ID: 906052843

View in Genome Browser
Species Human (GRCh38)
Location 1:42888645-42888667
Sequence TCATCCAAGAGCAGAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906052843_906052847 17 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052847 1:42888685-42888707 TGCATTTCAGTCTCATCGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
906052843_906052850 23 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052850 1:42888691-42888713 TCAGTCTCATCGTAGGGGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 70
906052843_906052851 30 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052851 1:42888698-42888720 CATCGTAGGGGCTGGGCTCCTGG 0: 1
1: 1
2: 1
3: 9
4: 153
906052843_906052849 22 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052849 1:42888690-42888712 TTCAGTCTCATCGTAGGGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 68
906052843_906052848 18 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052848 1:42888686-42888708 GCATTTCAGTCTCATCGTAGGGG 0: 1
1: 0
2: 0
3: 6
4: 55
906052843_906052846 16 Left 906052843 1:42888645-42888667 CCAGCGGCTCTGCTCTTGGATGA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 906052846 1:42888684-42888706 GTGCATTTCAGTCTCATCGTAGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906052843 Original CRISPR TCATCCAAGAGCAGAGCCGC TGG (reversed) Intergenic
903551549 1:24160668-24160690 ACATTCAAGAGCAGAGGCCCAGG + Intronic
904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG + Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
907927932 1:58972167-58972189 TCATCTAAGTGCAGAGCCTGGGG - Intergenic
910075760 1:83276973-83276995 TCACCCAAGAGCAGAGTCCTTGG + Intergenic
912734646 1:112139518-112139540 GCTTCCAAGAGAAGAGCTGCTGG - Intergenic
913417629 1:118629192-118629214 TCTTCCAAGACTAGAGCCCCTGG - Intergenic
916747680 1:167697246-167697268 CCATCCAAGAGCAAGGCCCCAGG + Exonic
916991640 1:170251025-170251047 TGCTCCAAGTGCAGGGCCGCGGG + Intergenic
924552658 1:245092713-245092735 TCATTCAATATCAGAGCCCCAGG - Intronic
1066443715 10:35462681-35462703 TCATTCCAGAGCAGAGGGGCTGG + Intronic
1067661325 10:48238098-48238120 TCTTCCAGGAGCAGATCCCCAGG - Exonic
1068827435 10:61455015-61455037 TCATCGAAGAGCAGTTCCCCTGG - Intergenic
1070482805 10:76901804-76901826 GCATCCAGGAGCAGAGCTGTGGG + Intronic
1070820835 10:79353188-79353210 CCAGCCAAGAGCAGAACTGCAGG - Intronic
1071683180 10:87728253-87728275 TCATCCAAGATAAGAGCAGTAGG + Intronic
1074883689 10:117678288-117678310 TCATCAAACAGCAGAGGCCCAGG - Intergenic
1076332672 10:129681945-129681967 TCATCCAAGAGGAGATACGTAGG + Intronic
1076555821 10:131320889-131320911 GCATCCCAGAGCCGAGCCCCAGG + Intergenic
1076629804 10:131845729-131845751 GCATCCAAGAGCAGCTCCGCAGG + Intergenic
1077235282 11:1479160-1479182 ACATGCAGGAGCAGAGCCTCTGG + Intronic
1088083534 11:105950218-105950240 TCACCCAAGACCAGATCCACTGG - Intronic
1089082135 11:115785374-115785396 TCCTGCAAGAGCAGGGCCCCTGG + Intergenic
1089917965 11:122177427-122177449 TCATTCAAAAGCAGAGCTGAAGG - Intergenic
1090480179 11:127061110-127061132 TCAGCCATGAGCAGAGGAGCTGG + Intergenic
1102191066 12:110988663-110988685 CCAGCCAAGAGCAAAGCGGCTGG - Intergenic
1103821786 12:123704545-123704567 TGATCCAGGTGCAGACCCGCTGG + Exonic
1107901096 13:45014906-45014928 TAAACCAAGAGCAGAGCTACAGG - Intronic
1113599313 13:111557539-111557561 TCATCCAGCGGCAGAGCGGCGGG - Intergenic
1115354916 14:32437010-32437032 ACAGCCAAGAGCAGAGTCACAGG - Intronic
1116285437 14:42965529-42965551 TTATTCAAGAGCAGATCAGCAGG + Intergenic
