ID: 906050487

View in Genome Browser
Species Human (GRCh38)
Location 1:42867412-42867434
Sequence CATTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906050487_906050494 25 Left 906050487 1:42867412-42867434 CCTGCCATCTTCTGCAGATAATG No data
Right 906050494 1:42867460-42867482 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
906050487_906050491 15 Left 906050487 1:42867412-42867434 CCTGCCATCTTCTGCAGATAATG No data
Right 906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
906050487_906050490 4 Left 906050487 1:42867412-42867434 CCTGCCATCTTCTGCAGATAATG No data
Right 906050490 1:42867439-42867461 TTCTTTGGAGAGACAGCTCTTGG No data
906050487_906050492 16 Left 906050487 1:42867412-42867434 CCTGCCATCTTCTGCAGATAATG No data
Right 906050492 1:42867451-42867473 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
906050487_906050493 22 Left 906050487 1:42867412-42867434 CCTGCCATCTTCTGCAGATAATG No data
Right 906050493 1:42867457-42867479 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906050487 Original CRISPR CATTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr