ID: 906042451

View in Genome Browser
Species Human (GRCh38)
Location 1:42798566-42798588
Sequence AGAGCCTTCAGAACTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906042447_906042451 -3 Left 906042447 1:42798546-42798568 CCATCCCTTGGAAAGGAGTGAGA No data
Right 906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG No data
906042448_906042451 -7 Left 906042448 1:42798550-42798572 CCCTTGGAAAGGAGTGAGAGCCT No data
Right 906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG No data
906042449_906042451 -8 Left 906042449 1:42798551-42798573 CCTTGGAAAGGAGTGAGAGCCTT No data
Right 906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG No data
906042442_906042451 26 Left 906042442 1:42798517-42798539 CCAGCCGGGTGACTGTGTGCTAC No data
Right 906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG No data
906042443_906042451 22 Left 906042443 1:42798521-42798543 CCGGGTGACTGTGTGCTACTAAG No data
Right 906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906042451 Original CRISPR AGAGCCTTCAGAACTGGTAT TGG Intergenic
No off target data available for this crispr