1117101255 14:52350571-52350593 GCATCCAAGAGCAGAAATGCAGG - Intergenic
1122767982 14:104084965-104084987 CCATCCAAGAGAAGAGCCCGAGG - Intergenic
1123625341 15:22223368-22223390 TCATCCCAGAGCACACCCTCCGG + Intergenic
1124707148 15:31975529-31975551 TCATCCAAGATCTGCGCCGCGGG + Intergenic
1128243420 15:66116922-66116944 CCATCCAAGTGCAGAGACTCTGG + Intronic
1128732171 15:70028765-70028787 TTAGCAAAGAGAAGAGCCGCGGG + Intergenic
1131856803 15:96605928-96605950 TCATCCAAGACCTGAGCATCTGG - Intergenic
1135588597 16:23689839-23689861 TCCTGCAAGAGAAGAGCAGCAGG - Exonic
1136473841 16:30499499-30499521 TCATCCCAGAGCATTGGCGCTGG - Intronic
1139389900 16:66600793-66600815 TCATCCAACAGCAGTGCCTAGGG - Intergenic
1140305696 16:73800650-73800672 TCCTCCAAGACCACAGCCCCTGG + Intergenic
1141428847 16:83960614-83960636 GCATCAAAGAGCAGGGCCACGGG - Exonic
1142557985 17:792618-792640 TGAGCCCAGAGCAGAGCTGCTGG - Intergenic
1144583176 17:16471522-16471544 TCAGCCAAGAGCACAGCTGTGGG + Intronic
1145045761 17:19614325-19614347 TGATCCAAGGGCAGAAACGCAGG - Intergenic
1146074270 17:29713509-29713531 TCATGAAAGATCAGAGCTGCAGG + Intronic
1146619762 17:34388227-34388249 TCATCCAAGATCACAGCCCTAGG - Intergenic
1147685793 17:42286329-42286351 TCAACCAAGGGCACAGCCACTGG + Intergenic
1148835232 17:50462463-50462485 TCATCCAGGAGCAGGGTCCCCGG - Exonic
1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG + Intergenic
1151767115 17:76138364-76138386 TCATCCGAGCTCTGAGCCGCAGG + Intronic
1155236608 18:23826124-23826146 TCAGGAAAGAGCAGAGCTGCAGG - Intronic
1164477555 19:28586972-28586994 TCATGCAGGAGCAGGGCCACTGG + Intergenic
1165425434 19:35742867-35742889 TCATCCCAGAGCAGAGAGGCAGG - Intronic
1166377105 19:42333846-42333868 GCATCCAAGAGCAGAGCACAGGG + Intronic
925599324 2:5591595-5591617 TCCTCTAAGAGGAGAGCAGCAGG + Intergenic
925825748 2:7846911-7846933 GCTTCCAAGATCAAAGCCGCTGG + Intergenic
928132785 2:28665211-28665233 TCTTCCTGGAGCAGAGCAGCTGG - Intergenic
928337868 2:30413578-30413600 GCATACAGGAGCAGAGCCACAGG + Intergenic
929929003 2:46237809-46237831 CCATCCAAGAACAGATCTGCAGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG + Intergenic
940177792 2:150898211-150898233 CCATCCAGGAGCACAGCCGTGGG + Intergenic
940958443 2:159755355-159755377 ACATCCAAGACCAGACCCACTGG - Intronic
1169273098 20:4215886-4215908 TCAGCTAAGAGCACAGCTGCAGG - Intergenic
1170536823 20:17348941-17348963 TTAGCCAAGGGCAGAGCCACGGG - Intronic
1171379313 20:24722166-24722188 ACATCAAAGAGCAGAGCAGAGGG - Intergenic
1172193996 20:33079638-33079660 TCAGCCAAAAGCAGAGGGGCTGG + Intronic
1174149858 20:48478303-48478325 TGCTCCAAGAGGAGAGCAGCTGG - Intergenic
1178255900 21:31052449-31052471 CCATTCAAGAGCTGAGCCTCAGG - Intergenic
1179187115 21:39093611-39093633 TCATCCAGGAGCAGAGCGAGAGG + Intergenic
1185150807 22:49162949-49162971 CCATCCTAGAGCAGAGCTACGGG + Intergenic
953805399 3:46063607-46063629 ACACCCAAGGGCAGAGCCTCGGG + Intergenic
955470896 3:59285018-59285040 TCATCCAAGAGCACAGCTGTTGG + Intergenic
956799173 3:72741218-72741240 TCAGCTAAGAGCAGAGCCACAGG + Intergenic
960530812 3:118762176-118762198 TCATCCAAGTTCAGAGCTACCGG - Intergenic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
965054320 3:163695024-163695046 TCATCTGAGAGCAGAGCGGGAGG - Intergenic
966390892 3:179451444-179451466 ACAGCCGAGACCAGAGCCGCCGG + Exonic
970436242 4:16038078-16038100 TCATACAAGGGCAGAGCCGGTGG - Intronic
977977719 4:103286646-103286668 TCAGCCATGACCAGAGCAGCTGG - Intergenic
981116088 4:140992926-140992948 GCACCCGAGAGCAGAGCAGCAGG + Intronic
