACAGTTTCCATTTGG + Intergenic
1079670346 11:23162195-23162217 TCTCAAATTCAGATTGAACTGGG + Intergenic
1080841860 11:35991185-35991207 TCTCAATTACAGAATATGTTAGG + Intronic
1080860659 11:36147648-36147670 TCTGAAACACTGATTGTTTTAGG - Intronic
1081208230 11:40299904-40299926 TCACAAATAGAAACTGTATTAGG + Intronic
1081679840 11:44994494-44994516 GATCACATACAGATTGTGTTTGG - Intergenic
1083061952 11:59882342-59882364 TTTCAAGGACAGATTGTATATGG + Intergenic
1087234866 11:95706658-95706680 TCTCAATTCCATATTTTATTAGG - Intergenic
1088119208 11:106348210-106348232 TCTTACATACAGATTGTATAAGG - Intergenic
1088596762 11:111446936-111446958 TTTCAAATCCAGAGTGCATTTGG - Intronic
1088971385 11:114777537-114777559 TGTTGAAGACAGATTGTATTGGG + Intergenic
1091342265 11:134824972-134824994 CCACAAATGCAGGTTGTATTAGG + Intergenic
1093262519 12:16956923-16956945 GCTCAACTACATATTGTACTAGG - Intergenic
1093637197 12:21485241-21485263 TCTAAAAGCCTGATTGTATTTGG - Intronic
1094021526 12:25919377-25919399 TGTCAAATACACATTGGATTAGG + Intergenic
1097442047 12:59620967-59620989 CCTCAAAAAAAGATTGTATTTGG - Intronic
1097478819 12:60094751-60094773 TCTCAAATTCACTTTCTATTTGG + Intergenic
1097812096 12:64029998-64030020 TCTCAAGTACTCATTGTAGTGGG - Intronic
1097995630 12:65885211-65885233 TCTGAATTACAGATTATTTTAGG + Intronic
1098119013 12:67215637-67215659 TTTGATATACAGATTGGATTAGG + Intergenic
1098916828 12:76266144-76266166 TAGCAAAAACAGATTGTTTTGGG + Intergenic
1099583780 12:84489067-84489089 TCTCTAACACAGCTTGTGTTTGG + Intergenic
1099627341 12:85091282-85091304 TCTCAAAGGAAGACTGTATTAGG - Intronic
1099627345 12:85091375-85091397 TCTAAAATACAGAATCTATAAGG - Intronic
1100649515 12:96569626-96569648 TCTCAACTACAGATTTGTTTAGG - Intronic
1101305899 12:103527607-103527629 CCTGAAATACTGATTGTATCAGG - Intergenic
1101926973 12:108980287-108980309 GCTCAACTACAGACTTTATTCGG - Intronic
1103193922 12:119025741-119025763 TCTCATATACGGATTTTACTAGG + Intronic
1106909172 13:34445034-34445056 TTTTAAATAGAGATTGTATGTGG + Intergenic
1107132873 13:36914972-36914994 TATCAAATACAGATTTACTTTGG - Intronic
1108325215 13:49323924-49323946 TCTCAAATTCAAATTGAATGGGG + Intronic
1108744125 13:53373015-53373037 TCTCAAATTCTAATTCTATTTGG - Intergenic
1109068563 13:57733978-57734000 TACAAAATACAGATTGTAGTTGG + Intergenic
1109180238 13:59205129-59205151 TATGAAAGACAGAATGTATTGGG + Intergenic
1109555529 13:63970050-63970072 TTTGAAATACAGATGGTTTTTGG - Intergenic
1109568585 13:64153992-64154014 TCTCAAATTCAGATGATATCAGG - Intergenic
1109894575 13:68667807-68667829 TTTAAAATAAAGATTGTAATTGG - Intergenic
1110749698 13:79098355-79098377 TCCCACATACAGTTTGTTTTAGG + Intergenic
1111690138 13:91553511-91553533 CCTCATATACAGATTGAACTGGG - Intronic
1112524009 13:100126152-100126174 GCTCATATACATATTGAATTTGG - Intronic
1112866611 13:103908909-103908931 ACACATATACAAATTGTATTTGG - Intergenic
1114153126 14:20067810-20067832 TCTCATATATAGCTTGTAGTTGG - Intergenic
1114763880 14:25348599-25348621 TTTAAAATACAGAATGTAATTGG + Intergenic
1115089728 14:29559335-29559357 TCTGAAAAACAGAATGTATCAGG + Intergenic
1115153251 14:30309732-30309754 TCTCAAATGAAAATTGTATGGGG - Intergenic
1115186923 14:30699140-30699162 TTACAAATAAATATTGTATTTGG - Intronic
1116364556 14:44043445-44043467 TCTCAAAAAAAAATTGCATTTGG - Intergenic
1116691638 14:48114786-48114808 TGTCAAATACAAATTGGGTTTGG - Intergenic
1118718826 14:68579609-68579631 TCTGAAATCCAGATTGTGTTGGG + Intronic
1120157319 14:81107737-81107759 TCTGAAATTCAAATTGTATTGGG - Intronic
1125233121 15:37481170-37481192 TCTCAAATACTGATTACTTTGGG + Intergenic
1128745449 15:70111153-70111175 TCTGAAATTCAAATTGTACTGGG + Intergenic
1131676176 15:94672968-94672990 CTTCAAATACTGATAGTATTTGG - Intergenic
1131845009 15:96481845-96481867 TTTTAAAAACATATTGTATTGGG - Intergenic
1135609847 16:23856823-23856845 TATCAAATAAAAATTGTATGAGG - Intronic
1138040950 16:53666423-53666445 TTTAAAATACATATTTTATTTGG - Intronic
1138181512 16:54943487-54943509 TATCAAAGACAGATTGGAGTTGG + Intergenic
1139252101 16:65506354-65506376 TCCCACATATAGATTTTATTAGG + Intergenic
1140658615 16:77165758-77165780 TCTCAGTTACCGTTTGTATTAGG + Intergenic
1143076341 17:4347210-4347232 TCTGAAATCCAGAATGTTTTTGG - Intronic
1143137914 17:4722220-4722242 ACTCAAATCCAGATTGTTTGTGG - Intergenic
1143730187 17:8877706-8877728 ACTGAACTCCAGATTGTATTGGG + Intergenic
1143958533 17:10695488-10695510 ATTAAATTACAGATTGTATTTGG - Intronic
1144243770 17:13341376-13341398 TCTCAAATCCAGATTGTGATGGG + Intergenic
1147963845 17:44182597-44182619 TCTCAAAAAAAAATTGTTTTAGG - Intergenic
1149392633 17:56207328-56207350 TCTCAAACACAGTGTGCATTAGG - Intronic
1149809018 17:59648952-59648974 TTTAAAATGCAGATTATATTGGG - Intronic
1153679074 18:7483545-7483567 TTTCAAATAGAAACTGTATTTGG - Intergenic
1153969010 18:10207671-10207693 TCTGAAATACAGATTTAACTGGG - Intergenic
1155836385 18:30590795-30590817 TCTCAAATCCAGATTGTTACAGG - Intergenic
1155881816 18:31158734-31158756 CCTCAAGTACAAATTTTATTGGG + Intronic
1157737847 18:50066297-50066319 TTTCAAAGACAGTTTGTATGGGG - Intronic
1158308068 18:56128154-56128176 TCTTGAAAACAGATTGTGTTTGG - Intergenic
1158739352 18:60122014-60122036 TCTGAAATTCAGATTTTACTGGG + Intergenic
1159771852 18:72555549-72555571 TCATAAATTAAGATTGTATTAGG - Intronic
1159800247 18:72889782-72889804 TCTCAAAGACACAAAGTATTAGG - Intergenic
