ID: 906052843

View in Genome Browser
Species Human (GRCh38)
Location 1:42888645-42888667
Sequence TCATCCAAGAGCAGAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906052843_906052849 22 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052849 1:42888690-42888712 TTCAGTCTCATCGTAGGGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 68
906052843_906052847 17 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052847 1:42888685-42888707 TGCATTTCAGTCTCATCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
906052843_906052846 16 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052846 1:42888684-42888706 GTGCATTTCAGTCTCATCGTAGG 0: 1
1: 0
2: 1
3: 5
4: 84
906052843_906052848 18 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052848 1:42888686-42888708 GCATTTCAGTCTCATCGTAGGGG 0: 1
1: 0
2: 0
3: 6
4: 55
906052843_906052850 23 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052850 1:42888691-42888713 TCAGTCTCATCGTAGGGGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 70
906052843_906052851 30 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052851 1:42888698-42888720 CATCGTAGGGGCTGGGCTCCTGG 0: 1
1: 1
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906052843 Original CRISPR TCATCCAAGAGCAGAGCCGC TGG (reversed) Intergenic