985378833 4:189371145-189371167 TAACCCCAGAGCAGAGCCACAGG - Intergenic
985632179 5:1019463-1019485 TCGGCCAATAGCAAAGCCGCAGG + Intronic
988467473 5:31504110-31504132 TAAACCAAGGGCAGAGACGCAGG + Intronic
990466764 5:56078330-56078352 TCATCCAGGAGCAAATCCCCAGG + Intergenic
991573319 5:68077870-68077892 CCATCCAAGAGCAAAGCCACTGG - Intergenic
993033304 5:82729128-82729150 CCATCCCAGAGGAGAGCTGCAGG + Intergenic
995963775 5:117878740-117878762 TCATGTAAGAGCAAAGCCACTGG + Intergenic
1006196471 6:32245769-32245791 TCATTAGAGAGCAGAGGCGCTGG + Intergenic
1006635463 6:35458350-35458372 GCAGCCAGGTGCAGAGCCGCAGG - Exonic
1007893623 6:45322840-45322862 TCATCCAAAAGCAGTGGCACTGG + Intronic
1007969726 6:46038442-46038464 TCATCCAAGAGAAGGGCCTCTGG - Intronic
1008880775 6:56378286-56378308 TCATCCAAGAGCTGAGTCCTGGG - Intronic
1009196625 6:60694552-60694574 TCATTAATGAGCAGTGCCGCAGG + Intergenic
1018580876 6:165307743-165307765 ACTTCCAAGAACAGAGCAGCAGG + Intronic
1023751654 7:43378840-43378862 TCAGGCAAGGGCAGAGCAGCAGG + Intronic
1023751743 7:43379561-43379583 TCAGGCAAGGGCAGAGCAGCAGG - Intronic
1027293474 7:76741849-76741871 TCACCCAAGAGCAGAGTCCTTGG + Intergenic
1029694197 7:102202303-102202325 TCACCCAAGAGCAGAGCGTAAGG + Intronic
1031751552 7:125581182-125581204 ACATCCAACAGCAGAGCTCCTGG + Intergenic
1032885588 7:136134676-136134698 TGATTCAATAGCAGAGCCCCGGG - Intergenic
1035102971 7:156416463-156416485 GCATCAAAGAGCAGAGCAGCAGG - Intergenic
1035341160 7:158163092-158163114 TCATCCCAGGGCAGAGCAGGGGG + Intronic
1035352689 7:158257684-158257706 TCCTCCAGGAGCGGAGCTGCAGG - Intronic
1036226345 8:6960970-6960992 GTTTCCAAGAGCAGAGCTGCAGG - Intergenic
1036776143 8:11614107-11614129 TCCTCCCATAGCAGAGCCGAAGG - Intergenic
1037942470 8:22962803-22962825 GCATCCCAGAGCAGAGCCATAGG + Intronic
1042961685 8:74310150-74310172 TCATCTAAGAGCAGAGCAGTTGG + Intronic
1044139854 8:88636944-88636966 TCATCCAAGAGAAGAAACACAGG - Intergenic
1045863543 8:106839582-106839604 TCATCTGAGAGCAGAGCGGGAGG - Intergenic
1046660001 8:116938621-116938643 TCCTCCAGCTGCAGAGCCGCTGG + Intronic
1047298928 8:123596446-123596468 TCCACCAAGAGCACAGCCCCAGG + Intergenic
1049333866 8:142071539-142071561 TCTTCCCTCAGCAGAGCCGCTGG - Intergenic
1049820289 8:144629356-144629378 GGCTCCAAGAGCAGACCCGCAGG + Intergenic
1056786583 9:89596961-89596983 TCATCAGAGAGCAGACCCGAGGG + Intergenic
1059150180 9:111942624-111942646 TCATCTAAGAACAGAGCTGCAGG + Intergenic
1060797461 9:126522374-126522396 TCAGCCAAGAGCACAGACCCAGG + Intergenic
1060985385 9:127816465-127816487 CAATCCAAGAGCAGAGCTGCAGG - Intronic
1061271358 9:129545331-129545353 CCCTCCAAGAGCAGAACAGCAGG - Intergenic
1061393894 9:130332912-130332934 GCATCCAGGAGCAGGGCCGGCGG - Intronic
1061599506 9:131658132-131658154 TCCTCTAAGAGCAGAACGGCTGG + Intronic
1062297258 9:135839120-135839142 TCATACAGGAGCAGAACCGAAGG - Intronic
1186330476 X:8527033-8527055 TCATCAAAGATCAGAGAGGCTGG - Intergenic
1186603214 X:11060922-11060944 TCATCTAAGACCAGAGCAGTGGG + Intergenic
1188637162 X:32448479-32448501 TCAGCCTAGTGCAGAGCCACTGG + Exonic
1195682699 X:107560774-107560796 TCATCAAAGAGAAGAACCTCCGG + Exonic
1201432749 Y:13921846-13921868 TCATCAAAGATCAGAGAAGCTGG + Intergenic
1201489383 Y:14524517-14524539 TCAGCCAAGAGCACAGTCGGAGG + Intronic
1202281513 Y:23195662-23195684 TAATCCAAGAACAGAGTCCCGGG + Intronic
1202284378 Y:23222857-23222879 TAATCCAAGAACAGAGTCCCGGG - Intronic
1202433185 Y:24810047-24810069 TAATCCAAGAACAGAGTCCCGGG + Intronic
1202436052 Y:24837243-24837265 TAATCCAAGAACAGAGTCCCGGG - Intronic