1160102643 18:75937501-75937523 TCTCAAACACAGATTTTACAAGG - Intergenic
1162005840 19:7778443-7778465 TCTGAAATACTGAGTGTTTTGGG + Intergenic
1163904616 19:20141221-20141243 TCTAATATACAGAATTTATTAGG + Intergenic
1165240612 19:34463860-34463882 TCTCAGAATCTGATTGTATTTGG - Intronic
1167223935 19:48223961-48223983 TCTCAAAAAAAAATTGCATTTGG - Intronic
925438062 2:3858539-3858561 TGTCAAATACCAGTTGTATTTGG + Intergenic
925545881 2:5015534-5015556 TCTCAAATTCAGATTTAACTGGG + Intergenic
927305277 2:21564299-21564321 GCTCAAACACAGATAGGATTAGG - Intergenic
927397013 2:22664102-22664124 TATCTAATACAGATTAAATTAGG + Intergenic
928771173 2:34703120-34703142 TTTAAAATATAGATTATATTAGG - Intergenic
929130436 2:38563453-38563475 ACTTAAATACAGCTAGTATTTGG - Exonic
929367841 2:41182436-41182458 TCTGTAATACAGATGTTATTTGG - Intergenic
929858387 2:45654362-45654384 TCTCAAATTCATGTTGGATTTGG + Intronic
931152779 2:59593462-59593484 TCTTAAATACAGAAACTATTGGG + Intergenic
935931298 2:108129129-108129151 CCCCACTTACAGATTGTATTTGG + Intergenic
936656564 2:114494903-114494925 TCTAAATTACAGGTGGTATTGGG + Intronic
936767200 2:115866690-115866712 TCTCTAATAGACATTGTTTTGGG - Intergenic
937593221 2:123640334-123640356 TCTCAAAAACAGTCAGTATTAGG + Intergenic
938556935 2:132433212-132433234 ACACAAATACAGATTGTACATGG + Intronic
938760105 2:134417326-134417348 TCTAAACTACAGACTTTATTTGG + Intronic
939232832 2:139452640-139452662 TCGAAACTACAGATTGTTTTGGG + Intergenic
939636272 2:144586101-144586123 TCTTACATACATATTGTACTTGG + Intergenic
939768234 2:146280649-146280671 TCTCAAATGGAAATTGAATTTGG + Intergenic
940127015 2:150337870-150337892 TTTCAGATACATATTATATTAGG - Intergenic
940494711 2:154411650-154411672 TCTGGAATATAGATTGTATCTGG + Intronic
941064528 2:160886248-160886270 ACTAAACTACAGATTTTATTTGG - Intergenic
941209385 2:162617528-162617550 TCTCCAAGAGAGATTGGATTGGG + Intronic
942523361 2:176827819-176827841 TCTTAAAAAGTGATTGTATTTGG - Intergenic
943123362 2:183765687-183765709 TATAGACTACAGATTGTATTAGG + Intergenic
944451667 2:199850571-199850593 TCCCAAACACAGAGTGTTTTGGG - Intronic
945797698 2:214385390-214385412 TATCAAATAGAGATTGCATGTGG - Intronic
946030565 2:216700699-216700721 TATAAAATACAGATTCTGTTAGG + Intergenic
946034537 2:216731396-216731418 TCTGAAATTCAGATTTAATTGGG + Intergenic
946095181 2:217268601-217268623 TGTAAAATACAGATTTTATGAGG - Intergenic
947193494 2:227536847-227536869 TCTTAAATACAAAATGTATTAGG + Intronic
947557969 2:231114490-231114512 TCTCAAATAAAGATTGCAAAAGG + Intronic
1169149197 20:3276046-3276068 TCTATAATACACATTGTCTTGGG + Intronic
1169677855 20:8174746-8174768 TCACATATGCATATTGTATTAGG + Intronic
1170136047 20:13074559-13074581 TCTCAAATCTAGATCATATTTGG + Intronic
1172036734 20:32016251-32016273 TCTGAAATTCAGATTTTACTAGG - Intronic
1174433509 20:50488670-50488692 TCTGAAATGCAGATGGTAATAGG + Intergenic
1177005685 21:15669483-15669505 TCTCACAAACAGATTGCAGTTGG - Intergenic
1177391576 21:20480653-20480675 TCACTAATACAGATAGTATGTGG - Intergenic
1177563402 21:22785707-22785729 TTTTAAACAAAGATTGTATTGGG + Intergenic
1178377375 21:32078002-32078024 TTTCAAAAACAGATTGGAGTAGG - Intergenic
1184311189 22:43644134-43644156 TCCCAAATGCAGGTTGGATTTGG + Intronic
949332265 3:2935575-2935597 TCTCAAATACATCTTGTACCAGG - Intronic
951630398 3:24713870-24713892 GCTAAAATACAGCTTTTATTTGG - Intergenic
952828572 3:37544369-37544391 TCTGAAATTCAGATTTAATTAGG - Intronic
953010419 3:39020208-39020230 TCTCAATTAAAGTTTCTATTTGG + Intergenic
957371236 3:79297080-79297102 TTTCAAATACAAAATGTAGTTGG + Intronic
957811744 3:85230685-85230707 TCTCAGATACTGCTTGTATAAGG + Intronic
957917014 3:86698353-86698375 TCTAAAATAAAGAGTGTAATTGG + Intergenic
959457803 3:106585239-106585261 TTTGAAATACAGTTTCTATTTGG - Intergenic
959484851 3:106915116-106915138 TTTCAAAAACAGATTATAGTAGG + Intergenic
960020383 3:112945411-112945433 GCTCACATAAATATTGTATTTGG + Intronic
960307032 3:116074461-116074483 TCTGAAATACAAATGGTTTTGGG - Intronic
962035426 3:131646575-131646597 TCTAAAATAAAGAGTGTAATTGG + Intronic
962384184 3:134919760-134919782 TCCCAAATCCAGACTGCATTAGG - Intronic
962888462 3:139650061-139650083 TCTCAAACACAGACTGCATAGGG + Intronic
963280687 3:143382193-143382215 TCTCAGATTCACATTGTGTTTGG - Intronic
964525194 3:157609815-157609837 TCTGAAATTCAGATTTAATTGGG - Intronic
964787657 3:160416184-160416206 TGTCAAATATTGATAGTATTGGG + Intronic
965340033 3:167479108-167479130 TCTAAAACACAGAGTGTATTTGG + Intronic
967246151 3:187488846-187488868 TCACAAATAGACATTGAATTTGG - Intergenic
967282925 3:187839846-187839868 TTTCATATACAGATTGAATATGG + Intergenic
967465538 3:189801923-189801945 TCTCAAAACCAGATTTTATTAGG - Intronic
968399267 4:277147-277169 TCACAAATACAGATTTAAATGGG + Intronic
970619381 4:17801781-17801803 TCTTAACTTCAGATTGTATTAGG + Exonic
970954575 4:21795082-21795104 CCTCAAAATGAGATTGTATTCGG + Intronic
971721935 4:30256017-30256039 TCTTAAATGCAGGTTGTAGTAGG + Intergenic
972734257 4:41825117-41825139 AGTAAAATACATATTGTATTAGG + Intergenic
974242492 4:59268305-59268327 TCTGAATTACAGGTTGTGTTTGG + Intergenic
974586917 4:63891484-63891506 TCTAAAAAAAAGATCGTATTGGG - Intergenic
975358590 4:73439097-73439119 TCTAAAATTCAGATTGAACTGGG - Intronic
976016996 4:80567904-80567926 ATTCAAATATACATTGTATTAGG - Intronic
976231990 4:82853749-82853771 CCTCATATACAGATTGCCTTGGG - Intronic
977216283 4:94287695-94287717 TTTAAAATAAAGATTGTGTTTGG + Intronic
977891278 4:102314338-102314360 TCTGAAGAACAGATTGTAATGGG - Intronic
977967590 4:103171251-103171273 TCTCTAAGACAGATCATATTAGG + Intronic
979367685 4:119844935-119844957 TCTAAAATCCAGATTCTTTTTGG + Intergenic
981445383 4:144830921-144830943 ACTAAAATACAGATTTTATTTGG - Intergenic
983186203 4:164703892-164703914 ACTCAAATACAGCTTGTGTCAGG + Intergenic
983284835 4:165726241-165726263 TCTCAAATACAGCTTAAGTTTGG + Intergenic
983765339 4:171473953-171473975 TCTGAGATACAGATTTCATTCGG + Intergenic
984023504 4:174515734-174515756 TCTAATATACAGATTATATAAGG + Intronic
984672291 4:182504407-182504429 TACCAAATACAGATTTGATTGGG + Intronic
986561984 5:9069519-9069541 TACAAAATAAAGATTGTATTAGG - Intronic
987691948 5:21278673-21278695 TCTCAAACTCAGAATGAATTGGG - Intergenic
989010125 5:36861998-36862020 TATCAAGTACATATTCTATTAGG + Intergenic
991748438 5:69771421-69771443 TCTCAAACTCAGAATGAATTGGG + Intergenic
991800018 5:70351266-70351288 TCTCAAACTCAGAATGAATTGGG + Intergenic
991828582 5:70658773-70658795 TCTCAAACTCAGAATGAATTGGG - Intergenic
991892373 5:71350697-71350719 TCTCAAACTCAGAATGAATTGGG + Intergenic
992097748 5:73378860-73378882 TCTCAAAAGCAAATTGTATGAGG + Intergenic
992373080 5:76165301-76165323 ACTCAAATACAGACTTTATTTGG + Intronic
993748035 5:91626211-91626233 TATCAATTACAGATTGATTTTGG + Intergenic
994822289 5:104668890-104668912 TCTCAAAAACAAAGTTTATTCGG - Intergenic
995843607 5:116468639-116468661 GGTTAAATACAGATTGTATCAGG + Intronic
996079595 5:119242007-119242029 ACACAAATACAGATTGTAAGTGG - Intronic
996286110 5:121794915-121794937 TCTCACCTCCAGATTATATTAGG + Intergenic
997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG + Intergenic
997771019 5:136553832-136553854 TCTCAAAGGCAGAATATATTTGG + Intergenic
999394544 5:151218922-151218944 TCTCAAAGGCAGAGAGTATTGGG + Intronic
1000046901 5:157529483-157529505 TCTCAGGTACAGACTGTAATGGG + Intronic
1000076995 5:157799708-157799730 TCTCAATGACAGAATGCATTGGG + Intronic
1000505883 5:162117043-162117065 TCTCAAAAAGAGATTGTTTTGGG + Intronic
1000522405 5:162312560-162312582 TCTCATAAACAGCATGTATTTGG - Intergenic
1002960451 6:1909578-1909600 TCTAGAATACAGATTGTCCTTGG - Intronic
1003979144 6:11373419-11373441 TCCCATATACATATGGTATTGGG - Intronic
1004027704 6:11835369-11835391 TGTCAAACCCAGATTGCATTTGG + Intergenic
1004091347 6:12505378-12505400 TCCCAATTGCAAATTGTATTTGG + Intergenic
1004201672 6:13554572-13554594 TCTGAAATACAAATTTAATTGGG + Intergenic
1005418323 6:25624651-25624673 TTCCAATTACAGTTTGTATTAGG + Intergenic
1005642489 6:27809647-27809669 TATAAAATACACATTGCATTTGG + Intergenic
1007233063 6:40363970-40363992 TATCAAATTCAGATTATTTTAGG - Intergenic
1008227024 6:48933147-48933169 TCTCATATATAGCTTTTATTAGG + Intergenic
1008819618 6:55615071-55615093 TACCAAATACACATTTTATTTGG + Intergenic
1008827338 6:55712871-55712893 TCTCAAATGCAGATTTAGTTTGG - Intergenic
1010649207 6:78431370-78431392 GCTCAAATATGGATTCTATTGGG + Intergenic
1010866691 6:80984314-80984336 TATCTAATACAGACTGTATGGGG + Intergenic
1013871008 6:114759764-114759786 ACTAAAATTCAGATTTTATTTGG - Intergenic
1013945731 6:115720009-115720031 TCTCATAACCAGATTGTATGGGG + Intergenic
1014304065 6:119718307-119718329 TCTCAAATAGAGATAGTCTGAGG - Intergenic
1014396960 6:120935750-120935772 TATTATATACAGACTGTATTAGG - Intergenic
1014587258 6:123214361-123214383 TCTAAAATGCAGGTTGCATTTGG + Intergenic
1015219004 6:130782647-130782669 TCGCAATTAGATATTGTATTAGG - Intergenic
1015350991 6:132219569-132219591 TGTCATATACAGACTGTATGAGG + Intergenic
1016913794 6:149225851-149225873 TCTCAAATTCTGCTTGTTTTTGG - Intronic
1017309769 6:152961365-152961387 TCTCATACACTGAATGTATTTGG - Intergenic
1017655456 6:156623887-156623909 TTTCAAATAAAGATTTTTTTTGG - Intergenic
1018470170 6:164088277-164088299 ACTCATACACATATTGTATTAGG - Intergenic
1020435413 7:8157355-8157377 GCTGAAATACAGAGTGTAATTGG - Intronic
1020624533 7:10561187-10561209 CCTCAAAAACTGACTGTATTTGG - Intergenic
1021293125 7:18870178-18870200 TCTAAACTACAGATTTTATATGG + Intronic
1021552590 7:21887327-21887349 TCTCACATAAAGCATGTATTTGG + Intronic
1021762518 7:23915036-23915058 TCTGTAATAAAGATGGTATTTGG + Intergenic
1022146205 7:27543557-27543579 TCTCACTTATAGATAGTATTTGG - Intronic
1023022545 7:36023297-36023319 ACTAAACTACAGATTTTATTTGG + Intergenic
1024106526 7:46093475-46093497 TCTCAAGAACAGTTTCTATTGGG + Intergenic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1024720382 7:52130226-52130248 TATAAAATATAGATTGTATATGG - Intergenic
1025226057 7:57164564-57164586 TCTCTAATACAAATTCTCTTAGG + Intergenic
1025298081 7:57792672-57792694 TCTCACATAAAGATTATATTTGG - Intergenic
1026420039 7:70225746-70225768 TTACAAAAAAAGATTGTATTAGG + Intronic
1027587891 7:80080634-80080656 TCTCAAATCCATATTGCCTTTGG - Intergenic
1027755955 7:82212261-82212283 TCTGAAATTCAAATTGAATTAGG - Intronic
1028028974 7:85884720-85884742 TCTCAAATACATTTTGGGTTGGG - Intergenic
1030921899 7:115401191-115401213 TCTCAAAGACAGATTCCTTTGGG - Intergenic
1031498065 7:122476648-122476670 TCACAAATACAGACTCTACTCGG + Intronic
1031500587 7:122510031-122510053 TCTCAAATACAGAGTGTTAAAGG + Intronic
1032251753 7:130263427-130263449 TCTCAGAAACAGATTTTACTGGG + Intergenic
1033976224 7:147104049-147104071 ACTCAAATACAGATTATACTTGG - Intronic
1034051326 7:147987432-147987454 TTTCAAATACCATTTGTATTTGG + Intronic
1035553597 8:546584-546606 TCTCAAATTTAGTTTGTACTGGG - Intergenic
1036593253 8:10188210-10188232 TTTTAAATACAGATCTTATTTGG + Intronic
1041214208 8:55583752-55583774 TACCAAATACAAATAGTATTTGG + Intergenic
1044009102 8:86969678-86969700 TCAAAAATACATATTGTAATAGG - Intronic
1047469647 8:125157546-125157568 TCTCAAATTAAGGTTGTGTTCGG + Intronic
1050909488 9:11050091-11050113 GCTAAACTACAGATTTTATTTGG + Intergenic
1051027657 9:12632809-12632831 TCTCAAAGACAGCTTGGATAGGG - Intergenic
1052123190 9:24743136-24743158 TCTCAACTACATCTTGTTTTGGG + Intergenic
1055062598 9:72085673-72085695 TCTGAAATACAGACTGTAAAAGG + Intergenic
1055995210 9:82150056-82150078 TCTCAAATACAATTTTAATTGGG + Intergenic
1057750125 9:97785867-97785889 TCTGATATACACATTGAATTTGG - Intergenic
1059377327 9:113894223-113894245 TCTTAAACATAGTTTGTATTTGG + Intronic
1059671374 9:116495616-116495638 TCTCAAATACAAATCCTATGAGG + Intronic
1061029657 9:128072820-128072842 TTTAAGACACAGATTGTATTTGG - Intronic
1061421559 9:130475504-130475526 TCTAAAATACAATGTGTATTTGG + Intronic
1185796307 X:2967962-2967984 TCTCAAGTACAGATTTTACATGG - Intronic
1186033486 X:5395054-5395076 TCTGAGATAAAGATTATATTAGG - Intergenic
1186061123 X:5708506-5708528 TCTCAAATATAAATTAAATTAGG + Intergenic
1188645264 X:32558857-32558879 TCTCAAATACCTATTATAGTTGG + Intronic
1189530172 X:41872255-41872277 TCTCAATTACATAATGCATTTGG + Intronic
1190052741 X:47163311-47163333 ACTAAACTACAGATTATATTAGG - Intronic
1194274231 X:91859341-91859363 TCTCATATACAGAATCTATAAGG - Intronic
1194641820 X:96411984-96412006 TCTGAAATTCCAATTGTATTTGG + Intergenic
1195467557 X:105196763-105196785 TCTCAAATAGAGACTGGATTAGG + Intronic
1196180336 X:112682696-112682718 TCACCAATACAGATTGGATATGG + Intergenic
1196421667 X:115528569-115528591 TCTCAAATTCAGATTTAACTGGG + Intergenic
1196512376 X:116527545-116527567 TTTAAAATAAAGATTGTAATTGG + Intergenic
1196962901 X:121023256-121023278 TTTTATATACAGGTTGTATTGGG - Intergenic
1197252771 X:124232553-124232575 TCTGAAATTCAAATTGAATTGGG + Intronic
1198633054 X:138663771-138663793 TTTCTGATACAAATTGTATTTGG - Intronic
1198977546 X:142353996-142354018 TCACTAATTCAAATTGTATTGGG - Intergenic
1199508791 X:148596479-148596501 TCTCAAGTACCTATTGTATTTGG - Intronic
1199591300 X:149470489-149470511 TCTCAAATTCAAATTTAATTGGG - Intergenic
1199664942 X:150089130-150089152 TCTCAAATACATAATTTATTTGG + Intergenic
1200301174 X:154978479-154978501 TCTAAAATAAAGAGTGTAATTGG - Intronic
1200591467 Y:5080748-5080770 TCTCATATACAGAATCTATAAGG - Intronic
1200629927 Y:5570829-5570851 TCTCTAATATATATTTTATTGGG - Intronic